ID: 1171997044

View in Genome Browser
Species Human (GRCh38)
Location 20:31739488-31739510
Sequence GGTCGCCGCCTAGGCGGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171997033_1171997044 22 Left 1171997033 20:31739443-31739465 CCGTTCGCGCCGCTAGGCCTGGC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 142
1171997037_1171997044 5 Left 1171997037 20:31739460-31739482 CCTGGCTTCTGAGGCGGTTGCGG 0: 1
1: 0
2: 1
3: 10
4: 303
Right 1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 142
1171997035_1171997044 13 Left 1171997035 20:31739452-31739474 CCGCTAGGCCTGGCTTCTGAGGC 0: 1
1: 0
2: 2
3: 25
4: 325
Right 1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 142
1171997029_1171997044 30 Left 1171997029 20:31739435-31739457 CCCTAGCGCCGTTCGCGCCGCTA 0: 1
1: 0
2: 0
3: 0
4: 5
Right 1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 142
1171997030_1171997044 29 Left 1171997030 20:31739436-31739458 CCTAGCGCCGTTCGCGCCGCTAG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171997044 Original CRISPR GGTCGCCGCCTAGGCGGGGC AGG Exonic
900140287 1:1136932-1136954 GGTCGGGCCCTGGGCGGGGCAGG + Intergenic
900199695 1:1398915-1398937 GGTCGGGGTCTAGGCGGGGGCGG + Intronic
900213533 1:1468779-1468801 GGTGGCTGCCACGGCGGGGCCGG + Exonic
901796254 1:11681180-11681202 GGGCGTGGCCTGGGCGGGGCGGG - Exonic
902600802 1:17539458-17539480 GGTCGCCGTGTGGCCGGGGCCGG + Intergenic
903016655 1:20366211-20366233 GGCCGCCGCCTACGCGGGTGGGG + Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
904245076 1:29181785-29181807 CGCCGCCGCCTAAGGGGGGCTGG - Exonic
904261399 1:29289742-29289764 GATCTCCCCCTAGGCAGGGCCGG - Intronic
905648285 1:39639704-39639726 CGGCGCCCCCGAGGCGGGGCCGG - Exonic
912717008 1:111989965-111989987 GGGCGCGGCGCAGGCGGGGCGGG + Intergenic
914428550 1:147600034-147600056 GCTCGCGTCCGAGGCGGGGCCGG + Intronic
920029166 1:203026429-203026451 CTCCGCCCCCTAGGCGGGGCTGG - Intergenic
923127000 1:231041002-231041024 GGCCGCCCCCTGGGCAGGGCAGG - Intergenic
1071544786 10:86521327-86521349 GGCGGCCGCCTAGGCCGGGAGGG - Intronic
1071676379 10:87659710-87659732 GGACCCCGCCTAGGCGGCGGCGG + Exonic
1074571898 10:114632072-114632094 GGGGCCCGCCGAGGCGGGGCGGG - Intronic
1076679780 10:132165741-132165763 TGTCACCGCCTACGAGGGGCGGG - Intronic
1077167327 11:1149707-1149729 GGTGGCCGCCAGGGCTGGGCAGG - Intergenic
1077207018 11:1349601-1349623 GGCCGCCGCATAGGAGGGGCTGG - Intergenic
1077237575 11:1489075-1489097 GGTCGCAACCAAGGCGGGACGGG + Intronic
1083265763 11:61546209-61546231 AGTGGCCGCCGCGGCGGGGCTGG - Exonic
1084161681 11:67353622-67353644 GCAGGCCGCCTATGCGGGGCGGG + Intronic
1096782731 12:54000434-54000456 TGTCGGCGCCGAGGTGGGGCTGG - Exonic
1101606115 12:106248308-106248330 GGACGCGGCCGAGGTGGGGCTGG + Intronic
1102518977 12:113467534-113467556 GGACTCCCCCGAGGCGGGGCCGG + Intronic
