ID: 1172015827

View in Genome Browser
Species Human (GRCh38)
Location 20:31872190-31872212
Sequence GGAGAACCTCTCTGAATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172015823_1172015827 10 Left 1172015823 20:31872157-31872179 CCCAGTTTTCTATGAAGGAAACA 0: 1
1: 0
2: 0
3: 32
4: 438
Right 1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG 0: 1
1: 0
2: 0
3: 17
4: 127
1172015824_1172015827 9 Left 1172015824 20:31872158-31872180 CCAGTTTTCTATGAAGGAAACAA 0: 1
1: 0
2: 2
3: 55
4: 592
Right 1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG 0: 1
1: 0
2: 0
3: 17
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172015827 Original CRISPR GGAGAACCTCTCTGAATAAG TGG Intronic
903436584 1:23354517-23354539 GGAAAACCTCTCTAAAGAGGTGG - Intergenic
906843059 1:49160725-49160747 GCAGGACATCTCTGAAAAAGAGG - Intronic
907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG + Intergenic
910683355 1:89890362-89890384 TGAGAACATCCCTGAATTAGTGG - Intronic
914699212 1:150115770-150115792 AGAGACCCTCACTGAAAAAGTGG - Intronic
914717412 1:150264215-150264237 TGAGAACCTGTCTCAAAAAGCGG - Intronic
917240190 1:172939717-172939739 AGAGCAGCTCTCTGAAGAAGGGG + Intergenic
917949897 1:180020744-180020766 GGGGAGTCTCTCTGAAGAAGAGG + Exonic
919658857 1:200223553-200223575 GGACAGCCTCTCTGAAAAAGTGG + Intergenic
921785186 1:219221293-219221315 GGGGAACCTCTATGAATCAGGGG + Intergenic
923754400 1:236777502-236777524 GAAGAAAATCCCTGAATAAGTGG - Intergenic
924690475 1:246345150-246345172 GGAGAAACTCTTTGGATATGGGG - Intronic
1063740287 10:8810233-8810255 GGAGAACATCTCTTAATACGTGG + Intergenic
1064240638 10:13624847-13624869 GGAAAAACTCCCTGAATAGGTGG - Intronic
1066749855 10:38643518-38643540 GGAGAATCTCCTTGAATAACAGG + Intergenic
1066966787 10:42274202-42274224 GGAGAATCTCCTTGAATAACAGG - Intergenic
1067236351 10:44453877-44453899 GCAGAACATCTCTGAAAAAAAGG - Intergenic
1067692327 10:48509717-48509739 GGAGAGGCTCTCTGAATAAAGGG + Intronic
1071786515 10:88906615-88906637 GGAGACCCTGTCTCAATAAAAGG - Intronic
1072048540 10:91681180-91681202 GGAGAAATTCTCTAAAGAAGTGG - Intergenic
1073888516 10:108069477-108069499 GGAGAACCTATCTGAGAATGAGG + Intergenic
1074052175 10:109889949-109889971 GGAGAAACTGTATTAATAAGTGG - Intronic
1075151691 10:119938465-119938487 GGAGAACCCCTCACAAAAAGTGG - Intronic
1078779509 11:14423570-14423592 GGAGGAACTCACTGAAGAAGGGG + Intergenic
1082086141 11:48051515-48051537 GGAAAACCTCTCTGAACACCAGG - Intronic
1083297924 11:61725252-61725274 GAGGAACCTCTGTGAATAACTGG + Intronic
1084507777 11:69579877-69579899 GGAGTAGCTCCCTGAATGAGTGG + Intergenic
1087213828 11:95472776-95472798 GGAGAACATCTCTGAACTTGGGG - Intergenic
