ID: 1171993823

View in Genome Browser
Species Human (GRCh38)
Location 20:31717191-31717213
Sequence AGCCCCATGATGGAAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 345}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171993819_1171993823 16 Left 1171993819 20:31717152-31717174 CCACATTAAACTCAGGCAAAACC 0: 1
1: 0
2: 1
3: 6
4: 127
Right 1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG 0: 1
1: 0
2: 5
3: 28
4: 345
1171993815_1171993823 29 Left 1171993815 20:31717139-31717161 CCCCTATGTCTATCCACATTAAA 0: 1
1: 0
2: 1
3: 16
4: 254
Right 1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG 0: 1
1: 0
2: 5
3: 28
4: 345
1171993816_1171993823 28 Left 1171993816 20:31717140-31717162 CCCTATGTCTATCCACATTAAAC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG 0: 1
1: 0
2: 5
3: 28
4: 345
1171993817_1171993823 27 Left 1171993817 20:31717141-31717163 CCTATGTCTATCCACATTAAACT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG 0: 1
1: 0
2: 5
3: 28
4: 345
1171993820_1171993823 -5 Left 1171993820 20:31717173-31717195 CCACAGTTGCTTCAAGAAAGCCC 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG 0: 1
1: 0
2: 5
3: 28
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171993823 Original CRISPR AGCCCCATGATGGAAGGCTG AGG Intronic
900004566 1:36204-36226 TGCCACAAGTTGGAAGGCTGGGG + Intergenic
900024288 1:206720-206742 TGCCACAAGTTGGAAGGCTGGGG + Intergenic
900205691 1:1431114-1431136 GGCCCCACGTTGGAAGGCAGGGG + Intergenic
900314625 1:2050646-2050668 GGCCCCAAGATGGAAGGGAGCGG + Exonic
900604713 1:3518823-3518845 AGGGCCAGGATGGCAGGCTGGGG + Intronic
901627587 1:10632724-10632746 AGCCCCATGCTTGGAGGCCGGGG + Intergenic
902390678 1:16103207-16103229 AAGCCCATGCTGGAAGGTTGTGG - Intergenic
904324852 1:29721782-29721804 TGCCCCATGACTGGAGGCTGGGG + Intergenic
905119698 1:35672264-35672286 AGCTCCAAGTTGGAAGACTGAGG + Intergenic
905222202 1:36456022-36456044 AACCCCATGGAGAAAGGCTGGGG - Intronic
905257484 1:36694346-36694368 AGCCCCATGCAGCTAGGCTGAGG - Intergenic
909075297 1:71045821-71045843 AGCACCATGGCGAAAGGCTGAGG + Intronic
911283398 1:95959353-95959375 ACACCCACGCTGGAAGGCTGTGG + Intergenic
912648162 1:111414793-111414815 GGCCCCTAGAAGGAAGGCTGTGG - Exonic
912933826 1:113985991-113986013 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
913113891 1:115679498-115679520 GGCCCCGTGCTGGAAGGCGGTGG + Intronic
914768276 1:150659325-150659347 ATGCCCATGCTGGAAGGTTGTGG + Intronic
914982182 1:152424567-152424589 ACACCCATGCTGGAAGGTTGTGG - Intergenic
915379634 1:155428565-155428587 ACACCCACGCTGGAAGGCTGTGG + Intronic
915401321 1:155624054-155624076 AAGCCCATGCTGGAAGGTTGTGG + Intergenic
919827338 1:201512649-201512671 AGTCCCAGGCTGGGAGGCTGAGG - Intergenic
919905198 1:202073669-202073691 GGCCCCATCTTGGAAGGCTTTGG + Intergenic
920792767 1:209108387-209108409 AGTCCCATCTTGGGAGGCTGAGG - Intergenic
920815324 1:209325823-209325845 AGCCCCATGCTGGATAGCAGAGG + Intergenic
921226548 1:213025871-213025893 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
921403213 1:214749375-214749397 AGCCCCACTTTGGGAGGCTGAGG - Intergenic
921939994 1:220829427-220829449 AGCTCCAGGAAGGAAGGTTGTGG + Intergenic
922378005 1:224988885-224988907 ATCCCATTAATGGAAGGCTGAGG - Intronic
922556829 1:226539020-226539042 GACCCGATGCTGGAAGGCTGTGG - Intergenic
923031798 1:230255108-230255130 AGCCCCATGATGGGATGGTCAGG + Intronic
1063623423 10:7667816-7667838 AGCCGCAGGATGGGAGGGTGTGG - Intergenic
1065390671 10:25177371-25177393 AGTCCCATGAGGGAAGGCTCTGG + Intronic
