ID: 1172003041

View in Genome Browser
Species Human (GRCh38)
Location 20:31795558-31795580
Sequence CCGGGTGATCACTTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172003041_1172003054 12 Left 1172003041 20:31795558-31795580 CCCTGCTCCAAGTGATCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 213
Right 1172003054 20:31795593-31795615 CCGACAGGCTTTTCTGGAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 89
1172003041_1172003055 13 Left 1172003041 20:31795558-31795580 CCCTGCTCCAAGTGATCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 213
Right 1172003055 20:31795594-31795616 CGACAGGCTTTTCTGGAGTTGGG 0: 1
1: 0
2: 0
3: 13
4: 115
1172003041_1172003052 6 Left 1172003041 20:31795558-31795580 CCCTGCTCCAAGTGATCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 213
Right 1172003052 20:31795587-31795609 TGGGAACCGACAGGCTTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 109
1172003041_1172003051 -3 Left 1172003041 20:31795558-31795580 CCCTGCTCCAAGTGATCACCCGG 0: 1
1: 0
2: 1
3: 8
4: 213
Right 1172003051 20:31795578-31795600 CGGGGAATGTGGGAACCGACAGG 0: 1
1: 0
2: 0
3: 14
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172003041 Original CRISPR CCGGGTGATCACTTGGAGCA GGG (reversed) Intronic
900925311 1:5702073-5702095 CAGAGTCATCACATGGAGCAAGG + Intergenic
901892641 1:12280714-12280736 CAGGAGGATCACTTGAAGCAAGG - Intronic
903101072 1:21030099-21030121 CAGGATGATCACTTGAAGCGAGG - Intronic
903205418 1:21778683-21778705 CAGGAGGATCACTTGAAGCAAGG + Intronic
903245822 1:22014749-22014771 GCGGGTGATCACTTGAGGCCAGG - Intergenic
903845834 1:26279618-26279640 GCGAGGGATCCCTTGGAGCAAGG + Exonic
904183018 1:28680151-28680173 CCGGATGATCACTTGAAGCCAGG + Intronic
908222855 1:62025591-62025613 CCGGCTGATCACTTGAGGCCAGG + Intronic
910649692 1:89552725-89552747 CCTGGTGAACACAGGGAGCAGGG - Intronic
911470800 1:98315978-98316000 CGGGCCGATCACTTGAAGCAAGG - Intergenic
912334447 1:108849251-108849273 CGGGGGGATCACTTGAAGCCAGG + Intronic
912542208 1:110425621-110425643 CCTGGTGATCAGCTGGAGCTCGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914785441 1:150825086-150825108 GCAGGTGATCACTTGAAGCCAGG - Intronic
914788876 1:150858848-150858870 CAGGATGATCTCTTGGAGCTAGG - Intronic
916455736 1:164969574-164969596 CCAAGTGACCACATGGAGCACGG - Intergenic
920311238 1:205049661-205049683 CCGGGAGCTCACTGGGGGCAGGG - Intronic
920416000 1:205799770-205799792 GCGGATGATCACTGGGAACATGG - Exonic
921658337 1:217768150-217768172 CAGGGTAATCACTTGAACCAGGG + Intronic
922772907 1:228197985-228198007 CCTGGTGGTCACATGGAACACGG - Intergenic
1063997261 10:11631490-11631512 CAGGGGGATCACTTGAACCAGGG - Intergenic
1064083614 10:12328316-12328338 CAGGAGAATCACTTGGAGCAGGG - Intergenic
1064604673 10:17026402-17026424 GCGGGTGATCACTTGAGGCCAGG + Intronic
