ID: 1172006693

View in Genome Browser
Species Human (GRCh38)
Location 20:31823016-31823038
Sequence CACCCATGGCGGGGCGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 133}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172006693_1172006706 11 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006706 20:31823050-31823072 TTGCGGTGTTATTAGGATGGAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1172006693_1172006708 15 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006708 20:31823054-31823076 GGTGTTATTAGGATGGAGGGTGG 0: 1
1: 1
2: 0
3: 16
4: 193
1172006693_1172006709 16 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006709 20:31823055-31823077 GTGTTATTAGGATGGAGGGTGGG 0: 1
1: 0
2: 2
3: 5
4: 206
1172006693_1172006707 12 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006707 20:31823051-31823073 TGCGGTGTTATTAGGATGGAGGG 0: 1
1: 0
2: 1
3: 7
4: 79
1172006693_1172006705 8 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006705 20:31823047-31823069 AGATTGCGGTGTTATTAGGATGG 0: 1
1: 0
2: 0
3: 3
4: 70
1172006693_1172006703 4 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006703 20:31823043-31823065 GGCCAGATTGCGGTGTTATTAGG No data
1172006693_1172006710 20 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006710 20:31823059-31823081 TATTAGGATGGAGGGTGGGCAGG 0: 1
1: 0
2: 3
3: 20
4: 243
1172006693_1172006702 -6 Left 1172006693 20:31823016-31823038 CCGGTCCCGCCCCGCCATGGGTG 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1172006702 20:31823033-31823055 TGGGTGGTCTGGCCAGATTGCGG 0: 1
1: 0
2: 2
3: 6
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172006693 Original CRISPR CACCCATGGCGGGGCGGGAC CGG (reversed) Intronic
900626644 1:3611567-3611589 GAGCCAGGGCGGGTCGGGACTGG - Intergenic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
903332274 1:22602276-22602298 CACCCATGGGGGCGGGGGAGAGG + Exonic
903597131 1:24503156-24503178 CACCCAGCGCGGGGCGGGGCGGG + Intronic
904093304 1:27959912-27959934 CTCCCCGGACGGGGCGGGACGGG + Exonic
904330945 1:29757506-29757528 CACGCAGGGAGGGGAGGGACAGG - Intergenic
905061787 1:35146222-35146244 CACCCATGGCGTGCCTGTACCGG - Intergenic
905517173 1:38570273-38570295 CACCCACCGCGGGGCAGGCCGGG + Intergenic
906146919 1:43565792-43565814 CACCCAGGCGGGGGCGGGAAGGG + Intronic
906499569 1:46331746-46331768 CACCCATGGCGGGTCTGCATTGG - Intergenic
906606961 1:47179551-47179573 CACCCAGGACAGGGCTGGACAGG - Intergenic
907672885 1:56492388-56492410 CACCCAGGGAGTGGAGGGACTGG - Intergenic
912048337 1:105489935-105489957 CATCCATGGCTGGGCGAGAGAGG - Intergenic
915579166 1:156803238-156803260 CACTCAGGGAGGGGCGGGGCTGG - Intergenic
919972925 1:202592314-202592336 CTCCCAAGGCAGGGCTGGACTGG + Exonic
921225507 1:213015516-213015538 AACCCGGGGCGGGGCGGGGCGGG - Intronic
922550922 1:226493810-226493832 CAACCATGGCGGGGAGGGGTGGG - Intergenic
923505304 1:234600242-234600264 GACCCCGGGCGGGGCGGGGCGGG - Intergenic
923566994 1:235083721-235083743 CCCAGATGGCGGGGCGGGGCTGG + Intergenic