1066541977 10:36457332-36457354 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1067151090 10:43735497-43735519 AGCCCCATGAAGGAGGGGTTGGG + Intergenic
1068671210 10:59725449-59725471 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1069056215 10:63847529-63847551 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1069513377 10:69058336-69058358 AGCCGCAACAGGGAAGGCTGGGG - Intergenic
1069860450 10:71467973-71467995 TTCCCCATGAAGGAAGGCTCAGG - Intronic
1070616973 10:77976739-77976761 AGCCCCATGATAGGGGTCTGAGG + Exonic
1070718433 10:78739553-78739575 AGCCCCAGGCAGGAAAGCTGGGG - Intergenic
1071507285 10:86240445-86240467 AGCCCCATGCTGGAGGGCCAGGG + Intronic
1071522382 10:86339346-86339368 AGCCCCATGCGGGAAGCCTGGGG + Intronic
1072788924 10:98303502-98303524 AGCCCTTGAATGGAAGGCTGGGG - Intergenic
1073318566 10:102599971-102599993 AGCCCCATACTGGATGCCTGTGG + Intronic
1073425667 10:103454192-103454214 AACCCCATGATGGCGGGCCGGGG + Exonic
1076416144 10:130290909-130290931 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1076479918 10:130778144-130778166 AGCCCTAGAATTGAAGGCTGTGG - Intergenic
1076546040 10:131246294-131246316 AGCACCATGAAGGAAGGCTGGGG + Intronic
1076849705 10:133086867-133086889 AGCCCCATAATGAGAGGCCGGGG + Intronic
1077151470 11:1074887-1074909 AGCCCCATGGTGGCTGGCAGGGG - Intergenic
1077406583 11:2385102-2385124 AGCGCCAAGATGGCAGCCTGGGG + Intronic
1077640018 11:3873062-3873084 AGTCCCAGCTTGGAAGGCTGAGG - Intronic
1078010500 11:7569777-7569799 AGGCCCTGGCTGGAAGGCTGAGG + Intronic
1078196257 11:9139379-9139401 GGCCACATGCTGGAAGCCTGAGG - Exonic
1078310578 11:10237094-10237116 AGCCACATTTTGGGAGGCTGAGG + Intronic
1080328495 11:31107813-31107835 AACCCCGTGACAGAAGGCTGGGG - Intronic
1080414771 11:32059012-32059034 TGCCCCATAATGGAATGCAGTGG + Intronic
1081708971 11:45204937-45204959 AGCCCCCTGATGGAGGCCTAGGG - Intronic
1083325956 11:61873136-61873158 CCCCCCATCATGGAGGGCTGTGG + Intergenic
1083609651 11:63998864-63998886 AGCCTCAGGCTGGAAGGCAGAGG + Exonic
1083635025 11:64116253-64116275 ACCACCATGGTGGATGGCTGGGG - Exonic
1085201773 11:74706307-74706329 GGACCCATGATGGGAGGCTAGGG + Intronic
1087064519 11:94014993-94015015 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1088216686 11:107518506-107518528 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1088743389 11:112785016-112785038 AGCCCCATGCTGGAATGGAGCGG - Intergenic
1088866168 11:113850049-113850071 AGACCCATGAGGGGAAGCTGAGG + Intronic
1088983576 11:114886297-114886319 ATCCCAATGCTGGAAGGCCGAGG - Intergenic
1091280086 11:134376757-134376779 AGCCCCGTGAAGGTGGGCTGGGG + Intronic
1091377985 12:38256-38278 TGCCACAAGTTGGAAGGCTGGGG + Intergenic
1091716536 12:2781321-2781343 AGGCCCACGCTGGAAGGTTGTGG - Intergenic
1092150613 12:6245824-6245846 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1092292604 12:7171481-7171503 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1093427153 12:19040908-19040930 AGACCCATCATGGAAGGATGGGG + Intergenic
1093492506 12:19721168-19721190 AGCCCCTTGATGACAGGCTCTGG + Intergenic
1094502390 12:31033048-31033070 ACTCCCATGTTGGAAGGCAGGGG + Intergenic
1094573875 12:31665917-31665939 ACACCCACGCTGGAAGGCTGTGG - Intronic
1096100202 12:48966231-48966253 AGCCGCCTGTTGGATGGCTGTGG - Exonic
1096358528 12:50963544-50963566 AGCCCCAGGATGAAAGGCATTGG - Intronic
1100267976 12:92996426-92996448 AGCTGCATGAGGGATGGCTGAGG + Intergenic
1101040769 12:100753258-100753280 AGCCACATGATGAAAGGCTGTGG + Intronic
1101181314 12:102221401-102221423 AGCCGGATTTTGGAAGGCTGTGG + Intergenic
