ID: 1172013003

View in Genome Browser
Species Human (GRCh38)
Location 20:31857272-31857294
Sequence ATGCCAGGAGGTCCTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172012994_1172013003 11 Left 1172012994 20:31857238-31857260 CCAGAATTGAAATGACGGCAACT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1172013003 20:31857272-31857294 ATGCCAGGAGGTCCTCCAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 232
1172012993_1172013003 12 Left 1172012993 20:31857237-31857259 CCCAGAATTGAAATGACGGCAAC 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1172013003 20:31857272-31857294 ATGCCAGGAGGTCCTCCAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172013003 Original CRISPR ATGCCAGGAGGTCCTCCAGG GGG Intronic
900093705 1:931709-931731 CTGCCAGGAAGGCCTCCAGAGGG - Intronic
900410419 1:2510145-2510167 ACGCCAGGATGACCTGCAGGAGG + Exonic
900481888 1:2903392-2903414 AGGGCAGGAGGCCCTCCACGCGG + Intergenic
900831771 1:4970474-4970496 ATGTCAGGAGGGCCTACAGAAGG - Intergenic
900952958 1:5868267-5868289 AGGCCAGGAGGTCCTGGAGTGGG + Intronic
900997774 1:6131709-6131731 ACTCCAGGAAGTCCTCCAGGAGG + Exonic
901053997 1:6440302-6440324 GTGCCAGGAGGGCCACCTGGAGG + Exonic
901870273 1:12134793-12134815 CTGCCTTGAGGTCCTCCATGTGG + Intronic
902480294 1:16708008-16708030 GTGCCAGGAGGGCCACCTGGAGG - Intergenic
902503283 1:16924401-16924423 GGGCCAGCAGGTCCTCCACGCGG - Exonic
907330042 1:53664831-53664853 ATGCCAGGAGGTTTTCTTGGGGG + Intronic
907388780 1:54142830-54142852 GTGCCAGCAGGTGCTCCAGGGGG - Intronic
909497197 1:76291369-76291391 CTGCCAGGAGGTGCTCCGGCAGG - Intronic
912479577 1:109970978-109971000 ATGCCAAGATGTCCTTCAGTAGG + Intergenic
913389548 1:118295294-118295316 TTGCCAGGAATTCCTCCAGCAGG + Intergenic
913412129 1:118563727-118563749 AGGCCTGGAGGTTCTCCAGGGGG + Intergenic
918436132 1:184515107-184515129 ATGCCAGGAGGTGTTCAAAGAGG - Intronic
919377139 1:196808854-196808876 GGGCCAGGAGGACTTCCAGGTGG + Intergenic
920339961 1:205269531-205269553 CTTCCAGGGGGTCCTTCAGGTGG - Exonic
921359582 1:214318390-214318412 ATGCCAAGAGGGCCAGCAGGAGG - Intronic
922003425 1:221503987-221504009 ATGCCTGGAGATCCTCCTGGAGG - Intergenic
922825137 1:228512528-228512550 ATTCCACGAGGACATCCAGGAGG + Intergenic
923675380 1:236076410-236076432 ATGCCTGTATGTCATCCAGGTGG - Intergenic
924068658 1:240254069-240254091 AGGCCAGTTGGACCTCCAGGTGG + Intronic
924381049 1:243464797-243464819 ATGCCAGTGGGTCATCCAGCAGG - Intronic
924458930 1:244240903-244240925 GTGCCAGTAGGTGCTCCAGTGGG - Intergenic
1063068397 10:2634090-2634112 ATTCCAGAAGGTCCTCAAGTTGG + Intergenic
1063829221 10:9932949-9932971 ATGTCAGGAGGGCTTCCCGGAGG + Intergenic
