ID: 1172012345

View in Genome Browser
Species Human (GRCh38)
Location 20:31852911-31852933
Sequence AACAAAGAGGCCCCTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172012345_1172012354 20 Left 1172012345 20:31852911-31852933 CCAGGTGGAGGGGCCTCTTTGTT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1172012354 20:31852954-31852976 CCTTGTGCACCATCCAGGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 182
1172012345_1172012358 29 Left 1172012345 20:31852911-31852933 CCAGGTGGAGGGGCCTCTTTGTT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1172012358 20:31852963-31852985 CCATCCAGGCCTGGAGGATTGGG 0: 1
1: 0
2: 2
3: 19
4: 208
1172012345_1172012355 23 Left 1172012345 20:31852911-31852933 CCAGGTGGAGGGGCCTCTTTGTT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1172012355 20:31852957-31852979 TGTGCACCATCCAGGCCTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 233
1172012345_1172012356 28 Left 1172012345 20:31852911-31852933 CCAGGTGGAGGGGCCTCTTTGTT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1172012356 20:31852962-31852984 ACCATCCAGGCCTGGAGGATTGG No data
1172012345_1172012359 30 Left 1172012345 20:31852911-31852933 CCAGGTGGAGGGGCCTCTTTGTT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1172012359 20:31852964-31852986 CATCCAGGCCTGGAGGATTGGGG 0: 1
1: 0
2: 1
3: 27
4: 227
1172012345_1172012351 15 Left 1172012345 20:31852911-31852933 CCAGGTGGAGGGGCCTCTTTGTT 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1172012351 20:31852949-31852971 CTTGCCCTTGTGCACCATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172012345 Original CRISPR AACAAAGAGGCCCCTCCACC TGG (reversed) Intronic
900503320 1:3017134-3017156 GACAGAGAGGCCCCTCGCCCAGG + Intergenic
901947581 1:12715951-12715973 AAGAAAGTGGCCCATCCAGCCGG - Intergenic
905183535 1:36180365-36180387 AACAGAGAGGACCCACCCCCAGG - Exonic
906776516 1:48534727-48534749 AACATACTGCCCCCTCCACCAGG + Intronic
906863620 1:49390935-49390957 ATCAAAAAGGCCCTTACACCAGG + Intronic
910871223 1:91834998-91835020 CACAAAGAAGCTCCTCCTCCAGG + Intronic
911245042 1:95507629-95507651 AACAAAGAGGCACCTGCTTCAGG + Intergenic
915592679 1:156879509-156879531 GAGACAGAGCCCCCTCCACCAGG - Intronic
916295012 1:163209130-163209152 ACCAAAAAGGCCCTTCCTCCTGG + Intronic
917682784 1:177384833-177384855 AAGACAGTGGCCCCTCCCCCTGG + Intergenic
919972237 1:202588691-202588713 CACATAGAGGCCCCTTCCCCAGG + Exonic
921203886 1:212831748-212831770 AACACACAGGCCTCCCCACCAGG + Intronic
922483493 1:225955793-225955815 ACCACAGAGGCCACTCCTCCTGG - Intergenic
923483141 1:234403562-234403584 AAGAAAGAGGCTCATCTACCTGG + Intronic
1063427707 10:5962747-5962769 AACAGACAGGCCCATCCCCCCGG + Intronic
1063701208 10:8387033-8387055 AACAAAGAAAACCCTCCACCTGG - Intergenic
1064146437 10:12829830-12829852 AACTGAGGGGCCCCTCCTCCTGG - Exonic
1067835781 10:49640468-49640490 AATAAGGAGTCCCCTCCCCCAGG - Intronic
1073419560 10:103413319-103413341 AACAAAGAGGCCTCCTTACCCGG - Exonic
1074442117 10:113487190-113487212 AACTAAGAGGCCCCTCCATGGGG - Intergenic
1075188511 10:120284803-120284825 AACAAAGGGTCCTTTCCACCGGG + Intergenic