1064430477 10:15266336-15266358 CAGCCATGGCTGGGAGGGATAGG + Intronic
1066049464 10:31620580-31620602 CACCCAAGGCTGGGGGTGACAGG - Intergenic
1069738378 10:70672424-70672446 CACACTGGGCGGGGCGGGGCCGG - Intergenic
1069859621 10:71462219-71462241 CACACAAGGCGGGGCCGGGCAGG - Intronic
1072765295 10:98089979-98090001 TACCCTTGGTGGGGCGGGGCTGG - Intergenic
1073129548 10:101178412-101178434 CACACATAGCGGGGTGGGTCTGG - Intergenic
1074146515 10:110721473-110721495 CTGCCATGGAGGGACGGGACTGG + Intronic
1076676949 10:132152052-132152074 CTCCCATGGCAGGGCTGGGCAGG - Intronic
1076738217 10:132468128-132468150 CTCCCAGGGCGGGAGGGGACGGG + Intergenic
1077038494 11:506968-506990 CTCCCGTGGCGGGGCGGGGTCGG - Intronic
1077060330 11:615065-615087 CACCCGGGGCGGGGCGGGGCTGG + Intronic
1077237577 11:1489080-1489102 CAACCAAGGCGGGACGGGGCAGG + Intronic
1077916003 11:6611983-6612005 GACCCTTGGCGGCGCGGGCCGGG - Exonic
1080885283 11:36362417-36362439 CACCCTTGGCGGGGTGGGGGTGG + Intronic
1082912293 11:58390656-58390678 AGCCCATGGAGGGGCGGGGCAGG + Intergenic
1084245323 11:67853144-67853166 CACCCATGGCGTGCCTGTACTGG - Intergenic
1084470744 11:69357611-69357633 CATCCATGGTGGGGTGGGATGGG + Intronic
1089752415 11:120661001-120661023 CATCCCTGGAGGGGCGGGTCTGG + Intronic
1091144074 11:133261971-133261993 CACCCACGGCAGGGCAGGACAGG - Intronic
1091910700 12:4228307-4228329 CACTCATGGCGGAAGGGGACGGG - Intergenic
1092140595 12:6180708-6180730 CACCCACTGCGGGGCAGGCCTGG + Intergenic
1092195763 12:6548799-6548821 CATCCATGGGGGGGCGGAAGCGG - Exonic
1095349178 12:41188862-41188884 CACCCAGGGCTGGCCGGGGCGGG + Exonic
1100843516 12:98636897-98636919 CCCCCCTGGCAGGGAGGGACAGG - Intronic
1103479619 12:121242519-121242541 CACCCAAGGCGGGGCTGCCCAGG + Intronic
1104421583 12:128640459-128640481 CGCCCAGGGCTGGGAGGGACTGG + Intronic
1110464783 13:75788811-75788833 CACCCAGGGCAGGGCAGGGCTGG + Intronic
1113883987 13:113647752-113647774 CACCCGAGGCAGGGCGGGAAAGG - Intergenic
1118691250 14:68342474-68342496 CAGCCATAGAGGGACGGGACAGG + Intronic
1118883822 14:69850448-69850470 CAGCCATGGCGGGGCGGCAGGGG - Intergenic
1121782017 14:96628028-96628050 CACCCATGCAGGGCTGGGACAGG + Intergenic
1122263952 14:100538188-100538210 CACCCAGCGAGGGGGGGGACGGG - Exonic
1128906361 15:71471304-71471326 GACTCATGGAGGGGAGGGACAGG + Intronic
1129207863 15:74047922-74047944 CAACCATGGAGGGGCTGGACAGG + Intergenic
1132923758 16:2416060-2416082 CACCCCTGGCGGGGCGTGGTGGG + Intergenic
1134770129 16:16801061-16801083 CCCCCTTGGTGGGGAGGGACAGG - Intergenic
1136247915 16:28985777-28985799 ACCCCATGGCGGGGCAGGGCTGG + Intronic
1142566555 17:844040-844062 CAGCTAAGGAGGGGCGGGACGGG - Intronic
1145865462 17:28238497-28238519 CACCCATGGCGTGCCTGTACCGG - Intergenic
1148122545 17:45221665-45221687 CAACCATGGCGGGCGGGGAGTGG - Intronic
1149943738 17:60899098-60899120 CAGCCATGGTGGGTGGGGACAGG + Intronic
1152226303 17:79094419-79094441 CACCCAGGGCTGGGCGGGCCTGG + Intronic
1152861456 17:82698742-82698764 CACCAATGGCGGGGCCGGGCGGG - Intergenic
1154489898 18:14913305-14913327 CACAGATGGCTGGGCAGGACAGG - Intergenic