1067140330 10:43650757-43650779 ATGCCAAGAGAACCTCCAGATGG + Intergenic
1067749281 10:48959505-48959527 AAGCAAGGAGGGCCTCCTGGAGG + Intronic
1069710595 10:70486092-70486114 CTGCCAGGTATTCCTCCAGGAGG + Intronic
1073149371 10:101301554-101301576 AAGCCAGGAGGACCTGCAGAGGG + Intergenic
1075617595 10:123902982-123903004 GTGCCAGAGGGTACTCCAGGTGG - Intronic
1075961190 10:126568822-126568844 AAGGCAGGAGGATCTCCAGGAGG + Intronic
1076474701 10:130743972-130743994 ATGCCAGGTGGGCAGCCAGGTGG - Intergenic
1076865172 10:133163018-133163040 ATGCAAGGAGGGCTTCCTGGAGG + Intronic
1076890607 10:133281331-133281353 GGGCCAGGAGGTCCAGCAGGTGG + Exonic
1077016174 11:399995-400017 TGGCCAGGCGGTCCTTCAGGTGG - Exonic
1077342124 11:2030864-2030886 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1078026280 11:7698608-7698630 ATGGCTGTAGGTGCTCCAGGTGG + Intronic
1078329088 11:10404118-10404140 GCCTCAGGAGGTCCTCCAGGAGG + Intronic
1079153956 11:17926775-17926797 GTCTCAGGAGGCCCTCCAGGTGG - Intronic
1083257882 11:61507992-61508014 CTGCCAGGAGCTCCCGCAGGAGG + Intergenic
1083325119 11:61869254-61869276 CTGCCAGCGGGTCCACCAGGAGG - Intergenic
1083733073 11:64663599-64663621 AGCCCAGGAGGTCCTGCAGTGGG - Intronic
1084570936 11:69959515-69959537 AGGCCAGGAGTGCCTCCTGGGGG - Intergenic
1084986565 11:72878711-72878733 ATGTCAGGTGGAACTCCAGGAGG + Intronic
1089655892 11:119946701-119946723 AGTCCAGGAGGACTTCCAGGTGG + Intergenic
1090836995 11:130461218-130461240 ATGCAGGGAGGTCCTCTGGGAGG - Intronic
1202825110 11_KI270721v1_random:86053-86075 ATGCCAGGGGGGTCTCCAGGTGG + Intergenic
1091692332 12:2605614-2605636 ATGCCAGGAGCCTTTCCAGGAGG - Intronic
1092682895 12:11007372-11007394 TTTCCAGAAGGTCATCCAGGTGG + Intronic
1092688502 12:11078986-11079008 TTTCCAGGAGGTCATCCAGGTGG + Intronic
1100064429 12:90624435-90624457 ATTCAGGCAGGTCCTCCAGGAGG + Intergenic
1101006305 12:100404331-100404353 CTGCCAAGAGGTCATCCAGCTGG + Intronic
1101319509 12:103661126-103661148 AGGCCAGGAGGTCCTCATTGAGG + Intronic
1102457148 12:113077873-113077895 GCGCCTGGAGGCCCTCCAGGTGG - Exonic
1103609947 12:122117227-122117249 ATGCCAAGAGATCCACGAGGAGG + Intronic
1104000134 12:124855007-124855029 ATGCCTGGAGCTCCACCAGCAGG + Intronic
1104872729 12:132011939-132011961 AAGCCAGCAGGGCCTCCAGGGGG - Intronic
1105279121 13:18952984-18953006 ATGGCAGGATGGGCTCCAGGAGG + Intergenic
1106771220 13:32962392-32962414 ATGACAGGAGGTATTCCATGAGG + Intergenic
1108496098 13:51026801-51026823 CTGCCTGGAGGGCCTGCAGGTGG + Intergenic
1108540099 13:51434031-51434053 CTGCCAATAGGACCTCCAGGTGG - Intronic
1113422027 13:110178219-110178241 ATTCCAGGAGGGCCTGCAGTTGG + Exonic
1113461410 13:110484925-110484947 ATGACAGGAGGTGGTCCTGGGGG - Exonic