1102124493 12:110469088-110469110 AGCCCCGTGGAGGAGGGCTGCGG + Intronic
1102463034 12:113112062-113112084 TGCGCCAGGATGGGAGGCTGAGG - Intronic
1103385330 12:120527945-120527967 ACCCCCAGGCTGGAAGGCAGTGG - Intronic
1104617546 12:130283270-130283292 AGCCCCAGGGAGGATGGCTGAGG + Intergenic
1105434085 13:20362344-20362366 TCCCCCATTATGGAACGCTGCGG + Intergenic
1105697472 13:22903061-22903083 ACACCCATGCTGGAAGGTTGTGG + Intergenic
1106468234 13:30031850-30031872 AGTCCTATGATGGAAGGCATGGG - Intergenic
1106694883 13:32162700-32162722 AGCCAGAAGGTGGAAGGCTGTGG - Intronic
1107116664 13:36754593-36754615 TGCCTCATGCTGGAAGCCTGGGG - Intergenic
1107421892 13:40255030-40255052 TGCCCCATGATGGGGGGCAGGGG - Intergenic
1109155712 13:58906507-58906529 AGGCCCCTGGTGGAAGGCTCAGG + Intergenic
1110027866 13:70565028-70565050 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1111812955 13:93115119-93115141 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1115128342 14:30023416-30023438 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1115233612 14:31187240-31187262 AGCTCCCTGCTGGGAGGCTGAGG + Intronic
1115418562 14:33166019-33166041 AGCCCCATGAGGATAGTCTGTGG + Intronic
1115546029 14:34465474-34465496 AGCCGGATTATAGAAGGCTGAGG + Intergenic
1116672461 14:47861138-47861160 ACACCCATGCTGGAAGGTTGTGG + Intergenic
1118453852 14:65928089-65928111 TGCCCCTTCCTGGAAGGCTGCGG + Intergenic
1119471267 14:74901171-74901193 ATCCCCAGGATGGCAGACTGAGG - Exonic
1119674230 14:76541882-76541904 AGCCAGAGAATGGAAGGCTGGGG + Intergenic
1120073562 14:80130446-80130468 AGCCCCATTCTGGAACCCTGAGG + Intergenic
1120261285 14:82189183-82189205 ACACCCAAGCTGGAAGGCTGTGG + Intergenic
1121304778 14:92899225-92899247 AGCCCCATGAAGACAGGATGGGG - Intergenic
1121864645 14:97351298-97351320 AGCCACGTGCTGGAAGCCTGTGG + Intergenic
1121883066 14:97517691-97517713 CTCCCCAGAATGGAAGGCTGGGG - Intergenic
1122206591 14:100150789-100150811 GGGCCCCTGAGGGAAGGCTGGGG - Intronic
1123070432 14:105640138-105640160 AGCCCCACGGTGCAAGGGTGAGG - Intergenic
1123673457 15:22684219-22684241 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1125127804 15:36244716-36244738 AGCCACACCTTGGAAGGCTGAGG + Intergenic
1125527747 15:40388772-40388794 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1128215417 15:65930979-65931001 TGCTCCATGTTGGATGGCTGTGG + Intronic
1128370212 15:67034753-67034775 AGCCTCAAGGTGGAAGCCTGGGG + Intergenic
1128608837 15:69058123-69058145 AACCCCATGATGGCAGCCTTGGG - Intronic
1129379594 15:75156702-75156724 AGCCCCATGAGGGCAGGATGGGG + Intergenic
1129676938 15:77636794-77636816 AACCCCATCATGGAGGGCTGTGG - Intronic
1131905045 15:97133881-97133903 AGCCTCATGACAGGAGGCTGAGG + Intergenic
1132448942 15:101954740-101954762 TGCCACAAGTTGGAAGGCTGGGG - Intergenic
1132636540 16:952579-952601 TGTCCCAGGATGGAAGGCTGTGG - Intronic
1132822187 16:1879795-1879817 AGCCCCAAGAAGGAAGGTGGTGG - Intronic
1132975831 16:2710640-2710662 AGCCCCAGGAAAGAAGTCTGTGG - Intergenic
1133329126 16:4960417-4960439 AGTCCCTGGATAGAAGGCTGGGG - Intronic
1133707330 16:8367303-8367325 AGCTCCATGAGGGCAGGCAGTGG - Intergenic
1133774736 16:8887666-8887688 AGCCCCATCATGCCAGGCTTTGG - Intergenic
1134124517 16:11607227-11607249 AGGCCTGTGATGCAAGGCTGAGG - Intronic
1135480496 16:22816986-22817008 GGCTCCAGGATGGAAGCCTGAGG - Intronic
1135866332 16:26105745-26105767 AGCCCCATGGGGGAAGCCTGGGG - Intronic
1136252161 16:29012443-29012465 ATCCACATGATGGAAGGAGGAGG - Intergenic
1136287339 16:29252320-29252342 AGCCCCATGGTGGGATGGTGGGG + Intergenic
