ID: 1172017332

View in Genome Browser
Species Human (GRCh38)
Location 20:31885470-31885492
Sequence CTGGATAAACATATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 1, 3: 54, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172017330_1172017332 -5 Left 1172017330 20:31885452-31885474 CCAAAGGCTCTGGAGCAACTGGA 0: 1
1: 0
2: 1
3: 64
4: 953
Right 1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG 0: 1
1: 1
2: 1
3: 54
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172017332 Original CRISPR CTGGATAAACATATGGAAAA TGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900900154 1:5510570-5510592 TTTGATAAACATCGGGAAAAAGG + Intergenic
901072036 1:6525517-6525539 CAGGATAAAAATAAGGAAACTGG - Exonic
902129823 1:14250141-14250163 CTGAATAAACATGTGTATAAAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903533288 1:24048695-24048717 CTGGGTAAACATCTGATAAATGG + Intergenic
903804004 1:25991108-25991130 CTGGATAAACATACGTTAATGGG - Intronic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904791474 1:33025311-33025333 CTGAATAAACATTTGCCAAAGGG + Intronic
906338535 1:44956747-44956769 CTGAATAAGCATTTGGAAAAAGG + Intronic
907697774 1:56751200-56751222 CTACCTAAACATATGCAAAAGGG + Exonic
908194172 1:61732772-61732794 GTGCAGAAACATAAGGAAAAAGG + Intergenic
908369237 1:63464439-63464461 TGGGATAGAAATATGGAAAAGGG + Intronic
909506706 1:76399379-76399401 CTGAATAACCTCATGGAAAAAGG - Intronic
911843169 1:102711056-102711078 CTAGAAAAACATAAGGCAAAAGG - Intergenic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
915112502 1:153573409-153573431 CTGGATTAATATATAGATAATGG - Intergenic
916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG + Intronic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
917004484 1:170397795-170397817 CTGGATTATCATAAGGAAAATGG + Intergenic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917387498 1:174492869-174492891 CTGCTTATACATATGGAAGAGGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918500973 1:185195759-185195781 GTCAACAAACATATGGAAAAAGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918932710 1:190876302-190876324 CTGCTTCAACATATGAAAAATGG + Intergenic
919503725 1:198371306-198371328 CTGGAAATAAATTTGGAAAAAGG + Intergenic
920259539 1:204679527-204679549 AGGGAAAAACATATGGAAGAAGG - Intronic
921539329 1:216394314-216394336 CTGAATAAATATCTGGGAAAAGG - Intronic
922094644 1:222432629-222432651 CAGGAAAAAACTATGGAAAAGGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923505738 1:234605024-234605046 CTGGATAGACTTATCCAAAACGG + Exonic
924171727 1:241349387-241349409 CTGGAAAAATATATAGGAAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1062998014 10:1885687-1885709 CTGGAAAAGAATATGTAAAATGG - Intergenic
1063029397 10:2217601-2217623 CTGGCGAAACATCTGTAAAACGG - Intergenic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1063429993 10:5979851-5979873 ATGGACATACACATGGAAAAGGG - Intergenic
1063498284 10:6530092-6530114 CTGGATATGCATATGGGACAGGG + Intronic
1063880519 10:10527039-10527061 TTGCATAAACACATGAAAAAGGG + Intergenic
1064047267 10:12028645-12028667 CTGAAAGAACTTATGGAAAAGGG - Intronic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1065268875 10:24006325-24006347 ATGGATAAAAGTATGGAAAAAGG - Intronic