1113920828 13:113908379-113908401 AGGCCAGCAGATCCTCCCGGTGG - Intergenic
1114043839 14:18704198-18704220 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1114048125 14:18894640-18894662 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1114114393 14:19507004-19507026 AGGCCAGGAGGAGCTCCAGTAGG - Intergenic
1114116088 14:19624757-19624779 AGGCCAGGAGGAGCTCCAGTAGG - Intergenic
1116586921 14:46717706-46717728 ATGGCAGGAGGTCATTCATGAGG + Intergenic
1122100127 14:99401971-99401993 AGGCCAGGAGCTCCTGCAGCAGG + Intronic
1122224022 14:100262405-100262427 ATGCCAGGTATTCCTCCAGGAGG - Exonic
1122548842 14:102539277-102539299 GGGCCAGGAGGGCCTCCTGGGGG + Intergenic
1123209067 14:106741295-106741317 ATGTCCTGAGGTCCTCCTGGTGG + Intergenic
1124899304 15:33807678-33807700 AGGCCTGGGGGACCTCCAGGCGG - Intronic
1125665160 15:41424796-41424818 AGGCCAGGAGTTCGACCAGGCGG + Intronic
1130179587 15:81611611-81611633 GTGTCAGGAGGTCCTCCCTGAGG - Intergenic
1130257166 15:82331165-82331187 ATGGGAACAGGTCCTCCAGGAGG + Intergenic
1130597785 15:85258825-85258847 ATGGGAACAGGTCCTCCAGGAGG - Intergenic
1132469263 16:92859-92881 AGGCCAGGCAGGCCTCCAGGTGG + Intronic
1132602196 16:778375-778397 AGGACGGGAGGTCCACCAGGAGG - Intronic
1132704710 16:1238548-1238570 GCGCCAGGCAGTCCTCCAGGAGG - Intergenic
1132706805 16:1247770-1247792 GCGCCAGGCAGTCCTCCAGGAGG + Intergenic
1132951722 16:2566614-2566636 ACGCCAGCAGGTCTTCCTGGGGG + Intronic
1132962628 16:2633556-2633578 ACGCCAGCAGGTCTTCCTGGGGG - Intergenic
1134834117 16:17347046-17347068 AGACCAGGTGGTCCTGCAGGAGG - Intronic
1134892990 16:17857748-17857770 AATCCAGGAGGACTTCCAGGAGG + Intergenic
1135709010 16:24699335-24699357 AACCCAGGAGGACTTCCAGGAGG + Intergenic
1136856961 16:33666421-33666443 TTGCCAGGAGGTCCTCGGGAGGG - Intergenic
1140347593 16:74228922-74228944 AGGCAGGGAGGTCATCCAGGTGG + Intergenic
1141596248 16:85098588-85098610 GTGCCCTGAGGTCCTCCACGGGG + Exonic
1142371710 16:89686375-89686397 ATGTGGGGAGGTCCTCCAGGTGG - Intronic
1142371720 16:89686407-89686429 AGGTAAGAAGGTCCTCCAGGTGG - Intronic
1203118534 16_KI270728v1_random:1514896-1514918 TTGCCAGGAGGTCCTCGGGAGGG - Intergenic
1142994167 17:3751165-3751187 ATGCCTGGGGGCCATCCAGGTGG + Intronic
1143411290 17:6711018-6711040 AGGCCAGGAGGGAATCCAGGTGG + Intronic
1144079240 17:11747561-11747583 CAGCCAGGAGCTCCTCCAGCTGG - Exonic
1145912361 17:28550042-28550064 CTGCCAGGAGGGCTTCCTGGAGG - Intronic
1146547113 17:33749193-33749215 ATGACAGAAAGGCCTCCAGGAGG - Intronic
1148213417 17:45821416-45821438 GTGCCAGGAGATCCTCAATGAGG + Exonic
1148456245 17:47813070-47813092 ATCCCAGGAGTTCCACCTGGGGG - Intronic
1148730906 17:49835818-49835840 AAGCAAGGAGGTCTGCCAGGAGG + Intergenic