1089084320 11:115803905-115803927 AGAGAACCTCTGGGAACAAGAGG - Intergenic
1090556843 11:127885358-127885380 GCAGACCCTCTCTGTATAGGGGG + Intergenic
1091223054 11:133941892-133941914 GGAGAACTTCTCTGAAGAAATGG - Intronic
1096420813 12:51455774-51455796 GGGGTACCTCCCTGAAAAAGAGG - Intronic
1097038990 12:56143100-56143122 GGAGGACCTCACAGAAGAAGAGG + Exonic
1099033312 12:77555769-77555791 TGAGAACATCTCTTAACAAGGGG + Intergenic
1103854409 12:123955884-123955906 GGATAACGTCTCTTTATAAGTGG - Intronic
1105898873 13:24740405-24740427 GGAGATCCTCTCTGGAGAACAGG - Intergenic
1106564234 13:30871298-30871320 GGGGAACATCTCTGAATCAGAGG + Intergenic
1107730247 13:43341353-43341375 GAAAAACCTCTCTGAAGAGGTGG + Intronic
1109625151 13:64964254-64964276 GGAAAACCTATCAGAATAACAGG + Intergenic
1112094461 13:96116844-96116866 CCTGAGCCTCTCTGAATAAGTGG - Intronic
1115796029 14:36936551-36936573 CCAGAACCTCTCAGAATAAATGG + Intronic
1116976159 14:51118353-51118375 GGAGGACACCTCAGAATAAGGGG + Intergenic
1119348654 14:73946356-73946378 TGAAAACCTCTCTGAAGATGAGG - Exonic
1120702765 14:87715923-87715945 CAAGCACCTCTCTGAATGAGAGG - Intergenic
1121583822 14:95049314-95049336 GGAGGAACTCTCTGACTAAGGGG - Intergenic
1124061179 15:26294866-26294888 GGAGAACTACTTGGAATAAGTGG - Intergenic
1124533217 15:30523728-30523750 GGAGAACCTCTGTCAAAAAGAGG - Intergenic
1124765440 15:32483916-32483938 GGAGAACCTCTGTCAAAAAGAGG + Intergenic
1125027676 15:35046899-35046921 AGAGAACCTCTCTTCATAAGTGG - Intergenic
1125257873 15:37787728-37787750 AGAGAAGTTCTCTGAAAAAGGGG - Intergenic
1128078699 15:64843488-64843510 GGAGAACTTCCCTTAATCAGGGG - Intronic
1142685858 17:1576589-1576611 GGAGACCCTCTGTGGGTAAGAGG - Exonic
1145125806 17:20299151-20299173 GGCTAACCTCACTGAAGAAGAGG - Intronic
1152402967 17:80080241-80080263 GCAGAACATCTCAGAATAATAGG + Intronic
1153927320 18:9845570-9845592 GGGGAACCTCCCTGGAAAAGAGG - Exonic
1156078827 18:33311605-33311627 AGTGACCCTCTCTGAAGAAGCGG - Intronic
1157954315 18:52079453-52079475 AGAGAACCTCTGTGAGAAAGAGG - Intergenic
1161097603 19:2401933-2401955 ATAGAAGCTCACTGAATAAGCGG - Intronic
1166220316 19:41360062-41360084 GGAGAACCCCTCTGTGGAAGTGG - Intronic
925689948 2:6511533-6511555 TGAGACCCTGTCTGAAAAAGGGG - Intergenic
926665191 2:15513977-15513999 TGAGAACCTGTCTAAAAAAGAGG + Intronic
926666207 2:15526278-15526300 GGATAAGCTCTATGAATATGTGG - Intronic
926848884 2:17172802-17172824 GCAGAACCTCACTATATAAGTGG + Intergenic
927912694 2:26912564-26912586 GGAGAGCCGCTCTGAAACAGAGG - Intronic
930345190 2:50171177-50171199 GAAGAAACTCTATGTATAAGTGG + Intronic
934312850 2:91885694-91885716 GGAGAATCTCCTTGAATAACAGG + Intergenic
937880360 2:126859797-126859819 GGTTAACCTCTCTGAATAACAGG + Intergenic