1065417102 10:25500319-25500341 CTGCAGATAAATATGGAAAAAGG + Intronic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068100140 10:52542393-52542415 CTGGATAAAGATTTGGGGAATGG + Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070010513 10:72469528-72469550 CTGATAAAACATCTGGAAAATGG - Intronic
1070255852 10:74812771-74812793 GCGAATAAACATATGAAAAATGG - Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071759696 10:88587170-88587192 TTGGATTAACGTATGGGAAAGGG + Intronic
1072191797 10:93081829-93081851 CTGGAGAAACATAAGGTAAATGG - Intergenic
1073657780 10:105435796-105435818 TTGGATAAACAAATGGCAGAAGG - Intergenic
1073924151 10:108495392-108495414 CTTGGTATACATATGCAAAATGG + Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1076621822 10:131793870-131793892 CTGGAAAAAAAGGTGGAAAAGGG - Intergenic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077553186 11:3212939-3212961 CTGGATCAACTTATGGAGAACGG - Intergenic
1077931849 11:6741056-6741078 AAGGATAAAGAAATGGAAAAAGG + Intergenic
1078116031 11:8451901-8451923 CTGGATAAAAAAATGCAAAGAGG + Intronic
1078151644 11:8764665-8764687 CTGGATAAAGAATTAGAAAAGGG + Intronic
1078573561 11:12479856-12479878 CTGGATAAATATATAGGACATGG - Intronic
1079576851 11:22014643-22014665 CTGGAAAAACATGAGGAAATTGG + Intergenic
1080182717 11:29443842-29443864 CTGGGTAAATATAAAGAAAAGGG + Intergenic
1080293832 11:30702253-30702275 CTGTATAAAAACATGGAAATTGG - Intergenic
1082879795 11:58026379-58026401 CTTGTTAAAAATATGGAACATGG + Intronic
1084920516 11:72465693-72465715 CTGGAGAAACCCATAGAAAAAGG - Intergenic
1085975226 11:81644902-81644924 ATGGAAAAAAATAAGGAAAAGGG + Intergenic
1088316761 11:108514898-108514920 CTGTAAAAACATACAGAAAAAGG - Intronic
1090469908 11:126971184-126971206 CTGAATAAACATTATGAAAAGGG + Intronic
1091128502 11:133123684-133123706 CTGAATAACCATATGCCAAAAGG + Intronic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092407410 12:8230581-8230603 CTGGTGAAACATAAAGAAAATGG + Intergenic
1092496326 12:8998767-8998789 CTTGTTGAACATATGCAAAATGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093509663 12:19911531-19911553 CTGGATATCCGTATGCAAAAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093852827 12:24061464-24061486 CTGGATAATCATTTGGATTATGG - Intergenic
1095039933 12:37429634-37429656 CTCTATATATATATGGAAAAGGG - Intergenic
1095039953 12:37430097-37430119 CTCTATATATATATGGAAAAGGG - Intergenic
1095574341 12:43718196-43718218 CTTGATTAAAATATGGACAAAGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096588987 12:52644709-52644731 CAGAATACACATCTGGAAAATGG + Exonic
1098409124 12:70160760-70160782 CTGGATATTCATATGCAGAAGGG + Intergenic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1098963000 12:76758681-76758703 GTGGATATCCATATGCAAAAAGG + Intergenic
1099170572 12:79359225-79359247 CTGGAAACCCATATGGTAAAGGG + Intronic
1099794422 12:87380423-87380445 TTGGATACCCATATGGAAAAAGG - Intergenic
1100323565 12:93519775-93519797 CTGGATAAACACAAGGATTAGGG - Intergenic
1100878212 12:98986317-98986339 CTGGTTTAACATGTAGAAAAAGG - Intronic
1100959757 12:99949392-99949414 CAGGATCAACATTTGGAGAATGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107098123 13:36558773-36558795 CTGGATTTACACATGGAAATGGG + Intergenic
1107332876 13:39320327-39320349 CTGGATGAACATGGGCAAAATGG + Intergenic
1107374790 13:39791165-39791187 CTAGATATACATATAGAAAGTGG - Intronic