1150639576 17:66940308-66940330 GGGACAGGAGGACCTCCAGGGGG + Intergenic
1151968331 17:77444049-77444071 ATGTCAGGAGGGCTTCCTGGAGG + Intronic
1152008708 17:77697714-77697736 ATGCCAGGTGGACACCCAGGTGG + Intergenic
1152214795 17:79025702-79025724 ATGGGAGGACGTGCTCCAGGAGG + Intronic
1152918202 17:83052549-83052571 CCACCAGGAGGTCCTCCAGGAGG + Intergenic
1152918239 17:83052651-83052673 CCACCAGGAGGTCCCCCAGGAGG + Intergenic
1152918281 17:83052753-83052775 CCACCAGGAGGTCCCCCAGGAGG + Intergenic
1152918322 17:83052855-83052877 CCACCAGGAGGTCCCCCAGGAGG + Intergenic
1153937894 18:9947129-9947151 ACTCCAGCAGGTCCTTCAGGAGG - Intronic
1154191750 18:12236133-12236155 GTTCCAGGAGGTTCTGCAGGAGG + Intergenic
1156206102 18:34887541-34887563 AGGACAGGAAGTCCTCCATGTGG - Intronic
1157222768 18:45839162-45839184 GTGCCAGGGGGTCAGCCAGGTGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157501350 18:48193160-48193182 AGGCCAGCAGGGCCTCCAGCTGG + Intronic
1160403467 18:78628618-78628640 AGGCCAGGTGGTCTTCCTGGAGG - Intergenic
1160405048 18:78639651-78639673 ATACCAGGAGGTACTGCAGAGGG - Intergenic
1160469645 18:79117552-79117574 GTGGGAGGAGGTCATCCAGGAGG + Intronic
1160524399 18:79526487-79526509 ATGTCAGGAGGTGCTGCTGGCGG + Intronic
1160897183 19:1408276-1408298 AGGCCAGGAAGCCCTACAGGCGG - Intronic
1161242380 19:3229487-3229509 AGGCCAGGAGGGCCGCCTGGAGG + Intronic
1161361573 19:3852872-3852894 ATGCCAGGAGCTCCCCCAAGTGG - Intronic
1163442363 19:17328473-17328495 AAGCCCGGAGGCCCTCCTGGAGG - Exonic
1166801138 19:45457961-45457983 AAGCCAGGAGGACTTCCTGGTGG - Intronic
1167168255 19:47813876-47813898 GTGCCAGGACGGCCACCAGGGGG + Intronic
1202714333 1_KI270714v1_random:33910-33932 GTGCCAGGAGGGCCACCTGGAGG - Intergenic
925107150 2:1301324-1301346 ATGCCATGCTGTCCTCCAGGGGG + Intronic
925167610 2:1727752-1727774 CTGCCAGCAGGGCCTCCACGTGG + Intronic
925355947 2:3241260-3241282 ATGCCACGAGGTAATCCATGGGG + Intronic
926469078 2:13230514-13230536 ATGCCAGATGTACCTCCAGGTGG + Intergenic
928363502 2:30684369-30684391 ATGGCACGAGTTCCTTCAGGGGG - Intergenic
930206755 2:48594665-48594687 AGTCCTGGAGGACCTCCAGGAGG + Intronic
933290860 2:80436812-80436834 AGGCGAGGAGGTCCTGAAGGTGG - Intronic
934033798 2:88071605-88071627 CTTCCAGCAGGTCCTCCAGGGGG + Intronic
935068980 2:99676895-99676917 AGGCCAGGAGTCCCTCCACGAGG + Intronic
936269809 2:111041051-111041073 GGGCCTGGAGGGCCTCCAGGTGG + Intronic
937226375 2:120372217-120372239 AGGCCAGGAGGGCAGCCAGGAGG + Intergenic
942051600 2:172145995-172146017 ATGTCAGGAGTTCCGCCAGAAGG + Intergenic
948397842 2:237660928-237660950 ATGACAGTGGGTCCTGCAGGTGG - Intronic