1066205665 10:33186948-33186970 CAGGATGATCACTTGAACCAAGG - Intronic
1067124711 10:43506409-43506431 CAGGGTGATCACTTGGGCCCAGG + Intergenic
1068110335 10:52672668-52672690 CAGGGTAATCACTTGAAGCTGGG + Intergenic
1070691887 10:78533153-78533175 CCGGGATTCCACTTGGAGCATGG + Intergenic
1070704579 10:78628526-78628548 CTGGCTGATCACTTGGGGAAAGG - Intergenic
1070762565 10:79033842-79033864 CGGGGAGATCACTTGAAGCCAGG - Intergenic
1072146055 10:92639358-92639380 CAGGGTGATCACTTGAGGCTAGG + Intronic
1073420048 10:103417398-103417420 CAGGCTGATCACTTGAAGCCAGG - Intronic
1074118999 10:110479325-110479347 CGGGATGATCACTTGAAGCCAGG - Intergenic
1076751090 10:132543643-132543665 CCAGGGGATCACTTGAAGCCAGG - Intronic
1079006756 11:16796893-16796915 CAGGAGGATCACTTGGAGCCGGG - Intronic
1082927826 11:58569615-58569637 CGGGGGGATCACTTGAAGCCAGG - Intronic
1083570306 11:63757451-63757473 TGGGAGGATCACTTGGAGCAAGG - Intronic
1086331812 11:85761884-85761906 CCGGCAGATCACTTGAAGCCAGG - Intronic
1090012325 11:123056324-123056346 CTGGGTGACCACTTGGACCCAGG + Intergenic
1092674398 12:10900277-10900299 CCTGGAGATAACTTGGAGAAAGG + Intronic
1095533959 12:43224405-43224427 CCGGCTGGTGGCTTGGAGCACGG - Intergenic
1096400093 12:51298839-51298861 CAGGGGGATCACTTGAAGCCAGG + Intronic
1097300653 12:58015099-58015121 CAGGATGATCACTTGAAGCCAGG - Intergenic
1100313161 12:93416538-93416560 CCAGGTGCTCACTTGGACCCAGG - Intronic
1101113859 12:101512537-101512559 CAGGTAGATCACTTGAAGCAAGG - Intergenic
1101689782 12:107066546-107066568 CAGGGGGATCACTTGGACCTGGG - Intronic
1101921648 12:108937925-108937947 CAGGTTGATCACTTGAAGCCAGG + Intronic
1102097931 12:110255208-110255230 GCGGGAGATCACTTGAAGCCAGG - Intergenic
1102203366 12:111073730-111073752 CAGGAGGATCACTTGGAGCCAGG + Intronic
1102537018 12:113589228-113589250 CTGGGAGATCTCTTGGAGGATGG + Intergenic
1103388928 12:120556014-120556036 CAGGTTGATCACTTGAAGCTGGG - Intronic
1103786298 12:123435898-123435920 CTGGGGGATCACTTGGAGCCAGG + Intronic
1103798637 12:123522818-123522840 CAGGAAGATCACTTGGAGCCAGG - Intronic
1104435472 12:128752915-128752937 AGGGGTGTTCACTTGGAGAAGGG - Intergenic
1104820209 12:131672712-131672734 CCGTGTGAGCACTCGGAGCAGGG - Intergenic
1105446021 13:20457781-20457803 CCATGTCAGCACTTGGAGCAGGG - Intronic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1115104105 14:29739061-29739083 CTGGAGGATCACTTGAAGCAAGG - Intronic
1115705035 14:35989946-35989968 CTGAGTGATCACATGGAGCATGG + Intergenic
1119234267 14:73006345-73006367 AAGGTTGATCACTTGAAGCAGGG + Intronic
1119707840 14:76797370-76797392 CCGGGGGATCACTTGAGGCCAGG + Intronic
1119797142 14:77408957-77408979 CAGGGGGATCACTTGAAGCCAGG - Intronic
1121174712 14:91882529-91882551 CTAGGAGATCACTTGGAGAAAGG + Intronic