1107571902 13:41670390-41670412 CTGGAGAAAAATATGGGAACAGG - Intronic
1107627955 13:42309727-42309749 CTAGATAAAGTTATAGAAAAGGG - Intronic
1107746191 13:43512291-43512313 TTGGATGAAAATATGCAAAATGG - Intronic
1107964437 13:45586644-45586666 CCAGATAATCATGTGGAAAATGG - Intronic
1108102978 13:46977525-46977547 GTTGATGAAGATATGGAAAAAGG - Intergenic
1108524080 13:51271059-51271081 CTGGAAAATGATATGGATAATGG - Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1110821481 13:79922511-79922533 CTGGTTCAACATATGCAAATCGG - Intergenic
1111193839 13:84845711-84845733 CTTGAAAACCATTTGGAAAAAGG + Intergenic
1112639663 13:101258536-101258558 CAGGATGAACATGTGGAAAACGG + Exonic
1112659310 13:101489290-101489312 ATGGATAAACACATGGTAGATGG + Intronic
1112935797 13:104796846-104796868 CAGGATCAACATGTGGACAATGG + Intergenic
1113316225 13:109182285-109182307 CTGGACAAACACATGTAAGATGG + Intronic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114710384 14:24771694-24771716 CTGGTTCAACATATGCAAATCGG + Intergenic
1115103843 14:29736231-29736253 CTGGATAAAAATATGCATATTGG + Intronic
1115591047 14:34865271-34865293 ATGGTTATACATATGCAAAAGGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116360751 14:43994232-43994254 CTCGTTAAGCATATGGAATATGG + Intergenic
1117435730 14:55713758-55713780 CTGCCTCAGCATATGGAAAAGGG + Intergenic
1117828642 14:59728473-59728495 CTGGATAAACATCAGGCAGAAGG - Intronic
1118018737 14:61689053-61689075 CTGGATTATTTTATGGAAAAGGG - Intergenic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1119149958 14:72349666-72349688 GTGGGCAAACATAAGGAAAAAGG + Intronic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120465068 14:84845888-84845910 CTGGCTAAAAGTATGGAATAGGG + Intergenic
1121024638 14:90606335-90606357 CTGGAGAAACACATGGCAACGGG + Intronic
1121149381 14:91617044-91617066 CTGCTTAAACATAGGGAATATGG - Intronic
1122450581 14:101803352-101803374 CTGGATATTCATATGCAGAATGG + Intronic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1202875686 14_GL000225v1_random:207553-207575 CCAGATGTACATATGGAAAATGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126044766 15:44628820-44628842 CTAGATGAACATCTGCAAAAAGG - Exonic
1126759969 15:51961064-51961086 TGGGATAGACTTATGGAAAATGG - Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1129744977 15:78012073-78012095 CTTGTTAAAAATATGGATAAAGG - Intronic
1129752329 15:78074980-78075002 CTGGAGAATGTTATGGAAAATGG - Intronic
1130052634 15:80496588-80496610 CTGGATAACCATATAGAACCAGG + Intronic
1131348989 15:91679359-91679381 CTGGATGAAGATAAGGCAAATGG - Intergenic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1132238825 15:100241786-100241808 CTTGATTGACATATAGAAAAGGG - Intronic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1134295595 16:12942693-12942715 CTGGGTAAACAAAGTGAAAAGGG - Intronic
1134901445 16:17941581-17941603 CTGGCTGAACAAATTGAAAATGG - Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136492780 16:30621310-30621332 CTGGGCAAACAGATAGAAAAGGG - Intronic
1137030518 16:35519579-35519601 CTGGGCAAACAGATAGAAAAGGG + Intergenic
1138934665 16:61704332-61704354 CTCAATAAACATATGACAAATGG - Intronic
1140180366 16:72710570-72710592 CAGGATATCCATATGCAAAAGGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1143735083 17:8905868-8905890 CATGACAAACATTTGGAAAATGG + Intronic
