ID: 1172014331

View in Genome Browser
Species Human (GRCh38)
Location 20:31863925-31863947
Sequence CACTGCTGCCGCCTTAATGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172014331_1172014336 18 Left 1172014331 20:31863925-31863947 CCCCCATTAAGGCGGCAGCAGTG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1172014336 20:31863966-31863988 TTTGAAGTGCTTTTTGCTAGAGG 0: 1
1: 0
2: 0
3: 19
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172014331 Original CRISPR CACTGCTGCCGCCTTAATGG GGG (reversed) Exonic
900348639 1:2224399-2224421 CACTGCTGGCTCCTTAAGGTGGG + Intergenic
900981766 1:6049867-6049889 CACAGCTGCCTCTTTCATGGGGG - Intronic
901192619 1:7421702-7421724 CACTGTTGCCACCTCATTGGTGG + Intronic
902067127 1:13697969-13697991 CCCTGCTGCCACCTTAATTTTGG + Intergenic
904183905 1:28687706-28687728 CACTGCTACTGCCTTAATTCAGG - Intronic
905708401 1:40080100-40080122 CACAGCTGCTGTCTTAATGAGGG - Intronic
906782943 1:48588907-48588929 CATTGCAGCCTCCTTAAGGGTGG - Intronic
906967269 1:50470410-50470432 CAATGCTGCCACTTTACTGGTGG - Intronic
911378613 1:97084058-97084080 CAATGCTGCCACCTTAATCTAGG + Intronic
912522431 1:110254840-110254862 CACTGCTGCAGCCTTCTTGTGGG - Intronic
912967523 1:114249268-114249290 CAATGCTGCAGTCTGAATGGCGG + Intergenic
921811229 1:219516684-219516706 CACTGCTGCTACCATAATTGAGG + Intergenic
1064063929 10:12164232-12164254 CTCTGCTGCCGCCTAACTTGGGG + Intronic
1065186249 10:23173519-23173541 AACAGCGGCCGCCTGAATGGCGG - Intergenic
1069627653 10:69878147-69878169 CTCTGCTGCGGCTTTCATGGGGG - Intronic
1070282962 10:75063153-75063175 AGCTGCTGCCCCCTTAATGGAGG - Intergenic
1077033794 11:483970-483992 CACTGGTGCAGCCTGCATGGAGG + Intronic
1077165155 11:1131449-1131471 CACCGCTGCCCCCTTACTGGGGG - Intergenic
1080661497 11:34299934-34299956 CACTGCTGCCTCCTTCATAAAGG + Intronic
1082873563 11:57965979-57966001 CACTGGGGCCTCCTTGATGGTGG - Intergenic
1083632824 11:64104521-64104543 CACTGCTACCACCTTTAGGGAGG - Intronic
1083952172 11:65962776-65962798 CACTGCTGCTGCCTTGGTGCAGG - Intronic
1084725209 11:70937365-70937387 CACTGCTGCCTGCCTGATGGAGG + Intronic
1086900461 11:92361576-92361598 CACTGCTGGCACCTTGATGTTGG + Intronic
1090000926 11:122957213-122957235 CACTGCTGCCACCTTACTCAAGG + Intronic
1092237652 12:6820112-6820134 CACTGCTGCCTCTTGAATGCAGG + Exonic
1092407244 12:8229607-8229629 CACTGCTTCCCCCTCAGTGGTGG - Intergenic
1093902336 12:24650311-24650333 CATTGCTGCTGCCTTAATTCAGG - Intergenic
1095897950 12:47299673-47299695 CACTGCTGCAGCATTGCTGGGGG + Intergenic
1100138477 12:91585877-91585899 AACTGCTGCAGCCTGAATGAAGG - Intergenic
1100454575 12:94740112-94740134 CACTGCTGTGGCCTTAATTCAGG - Intergenic
1100567066 12:95806662-95806684 ATCTGCTGCTGCCTTGATGGTGG + Intronic
1103791692 12:123476710-123476732 CCCTGCTGACGCCTTTATCGTGG + Intronic
1104209948 12:126679036-126679058 CACTGATGTAGCCTTCATGGTGG - Intergenic