1129055721 15:72818687-72818709 GTGGGTGACCACTTGCAGCAGGG - Intergenic
1131237523 15:90710040-90710062 CCGGCGGATCACTTGGGGCCAGG - Intergenic
1132800805 16:1752017-1752039 CCTGGTCATCTCTTGGAGCCGGG - Intronic
1133062936 16:3187091-3187113 GCGGGTGATCACTTGAAGCCAGG - Intergenic
1133421151 16:5648085-5648107 CAGGCTGATCACTTGAAGTAAGG - Intergenic
1134439560 16:14290436-14290458 CAGGCTGATCACTTGAGGCAAGG + Intergenic
1134654960 16:15941284-15941306 CTGGGGGATCACTTGAAGCTAGG - Intergenic
1136008965 16:27349976-27349998 CAGGGGGATCACTTGAAGCCAGG - Intronic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140463605 16:75161294-75161316 CGGGGAGATCACTTGTAGCCAGG - Intronic
1140973773 16:80039723-80039745 CTGAGTGATCATATGGAGCAGGG - Intergenic
1141702379 16:85648443-85648465 CTGGGGCCTCACTTGGAGCAGGG + Intronic
1141770289 16:86085604-86085626 CAGGGTGGTCACTGGGAGCCTGG - Intergenic
1142633591 17:1242561-1242583 CAGGAGGATCACTTGAAGCAAGG - Intergenic
1144553541 17:16261993-16262015 CCGGCAGATCACTTGAAGCCAGG + Intronic
1145302880 17:21653362-21653384 CTGGGTGTCCACTTGGAGCGTGG - Intergenic
1145755573 17:27387656-27387678 CAGGGAGATCACTTGAAGCCAGG - Intergenic
1146362330 17:32187057-32187079 CAGGGGGATCACTTGAAGCCAGG + Intronic
1146860960 17:36298083-36298105 CGGGCTGATCACTTGAAGCCAGG + Intronic
1146910848 17:36647446-36647468 CCGGGTGATCAGTGAGTGCACGG + Intergenic
1147091291 17:38102187-38102209 CGGGCTGATCACTTGAAGCCAGG + Intergenic
1147105921 17:38218318-38218340 CGGGCTGATCACTTGAAGCCAGG - Intergenic
1147180669 17:38683348-38683370 GCGGGTGATCACTTGAGGCCAGG + Intergenic
1148423589 17:47570192-47570214 CGGGCTGATCACTTGAAGCCAGG + Intronic
1148535475 17:48434893-48434915 CAGGGGGATCACTTGAGGCAGGG + Intergenic
1148535480 17:48434911-48434933 CAGGGGGATCACTTGAGGCAGGG + Intergenic
1148770116 17:50061612-50061634 CCAGGTGATCACTGGGGTCAGGG - Intronic
1148873149 17:50670308-50670330 CGGGGGGATCACTTGAAGCCAGG - Intronic
1150782835 17:68136739-68136761 CAGGGGGATCACTTGAAGCCAGG + Intergenic
1150962393 17:69928596-69928618 CAGGGTGAACAATTGGAACAAGG - Intergenic
1152493303 17:80652555-80652577 CAGGATGATCACTTGAAGCCAGG - Intronic
1152515880 17:80824674-80824696 CCGGTTGAGCACTCGGAGCGGGG + Intronic
1153137219 18:1930190-1930212 CAGGGTGATCCCTAGGACCAAGG - Intergenic
1154143146 18:11843430-11843452 CAGGATAATCACTTGAAGCAGGG + Intronic
1156342058 18:36218745-36218767 CAGGGGGATCACTTGAGGCAAGG - Intronic
1156699264 18:39805628-39805650 CCGGTTGATGAGTTAGAGCAGGG + Intergenic
1157269130 18:46257027-46257049 CAGGGTTATCACTTGGAAAAAGG + Intronic
1157836987 18:50913558-50913580 CAGGCTGATCACTTGGAGTCAGG - Intronic
1162177682 19:8843495-8843517 GCGGGTGATCACTTGTGGCCAGG + Intergenic
1162578745 19:11514748-11514770 CGGGATGATCACTTGAAGCCAGG - Intronic
