ID: 1172014336

View in Genome Browser
Species Human (GRCh38)
Location 20:31863966-31863988
Sequence TTTGAAGTGCTTTTTGCTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172014334_1172014336 16 Left 1172014334 20:31863927-31863949 CCCATTAAGGCGGCAGCAGTGGA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1172014336 20:31863966-31863988 TTTGAAGTGCTTTTTGCTAGAGG 0: 1
1: 0
2: 0
3: 19
4: 237
1172014331_1172014336 18 Left 1172014331 20:31863925-31863947 CCCCCATTAAGGCGGCAGCAGTG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1172014336 20:31863966-31863988 TTTGAAGTGCTTTTTGCTAGAGG 0: 1
1: 0
2: 0
3: 19
4: 237
1172014335_1172014336 15 Left 1172014335 20:31863928-31863950 CCATTAAGGCGGCAGCAGTGGAT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1172014336 20:31863966-31863988 TTTGAAGTGCTTTTTGCTAGAGG 0: 1
1: 0
2: 0
3: 19
4: 237
1172014332_1172014336 17 Left 1172014332 20:31863926-31863948 CCCCATTAAGGCGGCAGCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1172014336 20:31863966-31863988 TTTGAAGTGCTTTTTGCTAGAGG 0: 1
1: 0
2: 0
3: 19
4: 237
1172014330_1172014336 19 Left 1172014330 20:31863924-31863946 CCCCCCATTAAGGCGGCAGCAGT 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1172014336 20:31863966-31863988 TTTGAAGTGCTTTTTGCTAGAGG 0: 1
1: 0
2: 0
3: 19
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172014336 Original CRISPR TTTGAAGTGCTTTTTGCTAG AGG Exonic
902205082 1:14862477-14862499 TTTGGATTGATTTTTGCCAGTGG + Intronic
905048860 1:35031417-35031439 TTTGAAGAGCTTTTTGTTTTAGG - Intronic
908059944 1:60336825-60336847 TTTGAATTGGTTTCTGCTATTGG - Intergenic
908213495 1:61925917-61925939 TTTGAAGTGATCTTTTCTATAGG + Intronic
909464895 1:75962254-75962276 CTTGAAGTGCCTTTTTCTAAAGG + Intergenic
911584005 1:99669320-99669342 TTTGAAGTGCTTCTAAATAGTGG + Intronic
911723653 1:101218813-101218835 TTTGAACTGCTTTTTGAGTGTGG + Intergenic
913933185 1:125006156-125006178 TTTGAAGTGCATTTTGGAAAAGG + Intergenic
915238802 1:154504601-154504623 TTTGATTTGCATTTTCCTAGTGG + Intronic
918866964 1:189913878-189913900 TTTTAATTTTTTTTTGCTAGTGG + Intergenic
921521419 1:216159274-216159296 TATCAAGTGCTTTTTCCCAGAGG - Intronic
921960872 1:221033018-221033040 TTTGTTGTGCTTCTTGGTAGAGG + Intergenic
924159416 1:241215614-241215636 TTTGAAGTCCTATTTGCCTGAGG - Intronic
1063279201 10:4606930-4606952 TTTTAAAGGCTTTTTGCTAGGGG + Intergenic
1063426447 10:5953632-5953654 TTTGAATGGCTTTTTGGCAGAGG - Intronic
1064138806 10:12772888-12772910 TTTGAAGAGCTTGTATCTAGAGG + Intronic
1065644835 10:27823312-27823334 TTAGAATTGCATTTTGCTATTGG + Intronic
1066568444 10:36745722-36745744 TTTGATTTGCATTTTGCTAATGG - Intergenic
1068823543 10:61407334-61407356 TCTGAAGTGCTATTTGTTAGTGG + Exonic
