ID: 1171994529

View in Genome Browser
Species Human (GRCh38)
Location 20:31721909-31721931
Sequence GTTTGAACTGCGGTACCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171994529_1171994539 22 Left 1171994529 20:31721909-31721931 CCCGCCGGTACCGCAGTTCAAAC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1171994539 20:31721954-31721976 CTTGCTTTACTGCTGCCATGGGG 0: 1
1: 0
2: 1
3: 13
4: 208
1171994529_1171994537 20 Left 1171994529 20:31721909-31721931 CCCGCCGGTACCGCAGTTCAAAC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1171994537 20:31721952-31721974 CGCTTGCTTTACTGCTGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 72
1171994529_1171994538 21 Left 1171994529 20:31721909-31721931 CCCGCCGGTACCGCAGTTCAAAC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1171994538 20:31721953-31721975 GCTTGCTTTACTGCTGCCATGGG 0: 1
1: 0
2: 2
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171994529 Original CRISPR GTTTGAACTGCGGTACCGGC GGG (reversed) Exonic
907351839 1:53838306-53838328 CTTTGAACTGCGGTGGCGGGCGG - Exonic
1069087147 10:64154164-64154186 GTTTGAACTGCTTCACCAGCTGG - Intergenic
1070719492 10:78746401-78746423 GTTTGCTCTGCGGGAGCGGCTGG - Intergenic
1079128556 11:17735036-17735058 GTTTGATTTGCGGGGCCGGCGGG - Exonic
1079383419 11:19958514-19958536 GTTTGACCTGCAGTCCAGGCTGG + Intronic
1132434920 15:101792323-101792345 GTTTAAAATGCTTTACCGGCCGG + Intergenic
1139573039 16:67825223-67825245 GAATGAGCTGCGGTACCAGCGGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
927216726 2:20671636-20671658 CTTTGACATTCGGTACCGGCAGG - Exonic
1171994529 20:31721909-31721931 GTTTGAACTGCGGTACCGGCGGG - Exonic
1178207677 21:30488445-30488467 CTTTGAACTGCTGTTCAGGCTGG - Intronic
963838298 3:150079209-150079231 GTATGAACTGCGGTGTCAGCAGG - Intergenic
969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG + Intronic
976357533 4:84136682-84136704 GTTTGAATTGAGGTACCAGAGGG - Intergenic
978370135 4:108021788-108021810 GTTTGATTTGTGGTACCCGCAGG + Intronic
1060408984 9:123387585-123387607 GTTGGCACTGGGGCACCGGCAGG + Intronic