1104692850 12:130839350-130839372 GGGCGGGGCCTAGGCGGGGAGGG + Intergenic
1104957908 12:132475056-132475078 GGTCACCGCGGAGGGGGGGCGGG - Intergenic
1104957947 12:132475147-132475169 GGTCACCGCGGAGGGGGGGCGGG - Intergenic
1105409596 13:20160890-20160912 GGTCGCCGCCGCGGCAGAGCGGG - Exonic
1105492583 13:20902863-20902885 CGTCGCGGCCTCGGCGGGTCTGG + Intronic
1107086583 13:36432442-36432464 GGTGGCCGGCTGGGCGGGGCAGG - Exonic
1107549164 13:41458521-41458543 GGCCGCAGCCTTCGCGGGGCAGG - Intronic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1108662648 13:52600466-52600488 GGTCGCCGACTGGGCTGGGCTGG - Intergenic
1113769976 13:112901573-112901595 GGTCACCGCCTGGGAGGGGAAGG + Intronic
1113839158 13:113348801-113348823 GGTCGCGGCGTCTGCGGGGCGGG - Intronic
1113839165 13:113348827-113348849 GGTCGCGGCATCTGCGGGGCAGG - Intronic
1116945499 14:50831373-50831395 GGTCGCCACCGAGCTGGGGCTGG + Intergenic
1118289250 14:64504700-64504722 AGTCGCCGCGTAAGCGGGGCCGG + Intronic
1121453962 14:94026811-94026833 GGGCGCCGCCTCGACGGCGCTGG + Intronic
1122688596 14:103521411-103521433 GGTCGCCGTCCAGGCTGGACAGG + Exonic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1128865940 15:71115369-71115391 GGTCGCCGCCAGGGGGCGGCAGG + Exonic
1129810651 15:78507450-78507472 CGCAGCCTCCTAGGCGGGGCCGG + Intergenic
1132803120 16:1763813-1763835 GGGCCCCGCAGAGGCGGGGCGGG + Intronic
1134519347 16:14911609-14911631 GGCCGCGGCTCAGGCGGGGCCGG - Intronic
1134554586 16:15154619-15154641 GGCCGCGGCTCAGGCGGGGCCGG + Intergenic
1134707017 16:16310264-16310286 GGCCGCGGCTCAGGCGGGGCCGG - Intergenic
1134960523 16:18401860-18401882 GGCCGCGGCTCAGGCGGGGCCGG + Intergenic
1136531874 16:30875330-30875352 GGTCTCAGCCTCGGCGGGTCGGG + Intronic
1136711570 16:32241233-32241255 GGCCGCGGCCCAGGCAGGGCTGG - Intergenic
1136756345 16:32688172-32688194 GGCCGCGGCCCAGGCAGGGCTGG + Intergenic
1136811767 16:33182202-33182224 GGCCGCGGCCCAGGCAGGGCTGG - Intergenic
1136818243 16:33292282-33292304 GGCCGCGGCCCAGGCAGGGCTGG - Intronic
1136824807 16:33348815-33348837 GGCCGCGGCCCAGGCAGGGCTGG - Intergenic
1136829873 16:33447586-33447608 GGCCGCGGCCCAGGCAGGGCTGG - Intergenic
1138180788 16:54938924-54938946 AGTTGCAGCCTACGCGGGGCCGG - Intergenic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1139909984 16:70391726-70391748 GGCCGGGGCCTGGGCGGGGCAGG + Intronic
1142177293 16:88651079-88651101 GGGCGGGGCCTGGGCGGGGCGGG - Exonic
1202990345 16_KI270728v1_random:5170-5192 GGCCGCGGCCCAGGCAGGGCTGG - Intergenic
1203058484 16_KI270728v1_random:948526-948548 GGCCGCGGCCCAGGCAGGGCTGG + Intergenic
1142811944 17:2399640-2399662 GGGCGGGGCCTGGGCGGGGCTGG - Intronic
1143484015 17:7243100-7243122 GGGCGCCGGGGAGGCGGGGCCGG + Intronic
1146770906 17:35568027-35568049 GGGCGCCCCTGAGGCGGGGCTGG - Intergenic