940428847 2:153563735-153563757 GGAAAACTTCTATGAATAAATGG - Intergenic
944937064 2:204580318-204580340 GGAGACTCACTCTGGATAAGAGG - Intronic
946311064 2:218882947-218882969 GAAAACCCTCTCTGAATCAGAGG + Intronic
947760155 2:232598436-232598458 GCAGACTCTCCCTGAATAAGAGG - Intergenic
947925484 2:233918487-233918509 TGAGACCCTCTTAGAATAAGAGG - Intronic
948817082 2:240517247-240517269 TGAGAACCTCTTAGAATAACTGG + Intronic
1169105484 20:2990771-2990793 GGATAACCTCACAGAATAGGAGG + Intronic
1171468542 20:25351039-25351061 AGAGTAGCTCTCTGAAGAAGAGG - Intronic
1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG + Intronic
1174079528 20:47961060-47961082 GGACAGCCTCTCTGAAGAGGTGG - Intergenic
1174147602 20:48463081-48463103 GGAGGATCTCTCTGAAGAGGTGG - Intergenic
1174454087 20:50637399-50637421 GGAGGACCTCTCTGAGGAGGTGG - Intronic
1174472752 20:50772585-50772607 GGAGGACCTCTGTGAGGAAGTGG + Intergenic
1175936428 20:62516284-62516306 GGAGAAGCTCTCGGTTTAAGCGG - Intergenic
1177366714 21:20149160-20149182 GGAGAAAATCTGTGTATAAGTGG + Intergenic
1185207532 22:49548720-49548742 GGAGCTCCTCTCTGAATCTGGGG + Intronic
951860988 3:27252282-27252304 GGAAATCCTCTCTACATAAGTGG + Intronic
953083929 3:39648251-39648273 GGAGAATCTCTCTGAACTAAGGG + Intergenic
955129867 3:56155426-56155448 TGAGAACCTATCTGAATGATTGG + Intronic
955650219 3:61186275-61186297 GGAGAGACTCTCTGGGTAAGTGG - Intronic
956271212 3:67449161-67449183 GGCAAACCACTCTGATTAAGTGG + Intronic
956804017 3:72789862-72789884 GGAAAATCTCTCTGAAGAAAGGG + Intronic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
958779694 3:98525408-98525430 GGAACACCTCTCTGTATAAATGG - Intronic
966789263 3:183650542-183650564 TGATAACATCTGTGAATAAGCGG - Exonic
968933222 4:3595360-3595382 GGAGGACATCTCTGAATGAAGGG - Intergenic
970521636 4:16890439-16890461 GGCAGACCTCTCTGAAGAAGAGG - Intronic
973740392 4:53914137-53914159 GAAGAAACTCTCTAAAAAAGAGG - Intronic
973871950 4:55175644-55175666 GAAGAACCTCTCTGGATACCTGG + Intergenic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974943852 4:68503404-68503426 GCAGAACATCTCTGAAAAAAAGG + Intergenic
976056676 4:81077428-81077450 TGAGAACGGCTTTGAATAAGTGG - Intergenic
976831219 4:89316909-89316931 GGAAATCCTCTCTGAAGAGGCGG + Intergenic
977945057 4:102903731-102903753 GGAGAATATCCTTGAATAAGAGG + Intronic
980031806 4:127840320-127840342 GTAGTACCTCTCTTAAAAAGAGG - Exonic
980241351 4:130180749-130180771 GGTGAGCCTCTCTTAATAAATGG + Intergenic
982837379 4:160137288-160137310 GGAGAAAATCTGTGTATAAGTGG + Intergenic
984049012 4:174841035-174841057 GCACAAACTCTCTAAATAAGTGG + Intronic
993990013 5:94644708-94644730 GGTGAACCTCACTGAGTAAGGGG - Intronic