1106462175 13:29980819-29980841 CACTGCTGCTGCTTTACAGGAGG - Intergenic
1107330481 13:39294903-39294925 CCCTGCTGCTGCCTTAATTTTGG - Intergenic
1108765887 13:53628990-53629012 CACTGCTGCCTCCTAGAGGGTGG - Intergenic
1108921993 13:55687487-55687509 CACTGCTGTCACCTTAATTTTGG - Intergenic
1111293488 13:86198927-86198949 CAGTGCTGCCACCTTAATCTCGG + Intergenic
1112369733 13:98784306-98784328 CCCTGCTGACGCCTTAATCTCGG - Intergenic
1114050293 14:18915808-18915830 CACTGCTGCGGCCCTCATGCTGG - Intergenic
1114112265 14:19486124-19486146 CACTGCTGCGGCCCTCATGCTGG + Intergenic
1118851086 14:69584052-69584074 CACTGCTGCTGCCTTAGTTCAGG - Intergenic
1120730644 14:87997193-87997215 CACTGGGGCCGACTTAAGGGTGG - Intergenic
1120755971 14:88244689-88244711 CACTTCTGCAGCCTGAATGCAGG - Intronic
1121475484 14:94197489-94197511 CACTGCTGCCATCTTCATAGGGG + Intronic
1121494371 14:94381761-94381783 CTCTGCTGTGGCCTTAGTGGGGG - Intronic
1121920527 14:97876709-97876731 CATAGCTGCTGCCTTGATGGAGG + Intergenic
1124103143 15:26713798-26713820 CACTTCTGCCTCCTTACTGCAGG + Intronic
1133537751 16:6718517-6718539 AAATGCTGCCTCCTTAAAGGTGG - Intronic
1135003049 16:18793389-18793411 AATTGCTGCCTCCTTAATGTTGG - Intronic
1139035327 16:62938978-62939000 TAATGCTGCCTCCTTAATGCTGG + Intergenic
1143282626 17:5766205-5766227 GAGTGCCGCCACCTTAATGGTGG - Intergenic
1145253428 17:21309324-21309346 GAATGCTCCCGGCTTAATGGAGG + Intronic
1145323151 17:21778610-21778632 GAATGCTCCCGGCTTAATGGAGG - Intergenic
1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG + Exonic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1151175047 17:72281206-72281228 CACTGCTGTTGCCTTAGTTGAGG + Intergenic
1158771722 18:60525883-60525905 CACTGCTGCAGCTTTAATAGTGG - Intergenic
1165662778 19:37596735-37596757 CACTGGTGCCACCTTAAAGAGGG - Intronic
1165850893 19:38849810-38849832 CACTGCCGCCGCCGTAGTAGCGG + Exonic
1167969969 19:53183190-53183212 CACTGCTGCAGCCTGTGTGGGGG - Intronic
927637573 2:24827379-24827401 CACTGCTGCAGCCCTCCTGGAGG + Intronic
928665497 2:33547240-33547262 CGCTGGTGCCTCCTTGATGGCGG + Intronic
930144867 2:47991683-47991705 CAGTGCTGCCTGGTTAATGGGGG + Intergenic
935609485 2:105006200-105006222 CCCTGCTGACACCTTGATGGTGG - Intergenic
936008484 2:108910068-108910090 TACTGCTGCCACCGTAATGCTGG - Intronic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
937436703 2:121887400-121887422 CAGTGCTGCACCCTTCATGGTGG - Intergenic
940131704 2:150389152-150389174 CACTGAAGCTGCCTTAATGTTGG + Intergenic
941728127 2:168886426-168886448 CACTGTTGTCTCCTTAGTGGTGG + Intronic
944911620 2:204315892-204315914 CACACCTGCTGCCTTGATGGTGG + Intergenic
947861944 2:233366704-233366726 CACTGCTGCTGCATGACTGGGGG - Intronic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1178760989 21:35402879-35402901 CCCTGCTGACACCTTGATGGTGG - Intronic
1181169041 22:20998088-20998110 CACTGCTGTGGCTTTAATGGAGG - Exonic
1184370712 22:44080321-44080343 CCCTGCTGCCACCTTGATGTTGG - Intronic