1069322898 10:67195062-67195084 TTTTAAGTGATTTTGGTTAGTGG - Intronic
1069518917 10:69102078-69102100 CTTGAAATGCTTTTTTCTTGAGG + Intronic
1070774534 10:79102080-79102102 TGGGAAGAGCTTATTGCTAGGGG - Intronic
1071497234 10:86177143-86177165 TTGGAAGTGCTTGTTCCTGGAGG - Intronic
1073915061 10:108393214-108393236 TTTGAATTGCTTTTGGGTATGGG - Intergenic
1074537140 10:114336638-114336660 TTTGAAGTGCTTTTGATCAGAGG + Intronic
1075755568 10:124808831-124808853 TTTGAAATACTGTTGGCTAGCGG + Intronic
1076460188 10:130637944-130637966 TTTGTAGTTCTGTTTTCTAGTGG - Intergenic
1078468555 11:11568961-11568983 TTTGAAATGCATTTAGCTATGGG - Intronic
1078632404 11:13015058-13015080 TTTGATTTAATTTTTGCTAGAGG - Intergenic
1079191349 11:18279555-18279577 TATTAACTGCTTGTTGCTAGTGG - Exonic
1081473966 11:43406178-43406200 TTTGAAGTGCTCTGCGTTAGAGG - Intronic
1083566845 11:63726299-63726321 TTTTTACTGCTTTTAGCTAGAGG + Intronic
1087701572 11:101441562-101441584 TATGAAGTGCTTTTTCTTTGAGG - Intergenic
1089083310 11:115795836-115795858 TTTGAAGTTTTTGTTGCTTGCGG + Intergenic
1092054207 12:5495616-5495638 TTTGTTTTGCTTTTTGCAAGTGG + Intronic
1100374570 12:94002219-94002241 TTTGAAGTGCATTTTGGCAAAGG - Intergenic
1100930891 12:99608465-99608487 TTGTAAGTGGTTTTTGCTATAGG - Intronic
1102262794 12:111454942-111454964 GTTGATTTGCTTTTTGATAGTGG - Intronic
1102364383 12:112319307-112319329 TTTGCTGTGCTCTTGGCTAGAGG - Exonic
1104349555 12:128033158-128033180 TAAGAAGTGCTTTTTGCTTTTGG - Intergenic
1105334675 13:19455918-19455940 TTTGAAATGATGTTTGCTATAGG - Intronic
1105860238 13:24403407-24403429 TTTGAAATGATGTTTGCTATAGG + Intergenic
1106159313 13:27186246-27186268 TTTGATGTGCTTTTGGTTATAGG - Intergenic
1107685552 13:42894537-42894559 TTAAAAGTGCCTTTTGCTATAGG + Intronic
1107693872 13:42980776-42980798 TTTGAAGTGTTTATTTCTAAGGG + Intronic
1108656957 13:52542938-52542960 TTTGAAATGATGTTTGCTATAGG + Intergenic
1108958579 13:56190639-56190661 TTTGGTGTGTTTTTTGGTAGGGG - Intergenic
1108987092 13:56605375-56605397 TTTCATGTTCTATTTGCTAGGGG + Intergenic
1109293603 13:60503946-60503968 TTTATAATGCTTTTTGCTAAAGG + Intronic
1110515996 13:76412984-76413006 TTGGAAGTAATTTTTGTTAGTGG + Intergenic
1110581237 13:77130643-77130665 TTTGAAGTGCTATGTTTTAGGGG + Intronic
1110665533 13:78113505-78113527 TTTAAGGTGTTTTTTGCTGGTGG + Intergenic
1113003321 13:105669720-105669742 TTTATAGTGTTTTTTTCTAGAGG + Intergenic
1113310679 13:109129147-109129169 TTCAAAGTGCTTTTTATTAGTGG + Intronic
1113921128 13:113912363-113912385 TTTGAATTGCTTTTCCCTATGGG + Intergenic
1114324257 14:21573016-21573038 TTTGAGCTGATTTTTGCTAATGG - Intergenic
1115319085 14:32058926-32058948 TTTGAAATGCTTCTTGGTACAGG - Intergenic
1116271151 14:42768980-42769002 GTTTAAGTGATTTTAGCTAGTGG + Intergenic