1137660005 16:50197065-50197087 ATCCCCAGGCTGGAAGGCAGTGG - Intronic
1138476943 16:57276690-57276712 ATCACCATGTTGGGAGGCTGTGG + Intronic
1140299334 16:73740796-73740818 AAGCCCCTGATGGAAGGCAGGGG - Intergenic
1140432077 16:74912972-74912994 ATGCCCACGCTGGAAGGCTGTGG - Intronic
1142092952 16:88224949-88224971 AGCCCCATGGTGGGATGGTGGGG + Intergenic
1143717153 17:8782285-8782307 ATCCCCAGGATGGAAGCATGAGG - Intergenic
1143788368 17:9273598-9273620 AGCGCCATGAGGAAAGGATGTGG - Intronic
1144064262 17:11610565-11610587 AGGCACATGCTGGAAGTCTGGGG + Intronic
1145323753 17:21782231-21782253 AGCCCCAACATGGAAGGCATGGG + Intergenic
1145863284 17:28225363-28225385 AGCCCCAGGACAGATGGCTGTGG - Intergenic
1147248024 17:39134897-39134919 AGCTGCATGATGGAAACCTGGGG - Intronic
1147891884 17:43723129-43723151 AGGCCCATCATGTGAGGCTGTGG - Intergenic
1147927666 17:43955355-43955377 AGCCCCAGGACAGATGGCTGTGG + Intronic
1148002434 17:44397724-44397746 GGGCCCAGGATGGATGGCTGAGG + Exonic
1148332761 17:46821901-46821923 AGCCCCATGAGGGCGGGCGGGGG - Intronic
1148762962 17:50017611-50017633 GGCCTCATGATGGAAGTTTGAGG + Intergenic
1148911490 17:50945244-50945266 AGCCTCATGAAAGGAGGCTGGGG + Intergenic
1149000431 17:51751964-51751986 AGCTCCATGATGGCAGGGAGAGG - Intronic
1149547784 17:57517305-57517327 AGCCCCATGAAGAAACTCTGGGG + Intronic
1149676204 17:58464881-58464903 AGCACCATTTTGGGAGGCTGAGG - Intronic
1150482068 17:65518292-65518314 AGCCACAAGATGGCAGGGTGGGG - Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1151509048 17:74547168-74547190 AGTCCCATGATGTGAGTCTGGGG - Intergenic
1151539926 17:74759612-74759634 AGCGCCCGGAAGGAAGGCTGTGG + Intronic
1152064273 17:78101853-78101875 ACGCCCATGCTGGAAGGTTGTGG - Intronic
1157327645 18:46680572-46680594 AGCCCCAGGGTGCAAGGGTGGGG - Intronic
1157599546 18:48885662-48885684 AGGCCCATCTTGGGAGGCTGGGG - Intergenic
1158087607 18:53671734-53671756 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1158608492 18:58917415-58917437 AGTCTCAGGATGGAAGGCTGGGG + Intronic
1159195669 18:65110879-65110901 AATCCCATGCTGGAAGGTTGTGG - Intergenic
1160314376 18:77827458-77827480 AGCCCCTTTGGGGAAGGCTGAGG + Intergenic
1160636318 19:77813-77835 TGCCACAAGTTGGAAGGCTGGGG + Intergenic
1160976353 19:1794580-1794602 AGCCCCATGTTGGCAGGGGGTGG + Intronic
1161702390 19:5802586-5802608 AGCTTAATGATGGAGGGCTGGGG + Intergenic
1161823747 19:6547842-6547864 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1161854407 19:6755028-6755050 GGCCCCATGGTGGGAGGCCGAGG - Exonic
1163108200 19:15140184-15140206 AGCCCCTTGAGGGTGGGCTGTGG - Intergenic
1163315053 19:16535832-16535854 GGCCCGAAGATGGAATGCTGAGG - Intronic
1163583415 19:18151636-18151658 AGCTCCAGGATGGAAGGAGGGGG - Exonic
1163745402 19:19043648-19043670 AGCCCCAAGGGAGAAGGCTGTGG + Intronic
1163897079 19:20068661-20068683 GACCCGATGCTGGAAGGCTGTGG + Intergenic
1163935002 19:20434600-20434622 GACCCAATGCTGGAAGGCTGTGG + Intergenic
1163938107 19:20469244-20469266 GACCCGATGCTGGAAGGCTGTGG - Intergenic
1163949236 19:20568661-20568683 GACCCAATGCTGGAAGGCTGTGG + Intronic
1164024488 19:21338768-21338790 AAGCCCATGCTGGAAGGTTGTGG - Intergenic
1164261655 19:23572974-23572996 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1164291953 19:23877369-23877391 ACCCCACTGATGGAAGGGTGAGG + Intergenic
1165469619 19:35995786-35995808 AGCCCCGTGATGGACGGCAAGGG + Exonic
1165572381 19:36786208-36786230 AACCACATGCTGGAGGGCTGGGG + Intergenic
1165902534 19:39175422-39175444 TGACCCATGATGGCAGGGTGAGG + Exonic
1166185622 19:41137095-41137117 AGACCCAGAATGGGAGGCTGCGG + Intergenic