1075705745 10:124499310-124499332 AACACACAGCCCCCTCCAGCAGG + Intronic
1076206717 10:128609859-128609881 AACCTAGAGGCCCCTGCTCCAGG - Intergenic
1076350057 10:129809562-129809584 CACAAAGCAGCCCCTCCACAGGG + Intergenic
1076388897 10:130081660-130081682 AACAGAAAGGCACTTCCACCTGG + Intergenic
1076522841 10:131091566-131091588 AAGGAAAAGGCCTCTCCACCAGG - Intergenic
1077078512 11:712295-712317 AAAAAAAAGGCCCCTGCGCCTGG + Intronic
1077318828 11:1931606-1931628 AACACAGAGATTCCTCCACCAGG - Intronic
1079063484 11:17270069-17270091 AACAATGAAACCCGTCCACCTGG - Intronic
1084474163 11:69379263-69379285 AACAAAAATCCCTCTCCACCGGG + Intergenic
1087390490 11:97525132-97525154 AACAAATATGCCCCTTCAGCAGG + Intergenic
1089401116 11:118165189-118165211 GACACAGAGGCCCCTCCCACTGG + Exonic
1089817547 11:121189813-121189835 TGCAGAGAGGCCCATCCACCCGG - Exonic
1089991275 11:122862655-122862677 ACCATACAGGCCCCTCCAACTGG + Intronic
1090800531 11:130168762-130168784 AACAGAGGGGCCCCACCCCCAGG - Intronic
1096586633 12:52626901-52626923 AACAAGGTGGCCACTCTACCCGG + Intergenic
1097807595 12:63983012-63983034 AACAAAAAGGCCTCTTCAGCTGG - Intronic
1100285874 12:93165785-93165807 AAAAAAGAGGACCTTCCAGCTGG - Intergenic
1104588723 12:130067689-130067711 ACCATAGAGGCCCCACCAGCAGG - Intergenic
1106103015 13:26710387-26710409 AACACAGAGGCCCGTCTTCCTGG + Intergenic
1116409111 14:44601480-44601502 AAGTGAGGGGCCCCTCCACCCGG + Intergenic
1120842016 14:89094425-89094447 GAAAAAGAGGCCCCTCCTCCGGG + Intergenic
1120847686 14:89140259-89140281 CACACAGAGGCCCCTCCAGTGGG - Intronic
1121378727 14:93440719-93440741 AACAAAAATGCCCTTCCACATGG - Intronic
1128767386 15:70259412-70259434 AACATAAAGGCCACACCACCAGG - Intergenic
1130306063 15:82712802-82712824 AACAAAGATGCCCAGACACCTGG - Intergenic
1131232031 15:90666448-90666470 AAAGAAGAGCCCCTTCCACCAGG + Intergenic
1134147864 16:11781846-11781868 AACAAAGAGGCCCTTCTGCCCGG + Intronic
1134516420 16:14890899-14890921 AACACAAACGCCCCTCAACCAGG - Intronic
1134704093 16:16289551-16289573 AACACAAACGCCCCTCAACCAGG - Intronic
1134963450 16:18422563-18422585 AACACAAACGCCCCTCAACCAGG + Intronic
1134967745 16:18505162-18505184 AACACAAACGCCCCTCAACCAGG + Intronic
1136466616 16:30448558-30448580 ATCAAGGAGGCCCCTCAGCCAGG - Intergenic
1139231143 16:65283583-65283605 AAGAACCAGGCCCCTTCACCAGG - Intergenic
1139410031 16:66751607-66751629 CACAAAGAGGGCCCTCCCCCGGG + Exonic
1140196547 16:72860197-72860219 AACACAGAGCCCCCTCCAGCTGG + Intronic
1140514465 16:75532152-75532174 GAGAAAGAACCCCCTCCACCTGG + Intronic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1148752455 17:49953118-49953140 AACAAACAGGCTTCTCCTCCAGG + Intergenic
1151921096 17:77156143-77156165 CACAGAGAGGAACCTCCACCAGG - Intronic
1151988129 17:77557103-77557125 AAGAAAGAAGCCCCTACCCCTGG - Intergenic
1153909770 18:9696557-9696579 AACAGAGAAGGCCCACCACCGGG - Intergenic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1160450870 18:78965306-78965328 ACCCAGGCGGCCCCTCCACCTGG + Intergenic
1160504786 18:79420953-79420975 AAGAGGGAGGCCCCTCCAGCAGG + Intronic