948484717 2:238273015-238273037 ATGGCAGGAGTTCCTCCTGCAGG - Intronic
1168804903 20:666629-666651 ATACTGGGAGGTCCTCCAGGAGG + Intronic
1168928089 20:1599138-1599160 CTGCCAGGTTGTCCTCCCGGAGG + Intronic
1169558098 20:6770002-6770024 AAGCCAGGAGGGCATCCTGGAGG + Intronic
1169571622 20:6912718-6912740 AGACCAGGAAGTCCTCCTGGAGG + Intergenic
1171117438 20:22537139-22537161 ATTGCAGGAGGTCCTACTGGAGG - Intergenic
1171454530 20:25260106-25260128 CTGCTATGAGGTCCTGCAGGGGG - Intronic
1172013003 20:31857272-31857294 ATGCCAGGAGGTCCTCCAGGGGG + Intronic
1172240947 20:33412236-33412258 TTGCCAGGAGATGCTCCAGCAGG - Intronic
1172762152 20:37330491-37330513 AGGCTGGGATGTCCTCCAGGAGG - Intergenic
1172766861 20:37355685-37355707 ATGCCAGGAGAGCTTCCCGGAGG + Intronic
1173706640 20:45115041-45115063 CAGCCAGGAGGGCCCCCAGGAGG + Exonic
1173828101 20:46060177-46060199 ACTCCAGGGGGCCCTCCAGGAGG + Intergenic
1174406029 20:50304006-50304028 ATGCCTGGGGGCCATCCAGGAGG + Intergenic
1175312578 20:58021782-58021804 ATGCCAGCAAGCCCTCCACGTGG + Intergenic
1175374479 20:58514983-58515005 ATGGCAGGAGCTGCACCAGGGGG - Intronic
1175415848 20:58800518-58800540 ATGCCAGGACGGCTTGCAGGAGG + Intergenic
1176388488 21:6151483-6151505 ATCCCAGAAGGCCCTCCATGGGG + Intergenic
1178249086 21:30985016-30985038 CTGCCAGCAGGGCTTCCAGGAGG - Intergenic
1179555597 21:42173452-42173474 AGCCCAGGAGATCCTCCAAGGGG + Intergenic
1179734984 21:43386765-43386787 ATCCCAGAAGGCCCTCCATGGGG - Intergenic
1180068343 21:45423996-45424018 CTGCCAGCAGGTCCTGCAGACGG + Intronic
1180466660 22:15617314-15617336 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1180684562 22:17655261-17655283 AGGGCAGGTGGTCCTCCAGGAGG - Intronic
1180965824 22:19787494-19787516 ATGCCATGTGGTCCTGCAGGAGG + Exonic
1181774134 22:25147567-25147589 CAGCCAAGAGGACCTCCAGGAGG - Intronic
1183459395 22:37940860-37940882 AGCCCAGGAGCTGCTCCAGGAGG - Exonic
1183664261 22:39238297-39238319 ATCCCAGGTGGCCCTCCTGGTGG - Intronic
1183666088 22:39246670-39246692 CTCCCATGAGGTCCTCCATGTGG + Intergenic
1184257329 22:43294697-43294719 ATTCCAGGAGGACTTCCTGGAGG - Intronic
1184418278 22:44364491-44364513 AAGCCAGGAGGTCACCCTGGAGG + Intergenic
1184468618 22:44683351-44683373 CTGCCAGGTGGCCCTCAAGGTGG - Intronic
1184684399 22:46089609-46089631 CTGCCAGCAGCCCCTCCAGGTGG - Intronic
1184705884 22:46213124-46213146 CTGCCAGAATGTCCTCCAAGGGG + Intronic
1184899389 22:47434885-47434907 GAGCGAGGAGGTCCTCTAGGTGG - Intergenic
950045125 3:9944589-9944611 GTGGGAGGAGGTCCTACAGGTGG - Exonic
952890820 3:38039341-38039363 ATACAAGGAGGACTTCCAGGTGG - Exonic
957866846 3:86036560-86036582 AGTCCTGGAGGTCCTTCAGGTGG - Intronic
958481650 3:94651986-94652008 TTGCCAGGTGGTGCTCCAGGAGG - Intergenic