1167346438 19:48948419-48948441 ACGCCCATGCCGGAAGGCTGTGG + Intergenic
1167917689 19:52755453-52755475 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1168511360 19:56976321-56976343 ACCAGCATGTTGGAAGGCTGAGG + Intergenic
925611204 2:5705255-5705277 AGCCCCAAGAAGGAAGGCTGGGG + Intergenic
925647767 2:6054581-6054603 AGCTCCATGATGTACGGCAGAGG + Intergenic
926337724 2:11876782-11876804 AGCCCCATGCTGGGAAGCAGGGG - Intergenic
926364610 2:12121705-12121727 ATGCCCATGGAGGAAGGCTGTGG - Intergenic
927091756 2:19717814-19717836 AGCCCCTTGGGGGAAGGCTTTGG - Intergenic
927578527 2:24220632-24220654 AGCCCCATCAAGGAAGGACGGGG - Intronic
927641456 2:24848159-24848181 ACGCCCATGCTGGAAGGTTGTGG + Intronic
928274939 2:29892082-29892104 ACCCCCACCATGGAAGGATGTGG + Intronic
930336189 2:50049250-50049272 GGCCACATGATGGAAGACAGAGG + Intronic
930946820 2:57084992-57085014 AGCCCCATCATGGTAGACTCTGG + Intergenic
931702162 2:64918070-64918092 AGACTCCTGATGGAGGGCTGGGG + Intergenic
933729596 2:85446669-85446691 GGCCCAATGTAGGAAGGCTGGGG + Intergenic
935185387 2:100727081-100727103 AGAACCATGAAGGCAGGCTGTGG + Intergenic
936376001 2:111942045-111942067 AGCCCCAGGAAGGCAGCCTGAGG - Intronic
936565163 2:113577237-113577259 TGCCACAAGTTGGAAGGCTGGGG - Intergenic
937955178 2:127418210-127418232 AGCCCCATAGTGGCTGGCTGAGG - Intergenic
937983903 2:127630044-127630066 ACCCCCATGATGGAAGAGGGAGG - Intronic
938658743 2:133464064-133464086 AGCCCGTTGATGGAAAGTTGGGG - Intronic
938789746 2:134666175-134666197 AGCCCCATGGTGGAAGGTGGTGG - Intronic
940283771 2:152013532-152013554 AGTCCCATGATGGAATCCTGGGG + Intronic
940779936 2:157922402-157922424 AGCCCCAGAATGGAGGCCTGTGG - Intronic
941239085 2:163014788-163014810 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
941873790 2:170412859-170412881 AGCCCCATCAGGGAGGCCTGGGG + Intronic
942327462 2:174788065-174788087 AGCTCCAGGATGGCTGGCTGAGG + Intergenic
943062562 2:183053646-183053668 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
943286492 2:186008037-186008059 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
945772327 2:214059781-214059803 ATCCCCATGTGTGAAGGCTGGGG - Intronic
947403686 2:229753078-229753100 AACCGGATGAAGGAAGGCTGTGG - Intergenic
947642878 2:231716707-231716729 AGACCCATGAGCGTAGGCTGAGG - Intergenic
947977974 2:234384223-234384245 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1169113833 20:3049836-3049858 AGCCCCATGCTGGACAGCAGTGG - Intergenic
1171246104 20:23610955-23610977 AGCCCGATGATGGGAGGGTGTGG - Intergenic
1171439066 20:25146930-25146952 AGCCCCACGCAGGAAGGCAGAGG + Intergenic
1171993823 20:31717191-31717213 AGCCCCATGATGGAAGGCTGAGG + Intronic
1172436404 20:34931754-34931776 AGCCTCATAATGGAAGGATGGGG - Intronic
1173524703 20:43722777-43722799 AGCCCCACTTTGGGAGGCTGAGG - Intergenic
1175169690 20:57071462-57071484 AGCCACATGATGGAAGGCTCAGG - Intergenic
1175444483 20:59010617-59010639 TGCCCCAAGCTGGAAGGCGGTGG - Intergenic
1175706598 20:61183171-61183193 CGCCCCTTGCTGGCAGGCTGGGG - Intergenic
1175732992 20:61366761-61366783 ACGCCCATGCTGGAAGGTTGTGG - Intronic
1175778027 20:61665217-61665239 AGCACCATGCTGGTGGGCTGGGG + Intronic
1176008214 20:62877541-62877563 TGCCCCGTGACGGAAGGATGTGG + Intergenic
1177683852 21:24410965-24410987 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1178423770 21:32462641-32462663 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1178480259 21:32974246-32974268 ACCCCCATGGGGGCAGGCTGGGG + Intergenic
1182226888 22:28805677-28805699 ACGCCCAAGCTGGAAGGCTGTGG - Intergenic
