ID: 1172006370

View in Genome Browser
Species Human (GRCh38)
Location 20:31821476-31821498
Sequence GCATCAGAGCTCACCTTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172006365_1172006370 -3 Left 1172006365 20:31821456-31821478 CCAAGAAGCCCCCAAGCGAGGCA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1172006370 20:31821476-31821498 GCATCAGAGCTCACCTTTGAAGG 0: 1
1: 0
2: 0
3: 16
4: 142
1172006362_1172006370 22 Left 1172006362 20:31821431-31821453 CCTTCTAGTTCTGAGAAGCTGCT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1172006370 20:31821476-31821498 GCATCAGAGCTCACCTTTGAAGG 0: 1
1: 0
2: 0
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172006370 Original CRISPR GCATCAGAGCTCACCTTTGA AGG Exonic