ID: 1171991559

View in Genome Browser
Species Human (GRCh38)
Location 20:31700456-31700478
Sequence TGTAGGATCTTCAAGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171991559_1171991564 3 Left 1171991559 20:31700456-31700478 CCCTGGCACTTGAAGATCCTACA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1171991564 20:31700482-31700504 CTGGTTCTAGCTGACCTTTTTGG 0: 1
1: 0
2: 1
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171991559 Original CRISPR TGTAGGATCTTCAAGTGCCA GGG (reversed) Intronic
900414977 1:2530693-2530715 TGTAGAATGAACAAGTGCCACGG + Intergenic
901793844 1:11669001-11669023 TGTGGGAATTGCAAGTGCCAAGG - Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
907569133 1:55466916-55466938 CGTAGCATCTTCATCTGCCAGGG - Intergenic
910935221 1:92481392-92481414 TGTAGGATCTCCAGGTGCGCGGG - Intronic
913543574 1:119844637-119844659 TGAAGGATCTTAAAGTGCTGTGG - Intergenic
914792636 1:150892120-150892142 AGTGAGATCTGCAAGTGCCAGGG + Intergenic
917330040 1:173871095-173871117 TTTAGGGTCTTCAGGAGCCAAGG + Exonic
918338646 1:183548158-183548180 TAAGGGAACTTCAAGTGCCAGGG - Intronic
919805459 1:201378716-201378738 GGCAAGATCTTTAAGTGCCAGGG - Intronic
1062968706 10:1629633-1629655 TGCAGGATCTGCAGGTGCCCAGG - Intronic
1063425370 10:5946319-5946341 TGTAGTGTCTCCAAGTGACAGGG + Intronic
1065318285 10:24485519-24485541 TGTTGCAACTTCAAGTGTCATGG - Intronic
1066235788 10:33482993-33483015 TGAATGATCTTCTAGTGCCCAGG + Intergenic
1067559508 10:47295108-47295130 AGTGGGATTGTCAAGTGCCATGG - Intergenic
1068911850 10:62387091-62387113 TGTATGTTCTGCAAGTCCCAGGG - Intronic
1070284201 10:75071630-75071652 TGAAGGATCTTCATGGGCAAAGG - Intergenic
1070374288 10:75814141-75814163 AGCAGGATCTTCAAGTTCAAGGG - Intronic
1071432112 10:85614384-85614406 TCTAGCATGTTCTAGTGCCAAGG + Intronic
1081659533 11:44879562-44879584 AGTAGGATCGGCAGGTGCCAAGG + Intronic
1088095576 11:106096825-106096847 TGAAGGATCTTCAGGTGTCATGG - Exonic
1088746436 11:112808423-112808445 TGTCTGATCCTCAAGTACCACGG + Intergenic
1091606192 12:1953536-1953558 TATAAGATCTTCAAGGGCCTGGG + Intronic
1096456310 12:51790177-51790199 TCTAAGATCTTCCAGTCCCAAGG - Intronic
1100591684 12:96035689-96035711 TGAAGGAACTACAAGTTCCATGG + Intronic
1101471781 12:105003998-105004020 TATAGGAACTACAAGTACCAAGG + Intronic
1107087363 13:36440203-36440225 TCTAGGAACTTCCAGTGCCAAGG + Intronic
1108116322 13:47132529-47132551 TCTGGGATCTTCAAGTTCCCTGG - Intergenic
1109066770 13:57704860-57704882 TGTAGGATCTGCACTTGCTAAGG + Intronic
1109984457 13:69959882-69959904 GGGAGGATTTTTAAGTGCCAAGG - Intronic
1111866888 13:93779902-93779924 AGTAGCATCTTCCAGTCCCAGGG - Intronic
1113401173 13:109994731-109994753 TGTAGTATCTTCAGGTCCCTAGG - Intergenic
1116638352 14:47427380-47427402 GCTATGATCTTCAAATGCCACGG + Intronic
1118733542 14:68686091-68686113 GGTAGGCTCTTCACCTGCCAGGG + Intronic
1119127174 14:72138174-72138196 TATGGAATCTTCAAATGCCAAGG + Intronic
1124411060 15:29437562-29437584 TGAAGGATAATCAAGAGCCAGGG - Intronic
1128956147 15:71947751-71947773 TGAAGGATCAGCAATTGCCAGGG - Intronic