1182468355 22:30532043-30532065 AGCCCCATCTTGGATGGGTGGGG - Intronic
1183328360 22:37206444-37206466 AGGCCCATGATGGGATGTTGAGG - Exonic
1184170009 22:42753136-42753158 AGCCCCATGACGCATGGCTCGGG + Intergenic
1184361444 22:44021322-44021344 AGCTCCAAGATGGAAAGGTGGGG + Intronic
1184663953 22:45977816-45977838 AGCGCCGTGATGGAGGCCTGTGG + Intergenic
1184722348 22:46322342-46322364 AGCACCAAGAGGGAAGGGTGGGG - Intronic
1184850419 22:47116554-47116576 AGCGGCATCGTGGAAGGCTGGGG + Intronic
1185158692 22:49209529-49209551 AGCCTCAGGATGAGAGGCTGGGG - Intergenic
950651659 3:14410951-14410973 AGCACCATGAGGGAAGACTCAGG + Intronic
955947920 3:64213190-64213212 AGCTAGATGGTGGAAGGCTGAGG - Intronic
956898856 3:73692914-73692936 ACCCCAAAGATGGGAGGCTGGGG + Intergenic
957682291 3:83452385-83452407 AGCTCCATGAAGGAAGGCTTTGG + Intergenic
961441268 3:126954690-126954712 GGCCCCATGAGGGCAGGGTGGGG + Intronic
961450260 3:126999427-126999449 TGCCCCATGATGGCAGCCAGGGG - Intronic
961694977 3:128698362-128698384 AGACCCAGGCGGGAAGGCTGCGG - Intergenic
963123194 3:141793551-141793573 AGCTCCCTGAAGGATGGCTGAGG - Intronic
963879930 3:150517738-150517760 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
964043326 3:152291653-152291675 AGCTCCATGAGAGAAGGCAGTGG - Intronic
965075414 3:163968766-163968788 AGCACTCTGATGGAAGGGTGGGG - Intergenic
966921875 3:184617483-184617505 AGCAGCAAGATGGAAGGCGGAGG + Intronic
966978201 3:185105302-185105324 ACACCCATGCTGGAAGGTTGTGG + Intronic
966978797 3:185110637-185110659 ACGCCCATGCTGGAAGGTTGTGG + Intronic
968296236 3:197578419-197578441 ATCCTCATGATGTGAGGCTGTGG + Intergenic
968359808 3:198138956-198138978 AGCCCCAACATGGAAGGCTCAGG + Intergenic
968424162 4:510433-510455 ACGCCCACGCTGGAAGGCTGTGG - Intronic
969476293 4:7424303-7424325 AACCCCACGATGGCAGGCAGTGG + Intronic
970764550 4:19531909-19531931 TGCCCCATGAAGAAAGGGTGGGG - Intergenic
971174574 4:24268943-24268965 AGCTCCATGAGGGAAGGAAGGGG - Intergenic
971813911 4:31462799-31462821 ACACCCATGCTGGAAGGTTGTGG + Intergenic
972080654 4:35144798-35144820 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
973009013 4:45048611-45048633 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
974134865 4:57803063-57803085 AGCCACATGATGGAAGACTTTGG - Intergenic
974535084 4:63164203-63164225 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
975412469 4:74069940-74069962 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
976128502 4:81858560-81858582 ACGCCCATGCTGGAAGACTGTGG - Intronic
976816025 4:89148974-89148996 GCCCCCAGGATGGCAGGCTGCGG + Intergenic
976977343 4:91181073-91181095 ATGCCCATGCTGGAAGACTGTGG - Intronic
977638469 4:99328145-99328167 ATGCCCATGCTGGAAGGCTGTGG - Intergenic
979893495 4:126130848-126130870 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
983594742 4:169453520-169453542 ACGCCCATGCTGGAAGGTTGTGG + Intronic
984110743 4:175610338-175610360 AAGCCCATGCTGGAAGGTTGTGG - Intergenic
984564115 4:181307301-181307323 TGCCCCATGCTAGGAGGCTGTGG - Intergenic
984585069 4:181554016-181554038 AGCCGCATGAGGGAAGACAGGGG - Intergenic
986467246 5:8037922-8037944 ACGCCCACGCTGGAAGGCTGTGG - Intergenic
986619149 5:9652513-9652535 AGCCACAAGACGGAAGGATGTGG + Intronic
986749870 5:10777375-10777397 AGCTGCATGATGGTAGGCAGAGG + Intergenic
986954650 5:13136202-13136224 ATGCCCAAGATGGAAGGTTGTGG - Intergenic
987322296 5:16781809-16781831 AGCCCCATCATGGAAGCTTTCGG - Exonic
988481084 5:31631131-31631153 AACCCCATGATGCCATGCTGCGG - Intergenic
990539440 5:56757449-56757471 AGCCCCTTGAAGGAAGTGTGAGG - Intergenic
