ID: 1172005793

View in Genome Browser
Species Human (GRCh38)
Location 20:31818616-31818638
Sequence CCGAGGGGCACTCTAGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172005793_1172005798 -7 Left 1172005793 20:31818616-31818638 CCTCAGGCTAGAGTGCCCCTCGG No data
Right 1172005798 20:31818632-31818654 CCCTCGGGCCACCCCTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172005793 Original CRISPR CCGAGGGGCACTCTAGCCTG AGG (reversed) Intergenic
No off target data available for this crispr