1143970894 17:10794833-10794855 CAGGTTAAACAAATGGGAAAAGG + Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144260435 17:13514054-13514076 CTTGATAAACATCTGGGAAATGG - Intronic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1149221811 17:54423548-54423570 GCCGATAAACATATGAAAAAAGG + Intergenic
1150051262 17:61965641-61965663 CTGAAGAAACATATTTAAAATGG + Intronic
1151204798 17:72498413-72498435 CTAAATAAACATTTGTAAAACGG + Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153884991 18:9456818-9456840 GTGGATGAACACATGGAATAGGG - Intergenic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155376671 18:25165777-25165799 CTCATTAACCATATGGAAAATGG - Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158872019 18:61697356-61697378 CTAGATAAACATCTGGAAGATGG - Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161273855 19:3404682-3404704 CCGGAGAAACATCTGGAACAGGG + Intronic
1161498931 19:4602660-4602682 GTGGATAAATATATGGATTATGG + Intergenic
1161639032 19:5408336-5408358 CTGGATATCCACATGCAAAAGGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162387979 19:10371855-10371877 CTTGTTTATCATATGGAAAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1163596422 19:18223728-18223750 CTGGATGACCATATTGCAAAGGG + Intronic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164190048 19:22906153-22906175 CAGAATAAAAATGTGGAAAATGG - Intergenic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168144688 19:54414447-54414469 CTGGAGCAAAATATGGAAATGGG + Intergenic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
1168445464 19:56408239-56408261 CTAGGTTAAAATATGGAAAATGG + Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168576249 19:57513523-57513545 CTGGGCAAACAGATAGAAAAGGG + Intronic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927816952 2:26226605-26226627 TTGGATATTCATATGCAAAAAGG + Intronic
927968532 2:27288153-27288175 CTGGAAAAACCTTGGGAAAACGG - Intronic
928158588 2:28899786-28899808 CAGGATAAGCATATTTAAAAAGG - Intronic
928239235 2:29572197-29572219 CAGGATAAACAAATCCAAAATGG - Intronic
928870137 2:35966199-35966221 GTGGATATAAACATGGAAAAGGG - Intergenic
930070775 2:47364433-47364455 GTGGAAAAAGATATGAAAAAGGG + Intronic
930837595 2:55811153-55811175 CTGAAGAAAAATAAGGAAAATGG - Intergenic
931105427 2:59049825-59049847 CTCAATAAACCTAAGGAAAAAGG - Intergenic
931552544 2:63462637-63462659 CTGGCTAAAAATATGCAGAAAGG + Intronic
932002495 2:67897524-67897546 TTTGATAGAAATATGGAAAATGG + Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932953272 2:76318611-76318633 TTTGATAATCATCTGGAAAAGGG + Intergenic
933463305 2:82617277-82617299 CTAGACATTCATATGGAAAAGGG + Intergenic
933839358 2:86274151-86274173 CTGCATAAACATAGGAAGAAAGG + Intronic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936851724 2:116907296-116907318 CATGAGAGACATATGGAAAATGG - Intergenic
937526449 2:122775903-122775925 CTGGTTCAACATATGCAAATTGG + Intergenic
937702094 2:124874696-124874718 CTTTTTAAACATATGGAAACAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938484065 2:131685597-131685619 CTAGATATCCATATGCAAAAGGG - Intergenic
938851762 2:135267735-135267757 CTGGATATAAATATTTAAAATGG - Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
941425220 2:165335938-165335960 TTGAATAGACATATTGAAAAAGG + Intronic
941555060 2:166968094-166968116 CTAGCTAAACATATAGAAGAAGG + Intronic