1118896341 14:69948988-69949010 TGTGAAGTCCTTTTTGCAGGTGG - Intronic
1119208726 14:72813416-72813438 TTTGCAGATCCTTTTGCTAGAGG - Intronic
1119961201 14:78858781-78858803 TTTGAAGTGTTTGTTCCTGGTGG + Intronic
1120010553 14:79408594-79408616 TTTGAAGGAATTTTTACTAGTGG + Intronic
1120379436 14:83755641-83755663 TATGAAGTGCCTTTTGCTGCTGG - Intergenic
1121926728 14:97933774-97933796 TATGTAGTGCATCTTGCTAGGGG + Intronic
1124148298 15:27152147-27152169 TTTGAATTACTTTTTGATATAGG + Intronic
1128584580 15:68837032-68837054 TTTGAAGTATTTTTTGGTGGAGG - Intronic
1129141789 15:73605254-73605276 TTTGCAGTGCTTTTTTCTTTTGG - Intronic
1136009858 16:27356519-27356541 TCTGGGGTGCTTTTTGCAAGGGG + Intronic
1137766012 16:50978162-50978184 TATGCAGTGCTTTGTGCTAGTGG + Intergenic
1138488837 16:57364266-57364288 TCTGCAGTGCTCTATGCTAGAGG - Exonic
1138924264 16:61571565-61571587 ATGGAAGTGCTTTATGATAGTGG + Intergenic
1142384713 16:89756299-89756321 TATTAAGTGCTATTTGATAGTGG - Intronic
1144189320 17:12829567-12829589 TTGGAAGTTCTATTTGTTAGTGG + Intronic
1144380769 17:14695752-14695774 CTTCTAGTGCTTTTTGCTTGTGG - Intergenic
1145078332 17:19873708-19873730 TTTGAAGTGCTTCCAGATAGCGG - Intergenic
1145739902 17:27264723-27264745 TTTGATGGCCTTTTTGCTAGAGG - Intergenic
1145876389 17:28321361-28321383 TTTTAAGTGTATTTTGTTAGGGG - Intronic
1146101588 17:29987806-29987828 TTTGCAGTGCTTTGTGGTATGGG - Intronic
1148518897 17:48249689-48249711 TGTGAAGTGGTTTTTGCGGGGGG - Intronic
1149096398 17:52846334-52846356 TTTGCAGTTCCTCTTGCTAGAGG - Intergenic
1149385742 17:56141846-56141868 TTAGAAGTGCTTTTTGATTAAGG - Intronic
1153264174 18:3252713-3252735 TTTGAACTACTTTTGCCTAGTGG + Intronic
1153359923 18:4182660-4182682 TTTAAAGTGTCTTTTGCTATGGG + Intronic
1153603845 18:6810730-6810752 TATGAAGAGCTGTGTGCTAGAGG + Intronic
1156644120 18:39139418-39139440 TTTTAAGTGCTTTATGTTATGGG + Intergenic
1156877519 18:42032978-42033000 GTTGAAGTGCTTTGTGCTGCTGG - Intronic
1158473247 18:57757426-57757448 CTTGATGTGCTTGTTACTAGCGG + Intronic
1158764760 18:60436255-60436277 TTTGTTTTGCTTTTTGCTATTGG - Intergenic
1160367284 18:78337190-78337212 TTAGGGGTGCTTTTTGCTACTGG + Intergenic
1164293092 19:23885031-23885053 TTTGAATTGCTTTTTACTTAAGG + Intergenic
1167099456 19:47395240-47395262 TTTGAAGTTCTTGTAGCTGGAGG - Intergenic
926644881 2:15279386-15279408 TTTGAAGTGGTTGTTGATATGGG - Intronic
928598344 2:32878674-32878696 TTTGAAATGCTTTTTCCTACTGG - Intergenic
928794202 2:34996927-34996949 TTTCAAGTGCTTTTTGCCTGGGG + Intergenic
929255364 2:39805088-39805110 TTTGATGTGCATTTTTCTAATGG + Intergenic
930667539 2:54114767-54114789 TATGAAGTCTTTTATGCTAGTGG - Intronic
932452566 2:71823164-71823186 TTTGAGTTGATTTTTGCAAGTGG + Intergenic
932637387 2:73403190-73403212 TTTGAGTTGATTTTTGCTGGTGG + Intronic