1164822147 19:31258422-31258444 CGGGTTGAGGACTTGGAGCAAGG - Intergenic
1165029287 19:32985857-32985879 CCGGCGGATCACTTGAAGCCAGG - Intronic
1165716545 19:38049543-38049565 GCGGATGCTCACTTGAAGCATGG - Intronic
1166974187 19:46594305-46594327 CAGGAGGATCACTTGAAGCAAGG - Intronic
1167016482 19:46844267-46844289 CAGGGTAATCTCTTGGTGCAGGG - Intronic
924968453 2:100608-100630 CCGGGGGATCACTTGAACCCAGG + Intergenic
927211593 2:20642256-20642278 CGGGGAGATCCCTTGGTGCAGGG + Intronic
928690438 2:33793215-33793237 ACGGTTGATCCCTTGGAACAAGG + Intergenic
930083502 2:47474683-47474705 CCGGGGGATCACATGGGGCCAGG - Intronic
930118005 2:47736244-47736266 GCGGGTGATCACTTGAGGCCAGG + Intronic
933990590 2:87631388-87631410 CCGGGGGATCCCTGTGAGCAGGG + Intergenic
934977643 2:98815983-98816005 GCTGGTGTTCACTTGGAGTAGGG + Intronic
936303256 2:111319436-111319458 CCGGGGGATCCCTGTGAGCAGGG - Intergenic
936511664 2:113153234-113153256 CCGGGGGATCACTTGAGGCCAGG + Intergenic
941953413 2:171179728-171179750 CCGGGTGATCACTTGAGGTCAGG + Intronic
943174147 2:184447903-184447925 GCGGGAGATCACTTGGACCCAGG - Intergenic
943465763 2:188227469-188227491 CCAGGTGATCACTAGAAGAAGGG - Intergenic
943775068 2:191756491-191756513 CAGGATGATCACTTGAAGCCAGG - Intergenic
946157106 2:217814241-217814263 CAGGGGGATCACTTGGGGCCAGG - Intronic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
948115545 2:235492747-235492769 CCTGGTGAGCACTGGGAGAAGGG + Intergenic
948966583 2:241386324-241386346 CCGGAGGATCACTTGGGGCCAGG - Intronic
1169803821 20:9539245-9539267 CGGTGTGGTCACTTGGAGCACGG - Exonic
1172003035 20:31795528-31795550 CCAGGTGATCACTTAGAGCAGGG - Intronic
1172003041 20:31795558-31795580 CCGGGTGATCACTTGGAGCAGGG - Intronic
1172769049 20:37367565-37367587 CAGGGTGATCACTTGAGGCCAGG - Intronic
1176370354 21:6058573-6058595 CCAGGTGACCACTGAGAGCAAGG - Intergenic
1176416197 21:6476205-6476227 CCGGTGGATCACTTGAAGCCAGG + Intergenic
1176708778 21:10133302-10133324 CCTGGTGTCAACTTGGAGCACGG - Intergenic
1176972672 21:15285046-15285068 CGGGGGGATCACTTGGGGCCAGG - Intergenic
1177689387 21:24484670-24484692 CGGGAGGATCACTTGAAGCATGG + Intergenic
1179205001 21:39268209-39268231 GCGGGTGATCACTTGAAGTCAGG + Intronic
1179691697 21:43084539-43084561 CCGGTGGATCACTTGAAGCCAGG + Intergenic
1179753165 21:43479968-43479990 CCAGGTGACCACTGAGAGCAAGG + Intergenic
1180940596 22:19657710-19657732 CCTGGTGGTCACTTGAAGCCTGG + Intergenic
1182081706 22:27533951-27533973 CCGGGTGGGCACCTGGAGCTCGG - Intergenic
1183907253 22:41050834-41050856 GCGGGTGATCACTTGAGGCCAGG - Intergenic
1184652671 22:45926267-45926289 CCAGGTGGTCTCTTGGGGCAGGG - Intronic
949956831 3:9275970-9275992 CAGGGGGATCACCTGGAGCCAGG + Intronic
951524338 3:23639678-23639700 CAGGACGATCACTTGAAGCAAGG - Intergenic