990855927 5:60266289-60266311 AGCCCCATGAAAGCAGGCTCTGG + Intronic
992379781 5:76225913-76225935 GGCCCCATGCTGGAAGCCAGAGG + Intronic
993034408 5:82741241-82741263 AGCCCCATTGGGGAAGTCTGGGG + Intergenic
994148413 5:96420618-96420640 AACCCCAGGATGGGAGGCTGGGG - Intronic
994419035 5:99509375-99509397 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
995592247 5:113712019-113712041 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
998104512 5:139459845-139459867 AGCCCCATGGAGGAAGGCAGTGG - Intronic
999187987 5:149727084-149727106 ATCCCAACAATGGAAGGCTGAGG - Intergenic
1002972791 6:2041589-2041611 AGGCCCAGGATGGGAGGGTGAGG - Intronic
1003361767 6:5433249-5433271 ATCCCCATAATGGAACTCTGAGG - Intronic
1005185497 6:23159659-23159681 ACACCCATGCTGGAAGGTTGTGG + Intergenic
1006412383 6:33881855-33881877 ATCACCATCATGGGAGGCTGAGG + Intergenic
1007008331 6:38389479-38389501 AGCCCCATGCTGGATGGCGTTGG + Intronic
1007785549 6:44277329-44277351 AGGCCCCTGTTGGGAGGCTGAGG - Exonic
1009659294 6:66589749-66589771 TGGCCCATGCTGGAAGGCAGTGG - Intergenic
1009955247 6:70445742-70445764 ACGCCCATGCTGGAAGGTTGTGG - Intronic
1010007918 6:71015592-71015614 AGGTCCATGATGTAATGCTGGGG + Intergenic
1010423618 6:75702255-75702277 ACCCCCAAGCTGGAATGCTGTGG + Intronic
1010433654 6:75806586-75806608 ACGCCCATGCTGGAAGGTTGTGG + Intronic
1012541205 6:100364127-100364149 AGCACCAGGATTGAAAGCTGGGG - Intergenic
1014166119 6:118227073-118227095 TGCACCATGAGGGAAGGCAGTGG - Intronic
1015328453 6:131950895-131950917 AGCCTCGTGCTGGACGGCTGCGG - Exonic
1015825384 6:137305496-137305518 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1016346674 6:143120862-143120884 ATGCCCATGCTGGAAGGTTGTGG + Intronic
1017069805 6:150565607-150565629 AGCCACATGCTGAGAGGCTGTGG + Intergenic
1017835832 6:158177013-158177035 ACACCCACGCTGGAAGGCTGTGG - Intronic
1018064455 6:160115729-160115751 AGGGCCATGATGGAGGTCTGGGG - Intergenic
1018753767 6:166830815-166830837 AGTGCCAGGACGGAAGGCTGTGG - Intronic
1019260179 7:77692-77714 AGCCCCAACATGGAAGGCTCAGG - Intergenic
1021243748 7:18236726-18236748 AGACTCATGATGTACGGCTGTGG + Intronic
1023059380 7:36313629-36313651 AGACCCATCATGGAAGGCTCTGG - Intergenic
1023960671 7:44923371-44923393 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1024000540 7:45186496-45186518 ACCCCCATGAGGCAGGGCTGTGG - Intergenic
1024327434 7:48120667-48120689 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1025122479 7:56317036-56317058 AAGCCCATGCTGGAAGGTTGTGG + Intergenic
1025819666 7:64950396-64950418 ACGCCCATGCTGGAAGGCTGTGG + Intergenic
1027518111 7:79167868-79167890 ACACCCATGCTGGAAGGTTGTGG + Intronic
1030060014 7:105614570-105614592 GGCCACATGAGGGAAAGCTGTGG + Exonic
1030089109 7:105841603-105841625 AGTCATCTGATGGAAGGCTGTGG + Intronic
1030277590 7:107737052-107737074 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1030292336 7:107885124-107885146 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1032469350 7:132167019-132167041 AGACCAAAGATGGAAGTCTGGGG + Intronic
1033878682 7:145855122-145855144 AGGCCCACGCTGGAAGGTTGTGG + Intergenic
1034012349 7:147543356-147543378 ACACCCATGCTGGAAGGTTGTGG - Intronic
1034936318 7:155203012-155203034 AGACACAGGGTGGAAGGCTGGGG + Intergenic
1035610629 8:961216-961238 AGCCACATGATAGAAGTCAGTGG - Intergenic
1035874870 8:3177266-3177288 AGCCCCCTGATAGAGGCCTGTGG - Intronic
1036821230 8:11941881-11941903 ACACCCATGCTGGAAGGTTGTGG - Intergenic
1037479367 8:19289770-19289792 TGACCCATGATAGACGGCTGTGG - Intergenic