933041648 2:77475317-77475339 TTTGAAGTGCTTTTCCCAAAAGG - Intronic
933405720 2:81856290-81856312 TTTGAAGTGCTTTTTGAATCTGG + Intergenic
936441516 2:112558039-112558061 TTTGAATACCTTTTTGCTACTGG + Exonic
936495256 2:113014914-113014936 TTTGGAGTGCTTCTTTCAAGAGG + Intergenic
937188257 2:120066965-120066987 ATTGAATTGTTTTTTGCTACTGG + Intronic
937214907 2:120306312-120306334 TTTGAAGTGCCTTTGGGGAGTGG + Intergenic
937344573 2:121116887-121116909 TTTGAAGTATTTTTTGATGGAGG - Intergenic
937874646 2:126813243-126813265 TTTGAATTGTTTATTGCTGGTGG + Intergenic
938972158 2:136442484-136442506 GTGGAATTGCTTTTTGTTAGAGG + Intergenic
940336955 2:152539288-152539310 TTTTGAGTGCTTTTTGCAAGAGG - Intronic
941658340 2:168168695-168168717 TTTAAAGTGCTTTTGGCTGGGGG + Intronic
942100306 2:172574715-172574737 TTTGGATTGCTTATTGCTAGTGG + Intronic
942941898 2:181628588-181628610 TTTGAACAGCTTTTTGGAAGAGG - Intronic
945347463 2:208735177-208735199 TTTCAGGAGCTTTTTGGTAGAGG + Intronic
946008427 2:216545144-216545166 TTTGAAGTTCTTGATGCCAGAGG + Intronic
946331654 2:219012990-219013012 TTTGAAGAACATTTTGCTAAAGG + Intronic
1170080867 20:12473385-12473407 TTAGATGTGCTTGTTGCTATCGG + Intergenic
1171326970 20:24303167-24303189 TATGAAGTGCTTGGTGCTTGAGG - Intergenic
1171496566 20:25560390-25560412 TTTTAGGTTCCTTTTGCTAGAGG - Intronic
1172014336 20:31863966-31863988 TTTGAAGTGCTTTTTGCTAGAGG + Exonic
1172172626 20:32949691-32949713 TTTGAATTGCTTTTTGTATGTGG - Intronic
1174730317 20:52909697-52909719 TGTGAAGACTTTTTTGCTAGAGG - Intergenic
1177022763 21:15883638-15883660 TTTGAAGGGCTTTTTTTTGGGGG + Intergenic
1177084050 21:16680101-16680123 TTTATATTGCTTTTTGCTCGAGG - Intergenic
1177105395 21:16948621-16948643 TTTAAGATGATTTTTGCTAGTGG - Intergenic
1177335847 21:19725826-19725848 TTTGAATTGTTTTTAGCTATTGG - Intergenic
1179606440 21:42518640-42518662 GTTGAATTGCTTTTTGGTGGTGG + Intronic
1180693628 22:17738295-17738317 TTTGAAGTGCTTCTTCATACTGG - Intronic
1180886323 22:19246785-19246807 TTTGAATTGCATTTTCCTAATGG + Intronic
1182856824 22:33524825-33524847 TTTGCAGTACTTTTTCCCAGTGG - Intronic
1184659644 22:45959989-45960011 TCTGATGAGCTTTTTGATAGAGG - Intronic
949749212 3:7331581-7331603 TTTCAGGTGCTTTTGGCTATAGG - Intronic
950970705 3:17184230-17184252 TTTGAAGTTCATTTTGCATGTGG - Intronic
952201625 3:31134815-31134837 TTTGCAGTGCTTCTTGCTGTAGG - Intergenic
953142664 3:40244203-40244225 TTTGAAATGCTTTTTCTTACAGG + Intronic
956138478 3:66121939-66121961 TTTAAAGTGTTTTTATCTAGTGG - Intergenic
957680124 3:83423210-83423232 TATGACCTGCTTTTAGCTAGAGG + Intergenic
958153009 3:89715829-89715851 TTTGACTTGCTTTTTCCTAATGG + Intergenic
958421060 3:93932072-93932094 TTTGAAGTGCTTTCAGCAATTGG + Intronic
958575492 3:95945240-95945262 TTTGAATTGATTTTTGTAAGTGG + Intergenic