956618186 3:71193674-71193696 CGGGCTGATCACTTGGGGCCAGG - Intronic
959022353 3:101201748-101201770 CAGGGTGATCATTTCCAGCAGGG + Intergenic
961996362 3:131248525-131248547 CCTGGTGCTAACTTGGAGAAAGG - Intronic
966617874 3:181931460-181931482 CAGGGTGATCACTTGAGGCCAGG + Intergenic
966687587 3:182712651-182712673 CAGGGGAATCACTTGGACCAGGG + Intergenic
966709608 3:182957397-182957419 CGGGGTGATCACTTGAGGCCAGG + Intronic
968572775 4:1350996-1351018 CAGGAGGATCACTTGGACCAGGG - Intronic
968985017 4:3870271-3870293 CCGTGTGATCACCTGGTGCTGGG + Intergenic
969563059 4:7961542-7961564 CAGGAGGATCACTTGAAGCAAGG + Intergenic
974274553 4:59701460-59701482 CGGGTTGATCACTTGAAGCCAGG + Intergenic
975341767 4:73250371-73250393 CGGGCGGATCACTTGGAGCCGGG + Intronic
978107981 4:104927890-104927912 CTGGATGATCACTTGAAGCCAGG + Intergenic
989326300 5:40199756-40199778 CGGGAAGATCACTTGAAGCAAGG + Intergenic
990517190 5:56541411-56541433 CCGGAGGATCACTTGAAGCCCGG + Intronic
992167725 5:74071419-74071441 CCGGGGGATCACTTGAGGCCTGG - Intergenic
992554859 5:77893181-77893203 CCAGGAGAACACTTGGAGGAGGG - Intergenic
993110356 5:83649674-83649696 CGGGTTGATCACTTGGAGTCAGG - Intronic
993925739 5:93863494-93863516 CCGGAGGATCACTTGAAGCCAGG - Intronic
994011867 5:94913965-94913987 CAGGAGGATCACTTGGAGCTAGG - Intronic
995974773 5:118020581-118020603 CCGGTGGATCACTTGGGGCCAGG - Intergenic
997128010 5:131247866-131247888 CAGGAAGATCACTTGGAGCCTGG - Intronic
1000808511 5:165829582-165829604 CGGGAGGATCACTTGGAGCCCGG - Intergenic
1001146318 5:169187779-169187801 CGGGCTGATCACTTGAAGCCAGG - Intronic
1004526970 6:16418044-16418066 CAGGGTGATTAATGGGAGCATGG + Intronic
1005397058 6:25393644-25393666 CGGGATGATCACTTGAAGCCAGG + Intronic
1006644260 6:35505467-35505489 CCAGGGCCTCACTTGGAGCAGGG - Intronic
1007457718 6:41993128-41993150 TGGGGAGATCACTTGGAGCCAGG - Intronic
1009719015 6:67440432-67440454 CAGGGGGATCACTTCGAGCCAGG - Intergenic
1013271330 6:108548003-108548025 CAGGAGGATCACTTGGAGCCAGG + Intergenic
1014826131 6:126050473-126050495 CCGGAGGATCACTTGGGGCCAGG + Intergenic
1015311266 6:131769577-131769599 CGGGGGGATCACTTGTAGCCAGG - Intergenic
1015943499 6:138475716-138475738 CCGGTGGATCACTTGGCGCTAGG + Intronic
1016366207 6:143321369-143321391 GCGGGTGATCACTTGAGGCCAGG + Intronic
1017842124 6:158231098-158231120 CAGGAGGATCACTTGGAGCCAGG + Intergenic
1019065603 6:169293867-169293889 GCGGGTGATCACTTGAAGTCAGG - Intergenic
1019597755 7:1866159-1866181 CCGGGTGCACACTGGGAGCCAGG + Intronic
1019726240 7:2604336-2604358 CAGGGTGATCACTTGAGGCCAGG - Intronic
1020442064 7:8227811-8227833 CAGGAGGATCACTTGGAGCCAGG - Intronic
1020926652 7:14335969-14335991 CAGGAGGATCACTTGAAGCAGGG - Intronic
1021706648 7:23374429-23374451 CCAAGTTATCACTTGAAGCAAGG + Intronic