1131663523 15:94544478-94544500 TGTAGCATCTGCCAGAGCCAGGG - Intergenic
1134009250 16:10839046-10839068 TGCTGGATTTTCGAGTGCCAAGG - Intergenic
1136015740 16:27399645-27399667 AGAAGGATCTGCAAGTGCAAAGG - Intergenic
1136931890 16:34426046-34426068 TGGAAGATTTTAAAGTGCCAAGG + Intergenic
1136972682 16:34985769-34985791 TGGAAGATTTTAAAGTGCCAAGG - Intergenic
1137231613 16:46572152-46572174 TCTGGCTTCTTCAAGTGCCAGGG - Intergenic
1139496143 16:67319986-67320008 TATAGGATTTTCAAGAGCCAGGG + Intronic
1140034605 16:71362823-71362845 TGTAAAATTTTCAAGTGCTATGG - Intronic
1151015022 17:70543959-70543981 TCTAGGAACTGCAAGAGCCATGG - Intergenic
1151378010 17:73704778-73704800 TGTAGGAGATCCAAGTGCCTAGG + Intergenic
1152630608 17:81409210-81409232 TGTAGCATCTTCAGTTGTCATGG + Intronic
1155317022 18:24582096-24582118 TGTAGGATGTTCAAGTGGAGGGG + Intergenic
1156883580 18:42108656-42108678 TGTAGGAACCTCTAATGCCAAGG - Intergenic
1156979587 18:43269102-43269124 TGTATCATTTTCCAGTGCCAGGG - Exonic
1157358118 18:46953848-46953870 TGTAGGATAATCAGGTACCAGGG + Intronic
1160003693 18:75052469-75052491 TGGAGGATCTTCAAGGGACATGG - Intronic
1163665719 19:18603401-18603423 AGTGGGAGCTGCAAGTGCCAAGG + Intronic
925221011 2:2141065-2141087 TGTAAGATATTCAAATCCCATGG + Intronic
928352435 2:30572093-30572115 TGTTGAATTTTCAAATGCCATGG + Intronic
931867622 2:66429554-66429576 TATAGAATCTTCAAGTCTCACGG - Intergenic
936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG + Intronic
937352892 2:121178062-121178084 GGTAGGATCATCACCTGCCATGG + Intergenic
941812416 2:169768071-169768093 TGCAGGATCTGCAGGTCCCAAGG - Intronic
942215939 2:173719049-173719071 TTGAGAATCTTCATGTGCCAGGG - Intergenic
942417377 2:175773116-175773138 TGAAGGATTTTAAAGAGCCACGG + Intergenic
943978199 2:194510330-194510352 TGTAGGTTCATAAAGTGCTATGG - Intergenic
948647898 2:239420152-239420174 GGTAGGACCTTCAAGAGCAACGG - Intergenic
1169129001 20:3153642-3153664 TCTAGGATTTCCAGGTGCCAGGG + Intronic
1171142187 20:22752946-22752968 TCTAGCACCTTCCAGTGCCATGG - Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1175147914 20:56910756-56910778 TGTAGGCTATTCCAGAGCCAGGG + Intergenic
1178502637 21:33138458-33138480 TGTAGGAACTGCAAATACCATGG - Intergenic
1184244301 22:43228137-43228159 TGTCTGATCTTCAAGTGGCCTGG + Intronic
949921812 3:9008952-9008974 TGTAGGATCTTCCGGTGCAGTGG - Intronic
951425191 3:22536541-22536563 TGTAGGATCTTAAAGTTAGAAGG - Intergenic
953211280 3:40877467-40877489 AGTAGGAAGTTCAAGTGCAATGG + Intergenic
955576418 3:60369270-60369292 TCTAGGATCAAAAAGTGCCATGG - Intronic
961624947 3:128255270-128255292 TGAAGGATAGTCAAGGGCCATGG + Intronic
962278701 3:134034347-134034369 TGTGGGCTCTTCAAGGGCAAAGG + Intronic
962781917 3:138727143-138727165 TGGAAGATGTTCAAGTGCCAGGG + Intronic
969143745 4:5102248-5102270 TGCAGGATCATCAAGAGCCCAGG - Intronic
970986535 4:22165739-22165761 TGAAAGATCTTCAAATGCCCAGG + Intergenic
977918922 4:102622973-102622995 GGTAGGATCTTAAAGGGCCAGGG - Intergenic
978480482 4:109184580-109184602 TGAAAGAACTTCAAGTTCCAGGG + Intronic
978739185 4:112118729-112118751 TGTAGCATTTTCAATTTCCATGG + Intergenic