963443233 3:145367844-145367866 TTTCAAGTGCTTTTATCTATTGG + Intergenic
964490041 3:157226561-157226583 TTTGAAGTGCTTCCTACTATGGG + Intergenic
965245016 3:166257214-166257236 TTTTAAATGCTTTATGCTACAGG - Intergenic
965531454 3:169774012-169774034 TTTGCTGTGCTTTTTGCAGGTGG + Intronic
965942976 3:174208017-174208039 ATTGATTTGCTTTTTGCTAAAGG - Intronic
966650146 3:182291442-182291464 TTTGCTCTGCTTTTTGCTAATGG - Intergenic
966813152 3:183866333-183866355 TATGAAGTGCTTTTAGTTAATGG - Intronic
967071324 3:185964887-185964909 TTGCAAGTGCTTTATTCTAGAGG - Intergenic
969275489 4:6132754-6132776 TTTAAAGTGATTATTGATAGAGG - Intronic
972531377 4:39964272-39964294 TTAGAAGTACTCTGTGCTAGAGG + Intronic
972863753 4:43204679-43204701 TTGGAAGTGATTTTTGCATGAGG + Intergenic
973658942 4:53082426-53082448 TTTGATTTGCATTTCGCTAGTGG + Intronic
974315349 4:60272000-60272022 TTTGAAGTGCTTTTTGTTTTAGG + Intergenic
976066086 4:81189225-81189247 TTTTAAATGCTTTATGCTACAGG - Intronic
978530799 4:109711287-109711309 TTAGATGTGCTTGTTGCTACTGG - Exonic
979644171 4:123048020-123048042 TTTGAATTGATTTTTGTTTGTGG + Intronic
980066883 4:128199425-128199447 TTTGAAGTGCTGTTTGAGAAAGG - Exonic
981838858 4:149087838-149087860 TTTGAACTGCATTTTGTTATGGG + Intergenic
982415860 4:155131083-155131105 TTAGAAGTTCTTTTGTCTAGTGG - Intergenic
983324850 4:166240672-166240694 TATGAAGGGCATTTTGATAGAGG + Intergenic
984282592 4:177689990-177690012 GTTCAAGTACTTTTTGATAGCGG + Intergenic
984684636 4:182652680-182652702 TCTGAAGGGCTTTTTGACAGTGG + Intronic
985124401 4:186678203-186678225 TTTGAATTTGTTTTTTCTAGTGG - Intronic
986009775 5:3701521-3701543 TCTGAAGTGTTTTTTCCTGGGGG + Intergenic
986619949 5:9661939-9661961 TTTGGAGTGGATTTGGCTAGAGG + Intronic
986697629 5:10372857-10372879 TTTGCAGTGGTATTTTCTAGAGG - Intronic
986850392 5:11805363-11805385 GTAGATGTGCTTGTTGCTAGTGG - Intronic
987044282 5:14091788-14091810 TTGGAAGTGCTCTTTAATAGAGG - Intergenic
988104984 5:26733202-26733224 TTTGGAGTTATTTTTGCTAGTGG + Intergenic
989425813 5:41294297-41294319 TTTGAAGTGCTTTTTTCACTGGG + Intergenic
990469333 5:56099283-56099305 TTTGGATTGATTTGTGCTAGGGG - Intergenic
990755804 5:59068327-59068349 TTTTAAGTATTTTTTGTTAGGGG + Intronic
991041885 5:62184779-62184801 TTTGTAGTGCTTTTTTTTGGTGG - Intergenic
991995665 5:72384127-72384149 TTTGAAGTTCTTTTTGGTATGGG - Intergenic
993606027 5:89991531-89991553 TGTGAAGTGTGTTTTGCTGGGGG + Intergenic
994217023 5:97149335-97149357 TTTGGAGTGGATTTTGCTAGTGG + Intronic
994786415 5:104170349-104170371 TTTGCATTGCCTTTTTCTAGAGG - Intergenic
995068719 5:107892811-107892833 TTTGCAATGATTTTTGCTATGGG + Intronic
995069560 5:107903876-107903898 TCTCAAGTGCTTTTTTCTTGAGG + Intronic
995184210 5:109254558-109254580 TCTAAAGTGATTTTTGCTGGAGG - Intergenic