1157207082 18:45709935-45709957 CACACATGGAGGGGCAGGAAGGG - Intergenic
1161420936 19:4175635-4175657 AGCCCATGGTGGGGCGGGGCGGG - Intronic
1162235959 19:9309731-9309753 CAGGCAGGGCGGGGCGGGGCAGG + Intronic
1162398310 19:10430676-10430698 CCCCCAGGGCGGGGCGGGTCTGG - Intronic
1162535862 19:11262510-11262532 CAGCCGGGGCGGGGCGGGGCCGG + Intergenic
1163366904 19:16880515-16880537 CTCCCATGTCGTGGCGGGGCAGG - Intergenic
1163427073 19:17245676-17245698 CGCCCGTGGCGGGGGGGGAGGGG + Exonic
1164692568 19:30222349-30222371 CACCCCTGGTGGGGTGGGGCTGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
924973603 2:153804-153826 CACCCATTGCTGTGCTGGACTGG - Intergenic
926089974 2:10043455-10043477 CGCCCCTGCCGGGGCGGGGCCGG - Intronic
928318199 2:30262376-30262398 CACCTATGGAGGGGCTGCACAGG - Intronic
931877156 2:66526383-66526405 CACCCATGGCAGGCCGGGCCTGG + Intronic
932480561 2:72036673-72036695 CACCCATGGTGGGGCGGGGGGGG - Intergenic
932482965 2:72059918-72059940 CACACATGTCTGGGCTGGACTGG + Intergenic
934568611 2:95354221-95354243 AGCCCATGGCAGGGCAGGACAGG - Intronic
937283505 2:120736134-120736156 CAGCCGGGGCGGGGCGGGCCAGG - Intronic
938062193 2:128262667-128262689 CACCCCTGGCGGGGAGAGCCTGG - Intronic
939214404 2:139217649-139217671 CCCCCATGTTGGGGAGGGACCGG + Intergenic
940453565 2:153871002-153871024 CTCCCATGGCAGTGGGGGACAGG + Intergenic
943692312 2:190881247-190881269 CACCCGTGGTGGGGCGGGGGCGG + Exonic
944058425 2:195547330-195547352 GGCCCATGGCAGCGCGGGACTGG - Intergenic
944215608 2:197252334-197252356 GACCTTTGGCGGGGCGGGGCGGG - Intronic
946248137 2:218398677-218398699 CCTCCGTGGCGGGGCGGGGCGGG - Intronic
948478122 2:238234409-238234431 CGCCTCTGGCGGGGCGGGGCTGG + Intergenic
1171494749 20:25548098-25548120 CCCCCATGGCAAGGAGGGACAGG - Intronic
1172006693 20:31823016-31823038 CACCCATGGCGGGGCGGGACCGG - Intronic
1175215811 20:57391311-57391333 CGCCCGGGGCGGGGCGGGGCCGG + Intergenic
1175381560 20:58567617-58567639 CATCCATGGCGGGGAAGGCCGGG + Intergenic
1175514088 20:59557841-59557863 CACCCATGGCGTGCCTGTACCGG - Intergenic
1179190557 21:39118792-39118814 TCCCCATGGCGGGGCTGGCCTGG - Intergenic
1179437177 21:41369846-41369868 CAGCCACGGCGGGGCGGGAGCGG - Intronic
1179552839 21:42154390-42154412 CACACAGGGTGGGGAGGGACCGG + Intergenic
1179553105 21:42155759-42155781 CACACAGGGTGGGGAGGGACCGG - Intergenic
1179908224 21:44435074-44435096 CACCAATGGGGGAGCAGGACAGG - Intronic
1181102810 22:20552771-20552793 AACCCACGGCGGGGCTGGAGTGG - Intronic
1182318495 22:29463508-29463530 CACCCATGGCAGGGCTGGGATGG + Intergenic
1183780260 22:39994897-39994919 CCCCGACGGCGGGGCGGGGCGGG + Intergenic
1184323952 22:43767636-43767658 CACTCATGGCGGTGCCGGGCAGG - Intronic
1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG + Intronic
949498033 3:4652135-4652157 GACCCATGTCGGGGCGGAGCAGG + Exonic
950400941 3:12768878-12768900 AGCCCATGGCGGGGCGGGGCGGG + Intronic
950724247 3:14906282-14906304 CCGCCATGGAGGGGAGGGACAGG - Intronic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
961402054 3:126654669-126654691 CACCCGGGGCAGGGCGGGTCCGG - Intronic