997078304 5:130707625-130707647 GCAGAACATCTGTGAGTAAGGGG + Intergenic
997374736 5:133389630-133389652 GCAGAACCTTTCTGGATAGGTGG - Intronic
999274271 5:150318659-150318681 GGGCAACCTCTCTGAAGAGGTGG + Intronic
1003221974 6:4168938-4168960 TGTTAACCACTCTGAATAAGGGG + Intergenic
1003605604 6:7557738-7557760 GGAAAAACTCTGTGCATAAGAGG + Intronic
1006248068 6:32757704-32757726 ACAGAACCTCTCTGAATAGAGGG + Intronic
1008010307 6:46460067-46460089 CAAGACCCTCTCTGAAAAAGTGG - Intronic
1008700730 6:54096479-54096501 GGAGAGCCTCTCTGCAGATGAGG - Intronic
1013085819 6:106856702-106856724 GGAAAACCTCTCTGAGGAGGTGG + Intergenic
1014687051 6:124514632-124514654 GGAGAACCCTTCTGAATCTGGGG - Intronic
1016262215 6:142186100-142186122 GGAAAACCTTTCTGAGGAAGTGG + Intronic
1020488932 7:8755043-8755065 AGAGAATTTCTCTGAATGAGTGG + Intergenic
1024563312 7:50662253-50662275 GGAAGACCTCTCTGAAAAGGAGG - Intronic
1027813254 7:82932986-82933008 GGAGAACTTGTCAGAATAAAGGG - Intronic
1030068737 7:105680413-105680435 GAAGAAACTCTCTCAACAAGAGG - Intronic
1031850552 7:126857935-126857957 TGAGAACCTGTCTAAAGAAGGGG + Intronic
1032884639 7:136124471-136124493 GGAAAAGATCTCTGTATAAGAGG + Intergenic
1033022935 7:137745363-137745385 GGAAAACATGTCTGAATAAGGGG - Intronic
1034943354 7:155246433-155246455 GGAGACCCTCACTGAGTAAATGG + Intergenic
1039274983 8:35925348-35925370 GGAGAACCTCTGTGAATTGAGGG - Intergenic
1041603137 8:59745953-59745975 GGAAAACCTCTGTGAATCAAAGG - Intergenic
1045206818 8:100051073-100051095 GAATAGCCTCTCTGATTAAGTGG + Intronic
1047046730 8:121061961-121061983 GGAGATCCTGTGTGATTAAGTGG - Intergenic
1047199581 8:122753848-122753870 GAAGGAGCTCTCTGAAAAAGGGG - Intergenic
1050085532 9:1961007-1961029 AGAAAACCTCTCTGAAAAAGAGG - Intergenic
1050726787 9:8659125-8659147 GCAGAACATTTCTGAATGAGAGG + Intronic
1050825644 9:9941735-9941757 GTAGAACAACTCTGAAGAAGAGG + Intronic
1051397458 9:16640257-16640279 TGAGACCCTCTCTGAATATTTGG - Intronic
1056464680 9:86842196-86842218 GGAGAACATCTATGTATAAGTGG - Intergenic
1057850476 9:98563243-98563265 GGAGAACCTCTGTGAATCTTTGG - Intronic
1058442611 9:105023901-105023923 GGAGAAACTGTCTGCAGAAGAGG - Intergenic
1058628889 9:106965445-106965467 GGAGGACCTCAATGAACAAGGGG + Intronic
1185996870 X:4961249-4961271 AAAAAACATCTCTGAATAAGGGG + Intergenic
1186288873 X:8074763-8074785 GAAGAAACTCTGTGTATAAGTGG - Intergenic
1186636511 X:11411007-11411029 GTAGAACCTCTTTAAACAAGGGG + Intronic
1187299379 X:18032985-18033007 GGAGAACCTCTCAGAGGATGTGG - Intergenic
1190277924 X:48911209-48911231 GGAGTTCCTCACTGAAGAAGGGG - Intronic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1199599581 X:149534034-149534056 GGAGAAGGTCTCTGAATATCTGG + Intergenic