995897059 5:117026785-117026807 TATTAAGACCTTTTTGCTAGTGG - Intergenic
996595062 5:125191305-125191327 ATAGAATTCCTTTTTGCTAGTGG + Intergenic
999000464 5:147916175-147916197 TTTGATGTGCTTTTCCCTAATGG + Intergenic
999076459 5:148800455-148800477 TTTGAAGTGCTTTGTGTGGGGGG - Intergenic
999579921 5:153026712-153026734 TTTGAATTGATTTTTGCGTGTGG - Intergenic
1000193201 5:158933239-158933261 TTGAAATTGCTTTTTGCTAAAGG + Intronic
1000473006 5:161669879-161669901 ATTGAAGTGTTTTTTGTTAAAGG - Intronic
1001284103 5:170409984-170410006 TTTTAAGTGTGTTTTGCTAAAGG + Intronic
1003704058 6:8504296-8504318 TTTGAACTGGTTTTTACTTGTGG + Intergenic
1004303296 6:14477638-14477660 GTTGAAGAGCTTTATGCTATTGG - Intergenic
1005818476 6:29576997-29577019 TGGGAAGTGCTTTTTGTTGGTGG - Intronic
1010635272 6:78251599-78251621 TTTGAAGTCATTCTTGCTGGAGG - Intergenic
1010859309 6:80886999-80887021 TTTGAAGTGATTTTTGAGAATGG - Intergenic
1011453107 6:87516689-87516711 TTTGATGTGCTTTTAGTTACAGG - Intronic
1013355527 6:109342867-109342889 TCTGAGGATCTTTTTGCTAGAGG + Intergenic
1014037249 6:116781171-116781193 TTTTTTGTGCTTTTTGGTAGAGG + Intergenic
1014315390 6:119857979-119858001 TTTAAAGTACTTATTTCTAGTGG + Intergenic
1014709870 6:124794295-124794317 TATCAAGTGCTTTTTTCTGGAGG - Intronic
1015898717 6:138042281-138042303 TTTGATTTGCATTTTCCTAGTGG + Intergenic
1016481126 6:144483354-144483376 TTTGGTCTGCTTTTTGCTTGTGG + Intronic
1017194348 6:151684101-151684123 TCAGTAGTGCTTGTTGCTAGAGG + Intronic
1021427532 7:20519516-20519538 TTTGAAGTGCATTTTGGCAGAGG - Intergenic
1021685276 7:23179607-23179629 TTTAATGTGCTTATTGCTACTGG - Intergenic
1021825761 7:24549406-24549428 TTAGCAGTGCTTTTTTATAGTGG + Intergenic
1022376108 7:29812980-29813002 TTTGAGGTGCTTTTGGCAAATGG - Intronic
1024572680 7:50736871-50736893 TTTGAGTTGCTTTTTGCTTATGG - Intronic
1024622918 7:51178204-51178226 TTTTATGTGGTTTTTGCTAAAGG + Intronic
1024796313 7:53025847-53025869 TTTGATTTGCATTTTGCTAATGG - Intergenic
1026636580 7:72087993-72088015 TTTCAATTTCTTTTTGGTAGAGG - Intronic
1027131908 7:75597242-75597264 TATGAACTGCTGTTTGCTAGAGG - Intronic
1027709970 7:81587932-81587954 TTTGATGTGCTGTATGTTAGAGG - Intergenic
1029240069 7:99154014-99154036 TTTAAAGTGTTTTTTGGGAGGGG - Intergenic
1030683772 7:112461343-112461365 TTTTAAAGGCTTTTTGATAGAGG + Intronic
1031122069 7:117733244-117733266 CTTGAAGTGCTTATTGGTATAGG + Intronic
1031251339 7:119386509-119386531 TTTGAAGTGCTATTTCATTGTGG + Intergenic
1032184653 7:129713935-129713957 TTTGAAGGGCCTTGTGGTAGTGG + Intronic
1032430798 7:131859838-131859860 TTTCAATTGCTTTTAGCCAGCGG + Intergenic
1039849292 8:41348409-41348431 TGGGGAATGCTTTTTGCTAGAGG + Intergenic
1039987826 8:42462795-42462817 TTTGCAGTGCTTGTTTCTGGGGG + Intronic