1147440163 17:40443108-40443130 TGAGGCCGCCTTGGCGGGGCGGG + Intergenic
1148699637 17:49579802-49579824 GGGCGCCCACTAGGCAGGGCTGG - Exonic
1150239801 17:63622502-63622524 CGGCGCCGCCGAGGCCGGGCTGG + Exonic
1152267544 17:79305080-79305102 GGCCGCCGCCTGGCCAGGGCAGG + Intronic
1152744271 17:82031858-82031880 GGGCGCAGCCGGGGCGGGGCGGG + Intronic
1153805375 18:8705530-8705552 GGGCGCAGCCCGGGCGGGGCTGG + Intergenic
1159057071 18:63476865-63476887 GAGTGCCGCCGAGGCGGGGCGGG + Exonic
1160499103 18:79393824-79393846 GGTGGCCGCAGAGGCCGGGCCGG + Intergenic
1160858897 19:1229393-1229415 GGTCGCACCCTGGGCGGCGCCGG - Exonic
1161072919 19:2271255-2271277 GGCCCCTGCCTGGGCGGGGCGGG + Intronic
1161112612 19:2478621-2478643 GGTGGCCGCCTAGGCGGTCAGGG - Intergenic
1161215770 19:3094493-3094515 GGCGGCGGCCGAGGCGGGGCGGG + Exonic
1161350081 19:3786421-3786443 GGGGGCCGCGGAGGCGGGGCGGG - Intronic
1161412437 19:4123941-4123963 GGTCGGCGCCTACGCGAGCCCGG + Exonic
1161492884 19:4571896-4571918 GGCCGCCTCCCAGGCTGGGCAGG - Intergenic
1161521026 19:4723593-4723615 GGTCAGGGCCGAGGCGGGGCCGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162315607 19:9936480-9936502 GGCCGCCGGCGAGGCGGGGGAGG - Exonic
1162583977 19:11547783-11547805 CGTCTTCGCCTAGGTGGGGCAGG - Exonic
1162737693 19:12755601-12755623 GGTCACCACCTGGGCAGGGCGGG - Exonic
1162742703 19:12782707-12782729 GGTCCCGGCCGGGGCGGGGCTGG - Intronic
1163390434 19:17027067-17027089 GGTCGGGTCCGAGGCGGGGCTGG - Intergenic
1165157694 19:33797937-33797959 GGTTGCCGCGGAGGCGGGGCGGG - Intronic
1168145700 19:54419139-54419161 GGTGGCGGCCTTGGCGGGCCTGG + Exonic
930642284 2:53865770-53865792 GGTTGCCTCCTGGGTGGGGCTGG - Intronic
937869370 2:126776720-126776742 GGGCGGGGCCTGGGCGGGGCTGG - Intergenic
946029762 2:216694724-216694746 GCTGGCCGCCTATGCGGGGCCGG - Exonic
1171997044 20:31739488-31739510 GGTCGCCGCCTAGGCGGGGCAGG + Exonic
1175394498 20:58649634-58649656 GGTCGCCGCGCGGGCCGGGCTGG - Intergenic
1176076336 20:63250051-63250073 GGTCGCCGCCCTGGAGAGGCAGG - Exonic
1176131620 20:63498899-63498921 GGTCCCCGCGTCGGCCGGGCTGG - Intronic
1176201540 20:63863033-63863055 GGCCGGCGCCGACGCGGGGCGGG + Exonic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1178950393 21:36980842-36980864 GGGCGCGGCCTGAGCGGGGCTGG - Intronic
1179430166 21:41316323-41316345 GGGCGCCTGCTAGGCTGGGCTGG + Intronic
1184728952 22:46362809-46362831 GATGCCCGCCTGGGCGGGGCTGG + Exonic
951078401 3:18424625-18424647 TGTCGCTGCCTAGGCGGTGGAGG - Intronic
952744410 3:36764125-36764147 GGGCGCCACCTTGGCGGGGGCGG - Intergenic
954649844 3:52154361-52154383 GGGCGCAGCCATGGCGGGGCTGG + Exonic
954912700 3:54122401-54122423 CGGGGCCGCCGAGGCGGGGCCGG + Intergenic
961502848 3:127350073-127350095 CCTCTCCGCCTGGGCGGGGCAGG - Intergenic
966743529 3:183254483-183254505 GGCCGCCGCCCAGGTGCGGCAGG + Intronic