1163579148 19:18128046-18128068 AACATATTGGACCCTCCACCTGG + Intronic
1166896173 19:46023061-46023083 ATAAAGGCGGCCCCTCCACCGGG - Exonic
1168407521 19:56118689-56118711 ACCACAGAGGCCCCAGCACCTGG + Intronic
925030670 2:648137-648159 AACCAGGAGGCCCCCCAACCAGG + Intergenic
928203588 2:29267898-29267920 AACACAAAGGCCCCTCCATCAGG - Intronic
931254180 2:60555563-60555585 AACAATAAAGCCCCCCCACCGGG - Intergenic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
935872095 2:107462106-107462128 ATCAAAGAAGGCCATCCACCAGG - Intergenic
937207421 2:120245701-120245723 TGCAAGGAGGCCCCTCCCCCGGG + Intronic
937911486 2:127077794-127077816 GCCAAAGAGGCACCTCCATCAGG + Intronic
940766403 2:157794391-157794413 AATGATGAGGCCCCTTCACCTGG - Intronic
944447933 2:199810483-199810505 AAGAAAGAGGTGCCTCCAACAGG - Intronic
946081942 2:217128090-217128112 AGCAAAGAGGACCCTCCCTCTGG - Intergenic
1169553635 20:6726818-6726840 AACAAAGAGCCCAGTCCACGTGG + Intergenic
1170782796 20:19440625-19440647 AACAGTGAGGCCTCTCCTCCAGG - Intronic
1171187940 20:23136842-23136864 ATAAGAGAGGCCCCTCCACCTGG - Intergenic
1171486917 20:25491812-25491834 CCCAAGGTGGCCCCTCCACCCGG + Intronic
1172012345 20:31852911-31852933 AACAAAGAGGCCCCTCCACCTGG - Intronic
1174310331 20:49648329-49648351 AAAACAGAGGCTCCTCAACCTGG - Intronic
1178545079 21:33486407-33486429 AACAAAGTGGCCACTGGACCAGG + Intronic
1179190964 21:39121393-39121415 AACAAAGAGCCCACTGCCCCTGG + Intergenic
1180992032 22:19942443-19942465 AAGAGAGAGGCTGCTCCACCAGG + Intronic
1183581888 22:38731230-38731252 ATCCCAGAAGCCCCTCCACCCGG - Exonic
1184293550 22:43510311-43510333 CTCCAAGAGTCCCCTCCACCAGG + Intergenic
949876712 3:8630889-8630911 CGCAAAGAGGCGCCTCCCCCAGG - Exonic
950118578 3:10467126-10467148 ACCAGAGAGGCCCCTCCCCTGGG - Intronic
953378388 3:42447744-42447766 ATCCCAAAGGCCCCTCCACCTGG + Intergenic
955122693 3:56076719-56076741 ATCAGAGATGCTCCTCCACCTGG + Intronic
960668177 3:120131305-120131327 AACAAAGGGGCCCCTCACCTTGG + Intergenic
960884855 3:122383602-122383624 AACAAAGACCCCCCTGCTCCAGG - Intergenic
961443653 3:126967673-126967695 AACAAAGCAGCTCCTTCACCTGG - Intergenic
962142618 3:132806225-132806247 GCCAATGATGCCCCTCCACCAGG - Intergenic
969054009 4:4390469-4390491 AACAAAGAGACCCCAGCAACTGG - Intronic
969298851 4:6285416-6285438 AACACAAAGGCCCCTCTCCCTGG - Intronic
969486011 4:7472749-7472771 CATAATGAGGCCCCTCCAGCGGG - Intronic
971071167 4:23093859-23093881 AATAAAGAGGCCCCTGCAAATGG - Intergenic
974797329 4:66769532-66769554 AACAAAGAGGACTGTCAACCAGG + Intergenic
974974923 4:68880028-68880050 AACAAAGAAGGCCCACCACAGGG + Intergenic
975730569 4:77333673-77333695 AACAATTAGGCCCCACCAGCTGG - Intronic
979386171 4:120067523-120067545 ACCAAAGAGGCCCATCAACATGG + Intergenic
984259888 4:177432291-177432313 ACCAAAGAGGACCCTCCCCCAGG - Intronic
986665777 5:10102753-10102775 TACCAAAAGGCCCTTCCACCTGG + Intergenic
992136338 5:73749981-73750003 AACAAAGAGGACACCTCACCTGG - Exonic
999085929 5:148889714-148889736 AAGAAAGAGGCCATTCTACCAGG - Intergenic
1002107803 5:176888777-176888799 ACCAAAGAGGACCCCACACCGGG + Exonic