1038211088 8:25519701-25519723 AGTCCCATTTTGGAAGGCTGAGG - Intergenic
1038701237 8:29851263-29851285 GACCCCTTGATGAAAGGCTGGGG - Intergenic
1039580753 8:38664816-38664838 ACCCCCAGGCTGGAAGGCAGTGG - Intergenic
1039590783 8:38745035-38745057 AGCCCCGTGCTAGAAGCCTGGGG - Intronic
1040381391 8:46876635-46876657 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1040528436 8:48244906-48244928 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1040529036 8:48250396-48250418 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1044016294 8:87051768-87051790 ATGCCCATGCTGGAAGGTTGTGG - Intronic
1044531008 8:93307379-93307401 AGGCCATTGATGGAAGCCTGGGG - Intergenic
1044586678 8:93875055-93875077 ACGCCCATGCTGGAAGGCTGTGG - Intronic
1045246723 8:100448535-100448557 AGGCCCAGGAAGAAAGGCTGGGG - Intergenic
1046190676 8:110790642-110790664 AGACCCATGAGGAGAGGCTGAGG - Intergenic
1048101520 8:131357542-131357564 GACCCCATGCTGGAAGGTTGTGG + Intergenic
1048764839 8:137832660-137832682 AGCCCCAGGATAGGATGCTGGGG - Intergenic
1048988952 8:139750187-139750209 AGCCCCATCAGAGAAGCCTGGGG - Intronic
1049622430 8:143604715-143604737 ACCCCCAGGATTGAAGGCTAGGG - Exonic
1049887261 9:35987-36009 TGCCACAAGTTGGAAGGCTGGGG + Intergenic
1050906653 9:11013959-11013981 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1051313603 9:15804556-15804578 ATCCCCAGGATGCAAGGTTGGGG - Intronic
1051844256 9:21433974-21433996 ACGCCCATGCTGGAAGGTTGTGG + Intronic
1053539607 9:38959665-38959687 ATGCCCATGCTGGAAGGTTGTGG - Intergenic
1054626534 9:67404253-67404275 ATGCCCATGCTGGAAGGTTGTGG + Intergenic
1055067525 9:72133607-72133629 ATCAGAATGATGGAAGGCTGTGG - Intronic
1057286113 9:93755692-93755714 ACGCCCATGCTGGAAGGTTGTGG - Intergenic
1057869668 9:98708556-98708578 AGGCCCATGATGGAGAGCGGCGG + Exonic
1058111727 9:101037694-101037716 ACCCCCAGGAGGGAAGGCTGTGG - Intronic
1058386998 9:104448109-104448131 GGCACCATGATGGATGCCTGAGG - Intergenic
1058718241 9:107740883-107740905 AGCCCCATGCTGGAGTGCAGTGG + Intergenic
1060037117 9:120264953-120264975 AACCCCATGCTGGAGGGGTGTGG + Intergenic
1061055804 9:128222376-128222398 AGCCCCACGCTGAGAGGCTGGGG - Intronic
1061798093 9:133100190-133100212 AGCCCCAGGTTGGAAGCCTTTGG - Intronic
1062191374 9:135249568-135249590 AGGCCCAGGAAGGAAGGCCGAGG + Intergenic
1062744513 9:138202777-138202799 AGCCCCAACATGGAAGGCTCAGG + Intergenic
1202792030 9_KI270719v1_random:94663-94685 AGGCCCATGAGGGAAAGGTGAGG + Intergenic
1185980671 X:4774530-4774552 AACCCGATGCTGGAAGGCTGCGG - Intergenic
1186095781 X:6100250-6100272 ACCCCCATGCTGGAAGGCTGTGG - Intronic
1186154903 X:6715266-6715288 AGCCACACAATGGAATGCTGCGG - Intergenic
1187097898 X:16166609-16166631 AGCCCCATGTAGGAGGACTGAGG + Intergenic
1188828154 X:34862344-34862366 AGCCCCATGGTGCAGGGGTGGGG + Intergenic
1189386219 X:40539123-40539145 AGCCACAAGATAGAAGGCTCTGG - Intergenic
1190053437 X:47168912-47168934 TGCCCCATGAGGGAAGCCAGTGG + Intronic
1191900824 X:66039306-66039328 AGCCCCAAGAAGCAAAGCTGGGG + Intronic
1193915978 X:87364473-87364495 ACGCCCATGCTGGAAGGTTGTGG + Intergenic
1195546101 X:106114264-106114286 ACCCCCATGCTGGAAGGTTGTGG - Intergenic
1198036787 X:132808797-132808819 AGCCTCTAGAGGGAAGGCTGTGG - Intronic
1198387624 X:136144766-136144788 GCACCCATGATGGAAGGCTCTGG - Intergenic
1200002871 X:153071326-153071348 TGACCCATCATGGGAGGCTGGGG - Intergenic
1200004852 X:153078683-153078705 TGACCCATCATGGGAGGCTGGGG + Intergenic
1200091194 X:153636861-153636883 AGCTCCAAGAAGGACGGCTGTGG - Intergenic
1200128726 X:153830092-153830114 AGCCCCAGGATGGGAGGGTGCGG + Intronic