942468688 2:176236623-176236645 ATGGATAATCATATGACAAAAGG + Intergenic
943353751 2:186824937-186824959 GTGGATGAACATATGGGAGAAGG - Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
945612322 2:212019439-212019461 ATGGAAAAACACATGTAAAAGGG + Intronic
945828877 2:214758916-214758938 CTGCAAAAACATATGCAAAAAGG + Intronic
946282502 2:218676341-218676363 CTGGAAAAGGATTTGGAAAAAGG - Intronic
947102609 2:226637522-226637544 TTGGATAAACATATGTAATTGGG - Intergenic
947585773 2:231355775-231355797 CTGGAGAAAAACATGAAAAACGG - Intronic
948335981 2:237207367-237207389 GCAGATAAACAAATGGAAAATGG + Intergenic
948507908 2:238442749-238442771 CTGGACATCCATATGGAAAAAGG - Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172393346 20:34581642-34581664 CTGGATAAACATGAAGAAGATGG + Exonic
1173829518 20:46072242-46072264 CTGGAGAAAGATTTGGAAAGAGG - Intronic
1173932070 20:46829176-46829198 CTGGAAGGATATATGGAAAACGG + Intergenic
1176638244 21:9269741-9269763 CTGGTTCAACATATGAAAATCGG + Intergenic
1177108594 21:16994695-16994717 ATGGAAAAAGAAATGGAAAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177731565 21:25033909-25033931 CTGAATTATCATATGGCAAAAGG - Intergenic
1177763663 21:25432469-25432491 ATGGACAAACATATAGAAATGGG + Intergenic
1178206793 21:30477274-30477296 CTTTATAAACATATAAAAAATGG - Intergenic
1178220953 21:30659386-30659408 CTGGGTAATCATATGCAAATAGG + Intergenic
1178671280 21:34593780-34593802 GTGGAAAAATATCTGGAAAATGG + Intronic
1179199426 21:39202546-39202568 CTGGCCAAACATATGAACAAAGG + Intronic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1180371557 22:12042575-12042597 CTGGTTCAACATATGAAAATCGG + Intergenic
1180416228 22:12717880-12717902 CCAGATGTACATATGGAAAATGG - Intergenic
1180422286 22:12877238-12877260 CTGGTTCAACATATGAAAATCGG + Intergenic
1182979614 22:34656539-34656561 ATGCATAAACATATGGGGAATGG + Intergenic
1183050331 22:35255733-35255755 CTGGGGAAACACATGGAAATGGG + Intergenic
1184460202 22:44633529-44633551 CTGGATGAATGCATGGAAAATGG + Intergenic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
950971065 3:17188387-17188409 CAATATAAACACATGGAAAAAGG + Intronic
951359168 3:21704051-21704073 CTTGAAAAGCATATGAAAAAGGG - Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
955468322 3:59259128-59259150 CTGAATAAATATATTTAAAATGG + Intergenic
956040431 3:65139609-65139631 TGTGATAAAAATATGGAAAATGG - Intergenic
956088311 3:65637151-65637173 TTGGGTAAACATATAGAAATTGG + Intronic
956905930 3:73765133-73765155 TTGGATAAATATATGGAAGTGGG - Intergenic
956997323 3:74842581-74842603 CTGTATAAAAATATGTATAATGG - Intergenic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
960372684 3:116860327-116860349 CTGGATGTCCATATGGAAAGAGG - Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
962153865 3:132923305-132923327 CAGGATAAACATGTGTAGAAGGG + Intergenic
962294322 3:134167559-134167581 CTGGATAGCCATATGTAGAAAGG + Intronic
962663286 3:137627034-137627056 GTGGATAAAATCATGGAAAAGGG + Intergenic
962729153 3:138263851-138263873 CAGGTTAAATATATGGCAAAAGG - Intronic
963006420 3:140730048-140730070 AAGTATAAATATATGGAAAAAGG + Intergenic
963573470 3:147027964-147027986 CTGAAGAAACTTATGGAACAAGG - Intergenic
963668497 3:148221656-148221678 CTGGATAAGTATCTGGAAAAGGG - Intergenic