1003776324 6:9369820-9369842 AACAAAGGGGCCACTCCAGAGGG + Intergenic
1005816378 6:29556062-29556084 GGCAAAGAGGCACCTCCTCCAGG - Exonic
1006269556 6:32953315-32953337 ACCAAAGAGGGAACTCCACCAGG - Intronic
1007427557 6:41757227-41757249 CAAAAAGAGGCCCCTCGGCCGGG - Intergenic
1013355692 6:109344175-109344197 AATGAAGAGGGACCTCCACCAGG + Intergenic
1013639338 6:112057989-112058011 AGCAAAGAGGCCACTGAACCTGG + Intronic
1013744123 6:113324602-113324624 AACCAAAAGGCCCTTTCACCTGG + Intergenic
1015106194 6:129539576-129539598 AAGAAAAAGGCCACTCCTCCAGG - Intergenic
1015585261 6:134769843-134769865 AACAAAGATGTGCATCCACCAGG - Intergenic
1016992219 6:149938270-149938292 AACAAAGAGAAACCTCCGCCAGG - Intergenic
1016994775 6:149954210-149954232 AACAAAGAGAAACCTCCGCCAGG - Intergenic
1017003831 6:150015226-150015248 AACAAAGAGAAACCTCCGCCAGG + Intergenic
1017864372 6:158430265-158430287 AACAAAGAAGCCCATCCACATGG + Intronic
1019016838 6:168886082-168886104 AACAAAGAGGCCACTGATCCGGG + Intergenic
1020140849 7:5610758-5610780 ATCACAGAGGCCCCTCCTCCCGG - Intergenic
1020614572 7:10442116-10442138 AACATAGATGCCACTCCAGCAGG + Intergenic
1020669950 7:11094173-11094195 AACTAACAGACACCTCCACCAGG - Intronic
1020906988 7:14075624-14075646 ACCACAGAGGGGCCTCCACCTGG + Intergenic
1020936035 7:14465096-14465118 CAGAAAGAGGCACCTCCTCCTGG + Intronic
1023429676 7:40077008-40077030 AACAAATAGGCAACTCCAGCTGG - Intronic
1027404537 7:77846149-77846171 AAAATAGAGGCTCTTCCACCAGG - Intronic
1028189443 7:87828090-87828112 TTCAAAAGGGCCCCTCCACCTGG + Intronic
1032442106 7:131949858-131949880 AGCAAAGGGGCCCCGCCAGCGGG - Intergenic
1035246572 7:157566369-157566391 GACAAAGACGCCCCGCCACACGG + Intronic
1042150288 8:65775542-65775564 AACAAAAAGGCCTGGCCACCTGG - Intronic
1042393601 8:68264845-68264867 AAAAAAGAAGCCACTCCACAGGG - Intergenic
1045828736 8:106432419-106432441 AGCAAAGAGGCCAGTGCACCAGG - Intronic
1047346494 8:124033873-124033895 CACAAAGAGGCCACTCCACTTGG - Intronic
1049307340 8:141911346-141911368 AACAAATTGTCCCCTCCACAGGG + Intergenic
1050024509 9:1320011-1320033 AGCAAAGAAGCCCCTTCAGCAGG - Intergenic
1052378363 9:27742381-27742403 AGCAAAGATGTCCCTCCCCCTGG + Intergenic
1055242088 9:74197626-74197648 AAGTGAGAAGCCCCTCCACCCGG + Intergenic
1057317809 9:93981323-93981345 AACAAAAAGAGCCCTGCACCAGG + Intergenic
1058233030 9:102454120-102454142 AACAAATAGGTCCTTCCAACTGG - Intergenic
1061013427 9:127968430-127968452 AAAACAGAGGCCCTTCCTCCAGG - Intronic
1061861742 9:133471967-133471989 AACACAGAGGCCCAGCCACTGGG + Exonic
1187313383 X:18168109-18168131 AACATAGAGGTCTCTCCACATGG - Intronic
1198278265 X:135117791-135117813 ACCCAGGAGGCCCCTCTACCTGG + Intergenic
1198292697 X:135254725-135254747 ACCCAGGAGGCCCCTCTACCTGG - Intronic
1198298594 X:135310921-135310943 ACCCAAGAGGCCCCTCTACCTGG - Intronic
1199635833 X:149810630-149810652 AACAGAGAGGCATCTCCTCCTGG + Intergenic
1199643835 X:149886221-149886243 AACAGAGAGGCATCTCCTCCTGG + Intergenic
1199875605 X:151925548-151925570 AACAGAGAGGAGCCTCTACCTGG + Intergenic
1199955428 X:152738068-152738090 AACAGAGAGGAATCTCCACCTGG + Intergenic