1185092635 22:48784631-48784653 CTCCGGTGCCGCCTTCATGGGGG - Intronic
950108013 3:10400553-10400575 CACTGCTGCAGCCTTAGTGCCGG + Intronic
950639981 3:14342512-14342534 CACTGCTGCCGCCTTTCTCCAGG - Intergenic
956761592 3:72448605-72448627 CACAGCTGCCTCCTTAGGGGAGG + Intergenic
962274203 3:134000021-134000043 CACTGCCACCGCCTGACTGGAGG - Intronic
968687224 4:1969310-1969332 CACTGCTGTCGGCTTGATGGAGG - Intronic
969150441 4:5164581-5164603 CCATGCTGCCACCTTAATGTGGG - Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
973698105 4:53510905-53510927 CTCTGCTGCCCCATCAATGGGGG + Intronic
976368221 4:84255190-84255212 CACTGCTGGTGCCTTAATCAAGG + Intergenic
981095448 4:140774814-140774836 CACTGCTGGCACCTTGATGTTGG - Intergenic
983911514 4:173244715-173244737 CACTGCTACTGCCTTAATTCAGG - Intronic
986620892 5:9673126-9673148 CACTGCGGCCTACTTAAGGGTGG + Intronic
987866852 5:23552803-23552825 CACTGCGGCCTACTTAAAGGTGG - Intergenic
990341493 5:54827486-54827508 CACTGCTGACACCTTGATGTTGG + Intergenic
990883475 5:60565894-60565916 CTCTCCTGCCACCTTAATGTAGG - Intergenic
992365174 5:76083450-76083472 CACTGCAGCCGCCTCAGTGCGGG - Exonic
992960388 5:81952701-81952723 CACTGCTCCTGCCTTATTGGAGG - Intergenic
993643461 5:90434302-90434324 CACTGCTGCCCCCTTTAGGTGGG + Intergenic
1002558518 5:180063264-180063286 CACGGCTGCCGCCTTAGTTCAGG - Intronic
1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG + Intronic
1012250808 6:96978300-96978322 CACTGGGGCCTACTTAATGGTGG - Intronic
1013664698 6:112335500-112335522 CACAGCAGCCTCCTAAATGGTGG - Intergenic
1016295130 6:142565672-142565694 CACAGTTGCCGCTTTAATGATGG + Intergenic
1016779798 6:147944784-147944806 CCCTGCTGACACCTTAATCGTGG - Intergenic
1017261154 6:152389361-152389383 CACTGGTGCCTCCTTGAGGGTGG - Intronic
1018725896 6:166613263-166613285 CACCCCAGCCGCCTGAATGGTGG - Intronic
1022864347 7:34401549-34401571 CACTGCTGCCTCCCAAAAGGGGG + Intergenic
1024947222 7:54820883-54820905 CACTGCGGCCTGCTTAAGGGTGG - Intergenic
1028469467 7:91189289-91189311 AACTGCTGACCCCTTAATTGTGG - Intronic
1030534775 7:110752588-110752610 CCCTGCTGCCGTAGTAATGGAGG - Intronic
1034923338 7:155101458-155101480 CTCTGCTGCAGACTGAATGGTGG - Intergenic
1035556811 8:573208-573230 CACGGCTGCATCCTTAATGTTGG - Intergenic
1036956447 8:13192866-13192888 CACTGCTGGCGCCTTGATCTTGG + Intronic
1038094920 8:24297693-24297715 CCCTGCTGCCTCCTTAATTCAGG - Intronic
1041567043 8:59290465-59290487 CCCTGCTGCCACCTTAATCTTGG - Intergenic
1042004701 8:64168514-64168536 CCCTGCTGCAGCCTGCATGGTGG - Intergenic
1059181480 9:112217129-112217151 CACTGCTGACACCTTGATCGTGG + Intergenic
1060266917 9:122117122-122117144 CATTGCTGCTGCCCTAAAGGTGG + Intergenic
1062264780 9:135681952-135681974 CTCTGCTGCAGCCTGCATGGGGG + Intergenic
1186493423 X:9992914-9992936 CCCTGCTGCCGCCTCAGCGGTGG + Intergenic
1188260049 X:28012370-28012392 CACTTCTTCCACCTTAATGGTGG - Intergenic