1040685439 8:49866574-49866596 TTTGAAGTTCTTCTCACTAGAGG + Intergenic
1040846651 8:51849994-51850016 TGTGAAGTACTTTTTGCCTGTGG - Intronic
1041245303 8:55883442-55883464 TTAGCACTGCTTTTTGCTTGGGG + Intronic
1041559465 8:59198690-59198712 CTAGATGTGCTTGTTGCTAGTGG - Intergenic
1041787453 8:61650287-61650309 TTTAAACTGTTTTTTGCCAGTGG - Intronic
1042074989 8:64983548-64983570 TTTGAAGTGCTGTGTGCCAGTGG + Intergenic
1043385759 8:79746341-79746363 TCAGAAGTGCTTTTTGAAAGCGG - Intergenic
1043389155 8:79775006-79775028 TTTCAAGTTTTTTTTTCTAGTGG - Intergenic
1045704074 8:104899764-104899786 TGTGAAGTGCTTTATCCTATGGG + Intronic
1048308484 8:133300002-133300024 TTAGAAGGGCATTTTGCCAGGGG + Intronic
1049066200 8:140317523-140317545 CTAGAAGTGCTCTTTGCTACTGG + Intronic
1049334819 8:142078303-142078325 TCTGAGGTGCATTTTGCCAGGGG + Intergenic
1051207746 9:14706677-14706699 AGTGAAGTGATTTTTTCTAGTGG - Intergenic
1051651601 9:19331855-19331877 TTTGAAGTGCTTGATTTTAGGGG + Intronic
1051671380 9:19514106-19514128 TTTGAAGTGCTTTTTACTTCTGG + Exonic
1052671228 9:31560090-31560112 TTTGAACCTCTCTTTGCTAGAGG - Intergenic
1052869862 9:33493938-33493960 TTTGAAGGTCTTTTTGCTAAAGG - Intergenic
1056506228 9:87260623-87260645 TATGAATTGCTTTTAGCTAAAGG - Intergenic
1059061926 9:111042028-111042050 TTTCAAAAGCTTTTTGCCAGAGG - Intergenic
1059540697 9:115127412-115127434 TTTGAAGTATATTTTGCCAGTGG + Intergenic
1059635422 9:116165646-116165668 ATTGAAGAGCTTTCAGCTAGAGG - Intronic
1060391339 9:123279800-123279822 GGTGAAGTCCTTCTTGCTAGTGG - Intergenic
1060566510 9:124597406-124597428 GTTGAGTAGCTTTTTGCTAGTGG - Intronic
1060688623 9:125636052-125636074 TTTGAAGTGCCTTCTCCTAAAGG + Intronic
1061957004 9:133969007-133969029 TTTTAAGTGGTTTTTGCCTGTGG - Intronic
1187719528 X:22136753-22136775 TTTGTTGTACTCTTTGCTAGGGG + Intronic
1187980541 X:24752318-24752340 TTTGAATTGCTTTGTGGTAGAGG + Intronic
1188245841 X:27835011-27835033 TTTGTTGTGCTATATGCTAGTGG + Intergenic
1188566253 X:31529779-31529801 TTTGAAGGGCATTTTGTTATTGG - Intronic
1188682091 X:33022240-33022262 TTTGAAGTGATTTAATCTAGAGG + Intronic
1189426791 X:40909030-40909052 TTTGAAGTCCTTTATGTTTGAGG - Intergenic
1189470407 X:41309493-41309515 TTTGGAATGCATTTTCCTAGAGG + Intergenic
1193176276 X:78398673-78398695 TTTGAATTGCTTTTTGTATGTGG - Intergenic
1193314295 X:80046164-80046186 TTTGCAGTGTTTTGTGGTAGTGG + Intergenic
1193961774 X:87935014-87935036 CTTTGAGTGCTTTTTTCTAGTGG + Intergenic
1197892952 X:131283988-131284010 GTTCATGAGCTTTTTGCTAGCGG - Intronic
1199107862 X:143892905-143892927 TGTGAAGTTCTTTCTGCTCGAGG + Intergenic
1201851593 Y:18488894-18488916 TTTAAAGTGTTTGTTGTTAGAGG + Intergenic
1201881727 Y:18831486-18831508 TTTAAAGTGTTTGTTGTTAGAGG - Intergenic
1202597130 Y:26552198-26552220 TTTGAAATGATGTTTGCTATAGG + Intergenic