966904675 3:184513620-184513642 GGACGGCGCTTCGGCGGGGCTGG + Intronic
968674931 4:1871931-1871953 GGCGGCCGCCTCGGCCGGGCCGG - Intronic
969214508 4:5711311-5711333 CGTCGCCGCCCTGGCGGGGACGG + Exonic
969618994 4:8269650-8269672 TGTCGGGGCCTGGGCGGGGCTGG + Intergenic
969720550 4:8891156-8891178 GGTCGCCGGCAAGGCCTGGCTGG + Intergenic
971405609 4:26319436-26319458 GCTTGCCGCGGAGGCGGGGCGGG - Intronic
976765495 4:88593206-88593228 GTCCGCCTCCTGGGCGGGGCCGG + Intronic
979685318 4:123505647-123505669 GGTCGCGGCCTCGGCGGCGGCGG - Intergenic
980941640 4:139280272-139280294 GGGGGCCGCGGAGGCGGGGCTGG - Exonic
981748505 4:148072609-148072631 GGTGGCCGTCTAGGAAGGGCAGG - Exonic
985497725 5:218809-218831 GGTGGCCGCCCTGGCTGGGCTGG + Intronic
987050471 5:14143769-14143791 GCTGGCCGCCGCGGCGGGGCCGG - Exonic
994197415 5:96935879-96935901 GGGCGGGGCCTAGGCGGGGCCGG - Exonic
995787081 5:115841865-115841887 GGGCGGGGCCTGGGCGGGGCAGG - Exonic
1003218478 6:4135900-4135922 GGTCGGTGCGTGGGCGGGGCGGG + Intergenic
1013793612 6:113860186-113860208 GGCCGCCGCCGAGGCGGGCGCGG + Exonic
1015625761 6:135180496-135180518 GGGCACCGCCTGGGCCGGGCGGG + Intergenic
1015935660 6:138404289-138404311 CGCCGCCACCAAGGCGGGGCCGG - Exonic
1017725704 6:157274820-157274842 TGTCGCCGCCTGTACGGGGCGGG - Intergenic
1019474395 7:1236880-1236902 GGCCGGCTCCTCGGCGGGGCTGG - Exonic
1025033156 7:55573026-55573048 GGTGGCCTGCAAGGCGGGGCCGG - Intergenic
1028762326 7:94509886-94509908 GGCCGCGGCCGAGGAGGGGCAGG + Exonic
1033683788 7:143620936-143620958 GGTCGGAGGCGAGGCGGGGCGGG - Exonic
1035410019 7:158632237-158632259 AGCCGCGGCCTAGGTGGGGCTGG - Intronic
1035583166 8:752849-752871 GGTCGCCTTCTTGGAGGGGCAGG - Intergenic
1036645945 8:10611516-10611538 GGCCGCCCCCTGGGCGGGGTGGG + Exonic
1037450836 8:19014172-19014194 GGGCGCCGTCTCGCCGGGGCTGG + Intronic
1037980002 8:23246666-23246688 GTTCGCAGCCTTGCCGGGGCTGG + Exonic
1038147698 8:24913680-24913702 GGCCGCCGCCTCCACGGGGCGGG + Exonic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1044698914 8:94949193-94949215 GGCCGCCGGCTCGGCGGGGAAGG + Exonic
1049791091 8:144473051-144473073 GGTGGGCGCCGGGGCGGGGCAGG + Exonic
1053009115 9:34623513-34623535 GGTCGCCGGAGGGGCGGGGCCGG + Exonic
1053138275 9:35665239-35665261 GGGAGCCGCGGAGGCGGGGCCGG + Exonic
1061056635 9:128226178-128226200 GACGGCCGCCTGGGCGGGGCTGG + Intronic
1061133465 9:128720923-128720945 GGCAGCAGCCTGGGCGGGGCTGG + Exonic
1061192078 9:129087908-129087930 GGAGGCCGGCCAGGCGGGGCAGG - Intronic
1062503349 9:136860677-136860699 TGTCCCAGCCTGGGCGGGGCAGG - Exonic
1062613131 9:137383843-137383865 GGGGGCCTCCCAGGCGGGGCTGG - Intronic
1185869857 X:3655439-3655461 GGGCCCCGCCAAGGCAGGGCAGG + Intronic
1200231045 X:154444032-154444054 GGTCTCCGGCGGGGCGGGGCGGG + Intergenic
1200794154 Y:7325629-7325651 GGGCCCCGCCAAGGCAGGGCAGG - Intergenic