ID: 1172002776

View in Genome Browser
Species Human (GRCh38)
Location 20:31793215-31793237
Sequence GGGTTAACGGAGATAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172002776_1172002783 2 Left 1172002776 20:31793215-31793237 CCTTGTCCTATCTCCGTTAACCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1172002783 20:31793240-31793262 AGGAGTTGCAAAGGTGACTGTGG 0: 1
1: 0
2: 2
3: 21
4: 275
1172002776_1172002780 -7 Left 1172002776 20:31793215-31793237 CCTTGTCCTATCTCCGTTAACCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1172002780 20:31793231-31793253 TTAACCCAGAGGAGTTGCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 126
1172002776_1172002784 15 Left 1172002776 20:31793215-31793237 CCTTGTCCTATCTCCGTTAACCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1172002784 20:31793253-31793275 GTGACTGTGGTGATCGTTTATGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172002776 Original CRISPR GGGTTAACGGAGATAGGACA AGG (reversed) Intronic
901004628 1:6165842-6165864 GGGGAAGTGGAGATAGGACAGGG - Intronic
901054251 1:6441247-6441269 AGGTCAACGGAAAGAGGACAGGG + Intronic
902427099 1:16332156-16332178 GGGATAACAGATTTAGGACAGGG + Intronic
902480061 1:16707084-16707106 AGGTTAACGGAAAGAGGACAGGG - Intergenic
904101683 1:28035113-28035135 GGGTTAGGGGAGAAAGGAGAGGG + Intronic
906326853 1:44851712-44851734 GGATAAACGGAGATAAGAAAGGG + Intronic
906380532 1:45329499-45329521 GGGGAAAGGGAGAGAGGACAAGG - Intronic
906444221 1:45880415-45880437 GGATTTACGAAGAAAGGACATGG + Intronic
906959525 1:50409387-50409409 GGGTTAACTGAGTTTTGACAAGG + Intergenic
907521991 1:55029993-55030015 GGGTTTAAGGAGAAAGGAGAAGG - Intergenic
907617151 1:55937274-55937296 GGGTGAAAGGAGATGGGACAGGG - Intergenic
910301051 1:85708106-85708128 GGGATAAAGGAGATAGGGGATGG - Exonic
915069366 1:153253425-153253447 AGGTTATCTGAGATAGCACACGG + Intergenic
918232875 1:182551516-182551538 GGTTTAATGGAGATAGAGCAGGG - Intronic
923256231 1:232223904-232223926 GGGTTAAGGGAGGTTGCACAGGG - Intergenic
1067253255 10:44607919-44607941 AGGCTAACGGAGCCAGGACATGG + Intergenic
1073071731 10:100798657-100798679 GAGGTAAGGGAGATAGGAGAAGG - Intronic
1077312427 11:1895499-1895521 TGGTTAACGGTGAGAGGACAAGG - Intergenic
1079868461 11:25764714-25764736 GGGATAAGGGAGAAATGACAAGG + Intergenic
1081747304 11:45482273-45482295 GGGAGAAAGGAGAAAGGACAAGG - Intergenic
1083257709 11:61506779-61506801 GGGTTGATGGAAATGGGACAGGG + Intergenic
1085321481 11:75576766-75576788 GGGTAAATGGAGAAATGACATGG - Intergenic
1085454326 11:76657154-76657176 GGGGTAAGGGAGAGAGGACGGGG + Intergenic
1091773801 12:3171170-3171192 GGGATAAGGAAGATAGGACTGGG - Intronic
1104347970 12:128019954-128019976 CAGTGAAGGGAGATAGGACAGGG + Intergenic
1108177985 13:47813536-47813558 GGATTAAAGGAGATAGGGCACGG - Intergenic
1118107446 14:62676120-62676142 GTGTGAACGGAGAGAGAACAAGG - Intergenic
1118825621 14:69377992-69378014 GGGTTGGGGGAGAGAGGACAGGG - Intergenic
1118963279 14:70555854-70555876 GGTTTAACGGAGAAAGTAGATGG - Intergenic
1119344165 14:73908180-73908202 GGGATAACGGACACAGGAGAAGG - Intronic
1119525210 14:75317399-75317421 GGGTAAAACGAGATAGGATAGGG + Intergenic
1119656268 14:76419490-76419512 GGGTTAGCTGGGATAAGACATGG + Intronic
1120582551 14:86270807-86270829 GAGTGAAGGGAGATAGGAGAGGG - Intergenic
1121236494 14:92395042-92395064 GGATTCAGGGAGATAGGAAAGGG + Intronic
1126839761 15:52706087-52706109 GGGTTAGGGGAGATAGGTCAGGG + Intronic
1129789648 15:78332121-78332143 GGTTTAGAGGAGAAAGGACATGG - Intergenic
1131400528 15:92122012-92122034 GGGAGAAAGGAGAGAGGACATGG + Intronic
1135649972 16:24197484-24197506 GGGTTGAGGGAGAAAGGAAAAGG + Intronic