961357031 3:126345793-126345815 GTGGCAGGAGGGCCTGCAGGAGG + Intronic
966775737 3:183541323-183541345 AAGACAGGAGCTCCTCCAGCTGG + Intronic
967668771 3:192206853-192206875 CTTCCAGGGGGCCCTCCAGGAGG - Intronic
968831205 4:2933809-2933831 AGGCCAGGAGGTCCAGCAGGAGG + Exonic
969213256 4:5704171-5704193 ATGCAAGGAGGTCAGTCAGGCGG + Intronic
969299180 4:6287434-6287456 AAGCCAGGAGGTCATCCTGGAGG - Intronic
969565054 4:7972390-7972412 AATCTAGGAGGGCCTCCAGGAGG - Intronic
973737160 4:53883473-53883495 ATTACAGGAAGTCCTTCAGGCGG - Intronic
975634944 4:76438939-76438961 ATGCCAGGCAGACCTCCATGTGG + Intronic
983507133 4:168565617-168565639 AAGCCAGGAGGTCCTCCAGCAGG + Intronic
985047422 4:185953936-185953958 ATGCCTGGAGGACATCCCGGAGG + Intronic
985248891 4:188003264-188003286 ATGCCAGGTATTCCTCCAGGCGG - Exonic
985422809 4:189801519-189801541 CTGCCAGGAGGGCCTACATGTGG - Intergenic
985912939 5:2897284-2897306 AGGCCAGGAAGTCCTCCCCGAGG - Intergenic
986298500 5:6459485-6459507 AGGCCATGCAGTCCTCCAGGTGG - Intronic
986459607 5:7956822-7956844 ATCCCACGAGGCCCTCCACGCGG - Intergenic
990266642 5:54084083-54084105 AAACCAGGAAGTCTTCCAGGAGG + Intronic
993409677 5:87558431-87558453 AAGCAAGGAAGTCCTCCAAGAGG - Intergenic
993717111 5:91286164-91286186 ATGCCACAAGGTCCTGCAGAGGG - Intergenic
998039380 5:138942944-138942966 ATGTCAGCAGGACATCCAGGTGG - Intergenic
998474332 5:142407947-142407969 ATCCCAGCAGAGCCTCCAGGTGG + Intergenic
1001117898 5:168955056-168955078 AGGCCAGGAGTGCCTCTAGGTGG - Intronic
1005883812 6:30079679-30079701 ATTTCAGGAAGTCTTCCAGGAGG + Intergenic
1007336911 6:41160886-41160908 ATGATAGGAGGTCCTTAAGGAGG - Intronic
1007681943 6:43640116-43640138 GTGCAAAGAAGTCCTCCAGGTGG - Exonic
1007725926 6:43915577-43915599 ATGCCAGGAGGGCATCCTGATGG - Intergenic
1008632942 6:53381577-53381599 ATGCCTGGAGGAACTCCTGGGGG - Intergenic
1008829988 6:55747342-55747364 ATGGCATGATGTCTTCCAGGTGG + Intergenic
1014769004 6:125440012-125440034 ATGCCAGCAGGTCACACAGGTGG - Intergenic
1016570644 6:145508176-145508198 ATGACAAAAGGTCTTCCAGGTGG + Intronic
1018227033 6:161638539-161638561 ATGCCAGGAAGTCCTACAGCTGG + Intronic
1019493222 7:1324643-1324665 ATGCCAGGAGTTCTCCCTGGAGG + Intergenic
1020135787 7:5587145-5587167 AGTCCAGGAGGGCCTTCAGGAGG - Intergenic
1020907637 7:14084125-14084147 AAGCAAGCAGTTCCTCCAGGAGG - Intergenic
1021974816 7:26001583-26001605 ATACCAAGAGTTCCTCCAGTTGG - Intergenic
1022936666 7:35185883-35185905 GCGCCAGGAGGTCCTCCCCGGGG - Intergenic
1023183695 7:37511875-37511897 ATGCCAGGAGACCCCCCTGGAGG - Intergenic
1023670478 7:42571039-42571061 ATCCCAGGAGGCCCTGCAGTGGG - Intergenic
1025959188 7:66205475-66205497 AGGCCAGGATGCCGTCCAGGCGG + Exonic