980138007 4:128879376-128879398 TATAGGTTCTCCAAGTGTCATGG - Intronic
988894529 5:35657618-35657640 TGTAGGATCATCAACTGAGATGG + Intronic
989572070 5:42954145-42954167 TGGAGGATCCTCAAATACCAGGG + Intergenic
989582422 5:43045310-43045332 TGGAGGATCCTCAAATACCAGGG - Intergenic
991984702 5:72272712-72272734 AGTACGATCTTCAGGTTCCATGG - Intronic
992271779 5:75071861-75071883 TCTAGGAACTGCCAGTGCCATGG - Intronic
992301559 5:75387231-75387253 TCTAGGAACTGCCAGTGCCATGG - Intronic
993668068 5:90725842-90725864 TATATTATCTTCAAGAGCCAAGG + Intronic
998007428 5:138666255-138666277 TGTAGGCTCTTCAGGAACCAGGG - Intronic
998182462 5:139955109-139955131 TGTAAGCTCTTCAAGGGCCGGGG - Intronic
998215057 5:140231706-140231728 TGTAGGAACAGCAGGTGCCAAGG + Intronic
1002060955 5:176625751-176625773 TGTAGGAACAGCAAGTACCAAGG - Intronic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1007996273 6:46311537-46311559 TGGAAGAACTGCAAGTGCCAAGG + Intronic
1008737961 6:54570381-54570403 TGTTGTAGCTGCAAGTGCCAGGG + Intergenic
1010087769 6:71940652-71940674 AGAAGGATTTTCAAGTGCTAGGG + Intronic
1011078320 6:83461920-83461942 TGTAGGACCTCCAAGTGTCATGG - Intergenic
1013636964 6:112038266-112038288 AGTCGGAGGTTCAAGTGCCAAGG - Intergenic
1016448998 6:144161698-144161720 TGCTGGAACTTCAAGTGCTATGG + Intronic
1020186568 7:5963325-5963347 AGGAGGATCTCCAAGTTCCAGGG - Intronic
1020296348 7:6761449-6761471 AGGAGGATCTCCAAGTTCCAGGG + Intronic
1026944730 7:74308258-74308280 TGCAGGAGCCTCCAGTGCCAGGG + Intronic
1034955303 7:155330075-155330097 TGAAGGATCTTCAGGTGGCGGGG + Intergenic
1038596211 8:28889265-28889287 TGTAGGGACTTCATGAGCCAAGG - Intronic
1038973764 8:32668418-32668440 TGTAGGTTATTGAAGTGTCAGGG + Intronic
1039791010 8:40875596-40875618 TGTGGTATCTTCATGGGCCATGG + Intronic
1040055580 8:43054775-43054797 AGTAGTATTTTCAGGTGCCACGG + Intronic
1045154447 8:99451605-99451627 TGTAGGATTTCCAAATTCCATGG + Intronic
1047898663 8:129396237-129396259 TGTAGGATCACGAAGTCCCAGGG - Intergenic
1047981085 8:130183131-130183153 CGAAGAGTCTTCAAGTGCCACGG - Intronic
1050213354 9:3290860-3290882 TGTTGTTTCTTCAAATGCCAAGG - Intronic
1051954568 9:22675758-22675780 TGTATTATCCTCAAGTGCCATGG - Intergenic
1055544446 9:77354023-77354045 TATTAGATCTTAAAGTGCCAAGG - Intronic
1055975514 9:81950957-81950979 TGTCAGCTCTTCAAGTGCCCTGG - Intergenic
1056222918 9:84467806-84467828 AGTAAGATCATCAGGTGCCAGGG - Intergenic
1057299725 9:93870826-93870848 TGTAGAATCCTCTAGTTCCAGGG - Intergenic
1058662586 9:107280636-107280658 TGAAGGAACCTCAAGTGCAAAGG + Intergenic
1058770138 9:108222937-108222959 TGTAGGATCTGCAAGAAGCATGG - Intergenic
1188099000 X:26059065-26059087 TGTAGCATTTTCTAATGCCAAGG - Intergenic
1193204985 X:78737245-78737267 TGAAGGGTCTTAAATTGCCAAGG - Intergenic
1196595912 X:117545374-117545396 AGTAGGATTTTGAAGTGCCTCGG - Intergenic
1200366082 X:155666097-155666119 TGAAGGATCAGCAAGTGCAAAGG + Intronic
1202299241 Y:23393949-23393971 GCTAGGATTTTCCAGTGCCAAGG - Intergenic
1202571568 Y:26276649-26276671 GCTAGGATTTTCCAGTGCCAAGG + Intergenic