962998165 3:140651666-140651688 AGCCCATGGTGGGGCGGGAGTGG - Intergenic
968957799 4:3728058-3728080 CCCCCACGGTGGGGAGGGACTGG - Intergenic
969239119 4:5888011-5888033 CCCGCATGGCGGGGCGGGGCTGG - Intronic
969646756 4:8434703-8434725 CACCCATGGCGTGCCTGTACCGG + Intronic
971257822 4:25030448-25030470 GACGCAGGGTGGGGCGGGACGGG + Intronic
973552634 4:52051330-52051352 CACCCAGGGCGGGGCGGCGCGGG + Exonic
978954581 4:114598683-114598705 CACGCAGGGCGGGGCGCGGCTGG + Exonic
984992738 4:185396703-185396725 CGGCCGTGGCGGGGCTGGACAGG + Exonic
985972097 5:3386410-3386432 CAGCCATGGCGTGGAAGGACGGG + Intergenic
997749425 5:136330156-136330178 CCCCCATGTGGGGGCGGGGCAGG - Intronic
998157748 5:139796020-139796042 CGGCCAGGCCGGGGCGGGACGGG + Intronic
999322559 5:150624604-150624626 CCCCCAGGGCTGGGCGGGGCGGG + Intronic
1001798044 5:174518673-174518695 CCCACATGGCGGGGGGGGAGGGG - Intergenic
1002644311 5:180645679-180645701 CAGCCCTGGCCGGGCTGGACGGG - Intronic
1004503173 6:16227024-16227046 CCCGCAGGGCGGGGCGGGGCGGG - Intergenic
1006341162 6:33447870-33447892 CAGCCATGGCGGGGTGGTCCCGG - Exonic
1006430650 6:33993597-33993619 CCCCCATGGCGGGGCGGGGGTGG - Intergenic
1006570507 6:34999273-34999295 CACCCATGGCGTGCCTGTACCGG + Intronic
1007722179 6:43891559-43891581 CGCCCAGGGCCGGGCGGGAGGGG + Intergenic
1010783672 6:79974726-79974748 CATCCATGGCAGGGAGGGAAAGG - Intergenic
1011643244 6:89433792-89433814 CGTCCAGGGCGGGGAGGGACGGG - Intronic
1012401408 6:98845236-98845258 CCCGCGGGGCGGGGCGGGACGGG - Intergenic
1018905951 6:168076005-168076027 CATCCATGCCGGGGCTGAACAGG - Intronic
1021375366 7:19900697-19900719 CTGCCATGGGGGGGAGGGACAGG - Intergenic
1027174173 7:75892882-75892904 CACCCAGGCCGGGGTGGGAAGGG + Intergenic
1029270846 7:99375513-99375535 CGCCTAGGGCGGGGCGGGGCCGG + Intronic
1029513941 7:101014209-101014231 CACCCAGGGCTGGGAGGGTCTGG - Intronic
1029649697 7:101882873-101882895 CAGCCAAGGCTGGGCGAGACAGG - Intronic
1034523347 7:151638132-151638154 CAACCATGGCAGGGAGGAACTGG + Intronic
1035277388 7:157755963-157755985 CAGCCAGGGCTGGGCGGGGCTGG + Intronic
1036817229 8:11911286-11911308 CACCCATGGCGTGCCTGTACTGG - Intergenic
1049362447 8:142218727-142218749 CACCCAGGGTGGGGCGGGGAGGG - Intronic
1050851269 9:10289555-10289577 CACAAATGGCGGGGCGGTAGGGG - Intronic
1056969176 9:91188099-91188121 CACCCAGGGCTGGGCAGGTCTGG + Intergenic
1057211869 9:93204884-93204906 CACCCAGGGCCAGGCAGGACAGG - Intronic
1060945912 9:127569198-127569220 GACCGAGGGCGGGGCGGGGCGGG - Intronic
1062331341 9:136046171-136046193 CCCCCGTGGTGGGGCGGGAAGGG + Intronic
1062352832 9:136147625-136147647 CACCCATGGCGGGGCCAGGAGGG + Intergenic
1062482241 9:136757913-136757935 CAGCCATGGAGGAGCTGGACCGG - Exonic
1062565683 9:137163019-137163041 CCACCCTGGCGGGGCGGGACAGG + Intronic
1062614687 9:137391024-137391046 GACCCATGGTGGGGCGGGGGTGG + Intronic
1192203837 X:69083244-69083266 CAACCATGGGGAGGCGGGACAGG + Intergenic
1199772830 X:150984703-150984725 CGGCCCGGGCGGGGCGGGACCGG - Intronic
1200093119 X:153644901-153644923 CCCCCACGGCAGGGCGGGCCGGG + Intronic