964346966 3:155763684-155763706 CTGGAGAGAAATATGGAAAAAGG - Exonic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964863851 3:161231904-161231926 ATGCATAACCATATGGAAATTGG + Intronic
965501825 3:169466201-169466223 CTGGATATGCATATGCCAAATGG + Intronic
966238003 3:177724343-177724365 CTAAATAAACATTTGGAATAGGG - Intergenic
966555448 3:181254417-181254439 GTGTATAAAGATATGGAAGAAGG + Intergenic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
967513270 3:190337331-190337353 GTGGATGAACATATGGAAATGGG + Intronic
967533511 3:190576322-190576344 TTGGGAAAACATATGGCAAAGGG + Intronic
967933957 3:194711644-194711666 ACAGAAAAACATATGGAAAATGG - Intergenic
1202748652 3_GL000221v1_random:135280-135302 CTGGTTCAACATATGAAAATCGG - Intergenic
971523918 4:27591576-27591598 CAGCAAAAACATTTGGAAAAGGG + Intergenic
972224808 4:37000488-37000510 CAGGATACAGATAAGGAAAAGGG + Intergenic
972257597 4:37374529-37374551 ATGCAGAAAGATATGGAAAAAGG + Intronic
972577932 4:40369006-40369028 CTGGATAAGGAAATGTAAAAAGG - Intergenic
974139290 4:57864090-57864112 CTTGGTATACATATGAAAAAAGG + Intergenic
974326432 4:60420215-60420237 CTAGATAAACATGTTGACAAAGG - Intergenic
974394397 4:61315870-61315892 CATGATAAATATGTGGAAAATGG - Intronic
975616209 4:76250321-76250343 GTGAACAAACATATGAAAAAAGG - Intronic
976065222 4:81179407-81179429 CTGGGTAAAGATATTGAAATAGG - Intronic
976541943 4:86287993-86288015 ATTGAGTAACATATGGAAAATGG + Intronic
976545409 4:86329658-86329680 CTGCATAAGCATATGGCAGATGG - Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
980519011 4:133906520-133906542 TTGAATAAACATAGTGAAAATGG + Intergenic
981285658 4:143016220-143016242 CTATATAAACACATGGGAAATGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982983955 4:162180213-162180235 ATGAATAAATATATGTAAAATGG + Intergenic
983150933 4:164280496-164280518 CTGGCTAACCATTTGGAAAAAGG + Intronic
984340533 4:178451064-178451086 AAGGAGAAACATATGGGAAAGGG - Intergenic
984413197 4:179423572-179423594 CTCGATTAACATATGGTAGAAGG - Intergenic
985144705 4:186884111-186884133 CTGTCTACACATATGCAAAATGG - Intergenic
1202753141 4_GL000008v2_random:28153-28175 CTGGTTCAACATATGAAAATCGG + Intergenic
985989214 5:3541450-3541472 CAGGATAATCAAATGAAAAAAGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
986818077 5:11434621-11434643 ATGGATAAGCATTTGGAAAGAGG + Intronic
986888992 5:12277160-12277182 CTGAATAGACTTATGGAAAGAGG + Intergenic
987682288 5:21153066-21153088 CTTGATACAAATATGGAAAATGG + Intergenic
987800215 5:22686031-22686053 GTGGATAAGAATGTGGAAAAAGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988392101 5:30647659-30647681 CAGGATAATCATATGTAAAAAGG + Intergenic
988426036 5:31065848-31065870 ATAGATAAACATAGAGAAAATGG + Intergenic
989079231 5:37599578-37599600 CTGGTTATCCATATGTAAAAAGG + Intronic
989115619 5:37949584-37949606 CTTGATAAACATTTGTAGAATGG - Intergenic
989144089 5:38231424-38231446 CTGGAATACTATATGGAAAAGGG - Intergenic
990756840 5:59081598-59081620 TTGTATAACCATATGGACAAAGG - Intronic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992577364 5:78129365-78129387 CTGGATAAACATATTTAAAGAGG + Intronic
993059770 5:83025288-83025310 TTGGAAAAAAATATTGAAAATGG - Intergenic
993675219 5:90808518-90808540 CTGGATGAACATTTTAAAAATGG - Intronic
994631087 5:102288727-102288749 CTGGAGAAAAATATGGTTAAGGG - Intronic
994666850 5:102715616-102715638 CTGGATAAACATCTGGAATGAGG + Intergenic