1137640233 16:50022686-50022708 GGGTTAAGGGTGATAACACATGG + Intergenic
1143687785 17:8532898-8532920 TGGTTAAGGGATATAAGACAAGG + Intronic
1145959640 17:28879925-28879947 GGGGTCAGGGAGAAAGGACAGGG + Exonic
1156340355 18:36205134-36205156 GGGGTACTGGAGAGAGGACAGGG - Exonic
1202714098 1_KI270714v1_random:32990-33012 AGGTTAACGGAAAGAGGACAGGG - Intergenic
930343086 2:50142325-50142347 GGGTGAAGAGAGGTAGGACAGGG + Intronic
931564891 2:63605610-63605632 GGGTTAAAGGAGATTGCACATGG + Intronic
942469381 2:176243682-176243704 TGGTAAAGGGAGAAAGGACAAGG - Intergenic
947458025 2:230274259-230274281 AGGTTCTAGGAGATAGGACATGG - Intronic
1170395773 20:15923586-15923608 GGTTCAGCGGAGATGGGACAGGG - Intronic
1171396229 20:24835490-24835512 GGTTGAACGGAGGTAGGAAAAGG + Intergenic
1171493652 20:25539216-25539238 GGGTCAACAGAGAGAGGCCAAGG + Intronic
1172002776 20:31793215-31793237 GGGTTAACGGAGATAGGACAAGG - Intronic
1173859909 20:46276562-46276584 GGATTAAAGGAGATAGAACCTGG - Intronic
1174449828 20:50612669-50612691 GGGTTAAACGGGATGGGACACGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951300195 3:20987014-20987036 TGGATAATGGAGAGAGGACATGG + Intergenic
954431311 3:50472270-50472292 GGGTTAAGGCAGGCAGGACATGG + Intronic
958537249 3:95419018-95419040 GAGTTAACAGAGAGAGGACAGGG - Intergenic
958674006 3:97242592-97242614 GGGCTTACAGAGATAAGACATGG - Intronic
958813510 3:98890712-98890734 GGGTTAAAGGAATTAAGACATGG - Intronic
959831593 3:110869473-110869495 GGATTAGAGGAGAGAGGACAGGG - Intergenic
961621522 3:128228366-128228388 GGGTTGCCAGAGAAAGGACAAGG + Intronic
970682061 4:18520734-18520756 GGGTCTACGGAGAAAGGAAATGG - Intergenic
975524128 4:75330879-75330901 AGTTTAAAGGAGATGGGACATGG - Intergenic
976242029 4:82967812-82967834 AGATTAAAGGAGAAAGGACAAGG - Intronic
978779990 4:112542000-112542022 GCGTTAAAGTAGATAGGACTTGG - Intronic
994837334 5:104872365-104872387 GGGTTGACGGAGAGAGAAAATGG + Intergenic
999671938 5:153965871-153965893 GGGTAAATGGAGACAGGCCAAGG - Intergenic
1001911859 5:175526613-175526635 GGGATAAGGGAGAAATGACAGGG - Intronic
1004373490 6:15072742-15072764 GGGTTAACTGAGATAATGCATGG + Intergenic
1007128302 6:39446081-39446103 GGGGGAAAGGAGATAGGACTTGG + Intronic
1008156548 6:48022152-48022174 GGGAGAAAGGAGATAGAACAAGG - Intronic
1014255594 6:119157699-119157721 GTGCTAAGGGAGATAGCACATGG + Intergenic
1018472288 6:164107487-164107509 GGGTTAACTGAGATATTACCTGG + Intergenic
1018605488 6:165593307-165593329 GGGTTAAGGGAGATAGCATTAGG + Intronic
1022390368 7:29938537-29938559 GGGTTAACGGAATCAGGGCAAGG + Intronic
1023681996 7:42696757-42696779 GGATTAAAGGAGATAGGGCATGG - Intergenic
1029519466 7:101050969-101050991 GGACTAACGGCTATAGGACAGGG + Intronic
1030251243 7:107447378-107447400 GGGTTTTAGGAAATAGGACATGG + Intronic
1033943699 7:146687383-146687405 GGTTTAAATGAGATAGTACATGG + Intronic
1037701456 8:21278541-21278563 GTGCTAAAGGAGATAGGAAAGGG + Intergenic
1038845938 8:31229678-31229700 AGCCTAACAGAGATAGGACAAGG - Intergenic
1040645381 8:49390979-49391001 GGGTTTACGGGAATAGGGCAAGG + Intergenic
1042386626 8:68183214-68183236 GGGTATACAGAGAAAGGACATGG + Intronic
1043400198 8:79877084-79877106 GGGTTAGTGCAGAGAGGACAAGG - Intergenic
1044250809 8:90001935-90001957 GGGCTCAGGGAGCTAGGACAGGG + Intronic
1044535774 8:93354948-93354970 GGGATAAAAGAGATAGGAGAAGG + Intergenic
1046556887 8:115785734-115785756 GGGTTAAGGGGGCTAGGAGAGGG - Intronic
1050838461 9:10114292-10114314 GGGTCAAAGGAAATAGGATATGG + Intronic
1189753064 X:44242670-44242692 GTGTTGACTGAGATAGGAGAGGG - Intronic
1198257170 X:134933947-134933969 GGGTTAAAAGATATAGGAAAGGG - Intergenic