1027623803 7:80524309-80524331 ATGCCAGGCCGCACTCCAGGTGG + Intronic
1027936164 7:84605530-84605552 ATTCCAGAAAGTCCTCCATGTGG + Intergenic
1029832900 7:103279994-103280016 GCGCCAGGAGGTCCTCCCCGGGG - Intergenic
1034269966 7:149798687-149798709 AGGACAGCAGGCCCTCCAGGAGG - Intergenic
1034426739 7:151018023-151018045 GGGACAGGAGCTCCTCCAGGAGG + Exonic
1034691295 7:153016125-153016147 AAGCCAGGAGATCCTCCAGAAGG - Intergenic
1034691528 7:153018023-153018045 AAGCCAGGAGATCCTCCAGAAGG - Intergenic
1035437112 7:158867532-158867554 GTGACAGGAGGCGCTCCAGGTGG + Intronic
1035472066 7:159116721-159116743 ATGCTGGGAATTCCTCCAGGTGG + Intronic
1037001896 8:13729729-13729751 AGGCCTGGAGGTCTTCCAAGTGG - Intergenic
1037819147 8:22127391-22127413 GTGCCAGGAGGGCCTGGAGGGGG - Exonic
1038390105 8:27189539-27189561 ATGCCAGGGGCTCCTCTAGTGGG - Intergenic
1040306060 8:46212423-46212445 ATGCCGGGAGCTTCTCAAGGAGG + Intergenic
1040544989 8:48392170-48392192 ATGCCAGCAGGTCTTCCCAGAGG + Intergenic
1042194471 8:66220767-66220789 AGGCAAGGAGATCCTGCAGGTGG + Intergenic
1042268778 8:66935350-66935372 ATGCCAGCAGATCCACCTGGTGG + Intergenic
1048893136 8:138965559-138965581 ATGGGAGGAGGTACCCCAGGAGG + Intergenic
1049423742 8:142528161-142528183 ATGCCACGAGGACCTGCACGAGG + Intronic
1049574149 8:143382717-143382739 TTGCCCGGAGGTCCTCTGGGTGG - Exonic
1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG + Exonic
1054882122 9:70155043-70155065 AAGCCAGGAAGACCTGCAGGTGG - Intronic
1056793102 9:89638919-89638941 ACGCTAGCAGGTCCTCCAAGAGG - Intergenic
1057127688 9:92632014-92632036 AGCCCAGGTGGACCTCCAGGGGG - Intronic
1060736135 9:126067533-126067555 ATCCCAGGAGGCCTTCCTGGAGG - Intergenic
1060889979 9:127181956-127181978 ATCCCTGGAGCTCCTCAAGGAGG + Intronic
1061116109 9:128613377-128613399 ATGCCAGCAGGGCCTCCACCTGG - Exonic
1061402212 9:130374587-130374609 TTGCCTGGAGGACCTGCAGGAGG - Intronic
1061671876 9:132193406-132193428 AAGTCAGGAGGGCCTCCTGGAGG + Intronic
1062433769 9:136537090-136537112 ATGCCAGGACTCCCTCTAGGGGG + Intronic
1185693662 X:2177788-2177810 AGGCCACGTGGTCCTTCAGGTGG + Intergenic
1186146595 X:6630703-6630725 ATGCCAGGTGGTCTTTCATGAGG - Intergenic
1186499354 X:10038854-10038876 ATGCCAGGGTGCCCTTCAGGTGG - Intronic
1187083116 X:16012025-16012047 ATGTCAGGAGAGCTTCCAGGTGG + Intergenic
1187244895 X:17545349-17545371 TTGGCAGGAGGTCCTCCACCTGG + Intronic
1191870812 X:65743311-65743333 ATTCCAGTATGTCCTCCTGGGGG + Intergenic
1198509897 X:137339956-137339978 ATGCCAGTAGGACATCCATGTGG + Intergenic
1201238221 Y:11931851-11931873 ATGCTAGGAGCTCCTGGAGGGGG + Intergenic
1201627761 Y:16033846-16033868 ATGCCAGGTGGTCTTTCATGAGG - Intergenic