1021987235 7:26108480-26108502 CCGGGGGATCCCTTGAACCAAGG + Intergenic
1024579430 7:50789994-50790016 CCCTGTGATCACCAGGAGCATGG + Intronic
1026491795 7:70869940-70869962 CAGGGGAATCACTTGGAGCCGGG - Intergenic
1026587914 7:71671795-71671817 GCGGGTGATCACTTGAAGTCAGG + Intronic
1027796283 7:82697634-82697656 CTGGGTGGTAACTTGTAGCATGG - Intergenic
1032106253 7:129033683-129033705 GCGGGTGATCACTTGAGGCCAGG + Intronic
1033308179 7:140239901-140239923 CTGGGTGATCCCTGGGTGCAGGG - Intergenic
1034625420 7:152488442-152488464 CAGGAGGATCACTTGGAGCCAGG + Intergenic
1040761493 8:50850345-50850367 CAGGGGGATCACTTGGACCTAGG - Intergenic
1041208214 8:55520356-55520378 CAGGAGGATCACTTGAAGCAAGG + Intronic
1041928635 8:63264428-63264450 CCGGTGGATCACTTGAAGCCAGG - Intergenic
1042378904 8:68089554-68089576 CCAGGTGATTTCTTGAAGCAAGG + Intronic
1043434232 8:80222828-80222850 CAGGGAGATCACTTGAAGCCAGG - Intronic
1043453953 8:80395325-80395347 CAGGATGATCACTTGAAGCTAGG + Intergenic
1043939018 8:86175298-86175320 CAGGCTGATCACTTGAAGCCAGG - Intergenic
1044110166 8:88263353-88263375 CTGGCTGATTACTTAGAGCAGGG + Intronic
1044716290 8:95102749-95102771 CAGTGTGTTCACTGGGAGCATGG - Intronic
1046287380 8:112111680-112111702 CCGGCGGATCACTTGAAGCCAGG + Intergenic
1047817845 8:128484223-128484245 CAGGCTGATCACTTGGAGTCAGG - Intergenic
1048522427 8:135169170-135169192 CCGAGTGGCCACTTGGAGCTGGG + Intergenic
1049195244 8:141312126-141312148 CCTGGGGATGCCTTGGAGCAGGG + Intergenic
1049307687 8:141914535-141914557 CTGGGTGGTCTCTAGGAGCAGGG + Intergenic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1053645756 9:40118800-40118822 CCTGGTGTCAACTTGGAGCATGG - Intergenic
1053759955 9:41344709-41344731 CCTGGTGTCAACTTGGAGCATGG + Intergenic
1054326768 9:63716701-63716723 CCTGGTGTCAACTTGGAGCATGG - Intergenic
1054538815 9:66257172-66257194 CCTGGTGTCAACTTGGAGCATGG + Intergenic
1058054531 9:100436239-100436261 CAGGGTGATCACTTGGGCCAAGG - Intronic
1060559343 9:124530035-124530057 CAGAGTGAACACTTGGGGCAAGG - Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1062302263 9:135881262-135881284 CAGGAGGATCACTTGGAGCCTGG + Intronic
1202793539 9_KI270719v1_random:102272-102294 CCTGGTGTCAACTTGGAGCACGG - Intergenic
1185698209 X:2211916-2211938 CGGGGTGATCACTTGAGGCCAGG + Intergenic
1187917059 X:24163748-24163770 GCAGGAGATCACTTGCAGCAAGG - Intronic
1189397465 X:40635746-40635768 CAGGGAGATTACTTGGAGCATGG - Intronic
1189442648 X:41051000-41051022 CGGGCTGATCACTTGGGGCCAGG + Intergenic
1191265872 X:58393011-58393033 CCAAGTGACCACTTGCAGCATGG - Intergenic
1197472522 X:126881174-126881196 CCTGGAGCTAACTTGGAGCAAGG + Intergenic
1197512084 X:127382001-127382023 CAGGCAGATCACTTGGAGCCAGG - Intergenic
1198212818 X:134531004-134531026 CAGGGGGATGACCTGGAGCAGGG - Intergenic