995159520 5:108962229-108962251 TTGTGTAAACATATGGAAGATGG + Intronic
995766745 5:115627056-115627078 CTCCATAAATATATGTAAAATGG - Intronic
996293410 5:121881829-121881851 CTGGATATACATTTCTAAAAAGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997867560 5:137478185-137478207 ATGGATAAACACGAGGAAAATGG + Intronic
998874402 5:146584757-146584779 TTGGATGAACAAAAGGAAAAAGG + Intronic
999929710 5:156417959-156417981 CTGGATAAAAATATTCAAGATGG + Intronic
1000682108 5:164197914-164197936 CTTTATAAACATAGGGAAATAGG + Intergenic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006812644 6:36829949-36829971 TTGCATAAACATCTGGCAAATGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1009437902 6:63638480-63638502 CAGAAAAAACATATGTAAAAAGG - Intronic
1010104156 6:72148301-72148323 TTGGTTAACCATCTGGAAAAAGG + Intronic
1010999786 6:82574937-82574959 GTGGCAAAACATTTGGAAAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012958243 6:105593775-105593797 CTGGAAAAAGACATGAAAAATGG + Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013815922 6:114097305-114097327 GTGGATATACTTATGAAAAAAGG + Intronic
1014519290 6:122420533-122420555 CTGGATTCACATATACAAAATGG - Intronic
1015075809 6:129155924-129155946 CTATATACAAATATGGAAAATGG + Intronic
1015349405 6:132199363-132199385 CTGAATAAACCTTTGGCAAATGG + Intergenic
1015666654 6:135638056-135638078 CTGGATAAGGTGATGGAAAATGG + Intergenic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015991823 6:138952783-138952805 CTGGATATCCATATGAAATATGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017728368 6:157292097-157292119 CTGGTTAAAAATATTGAAGACGG + Exonic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019180447 6:170184321-170184343 CTGGATAACCAAGTGGAAAATGG - Intergenic
1019732649 7:2636468-2636490 CTGGACAAGCATCTGGAACACGG - Intronic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021605422 7:22404934-22404956 CAGGATAAATAAATGGTAAATGG + Intergenic
1021954167 7:25807226-25807248 TTGCATAATCCTATGGAAAAGGG + Intergenic
1022290425 7:28997252-28997274 GTGAATAAACGTATGCAAAAAGG + Intronic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1025014407 7:55427312-55427334 CTGGATACTGATATGGAAGATGG + Intronic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1027660578 7:80983595-80983617 AAGGATAAACACATAGAAAAGGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028788386 7:94823717-94823739 TTGGATAGCCATATGGAGAAAGG + Intergenic
1030388358 7:108893678-108893700 CTGGATATATATCTGAAAAAGGG + Intergenic
1030886189 7:114940914-114940936 CTGGATAACAAGATGGAATAGGG - Intronic
1032070173 7:128800091-128800113 ATGGACAAACATATAGAAAAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036847779 8:12181500-12181522 CTGGTGAAACATGTAGAAAATGG + Intergenic
1036869147 8:12423815-12423837 CTGGTGAAACATGTAGAAAATGG + Intergenic
1036929231 8:12937322-12937344 ATAGATAAAAATATGGAAAGAGG + Intergenic
1037718715 8:21422433-21422455 TAGGAGAAACATATAGAAAAGGG - Intergenic
1038827590 8:31021758-31021780 CTGGAAAATCATATGAAAATGGG + Intronic
1039521239 8:38174177-38174199 GGGGATAAAGATATGAAAAAAGG + Intronic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040678449 8:49780649-49780671 CTGTGTACACATATGGCAAAAGG + Intergenic
1040717789 8:50279259-50279281 ATCAATAAACATGTGGAAAATGG + Intronic
1041206416 8:55502916-55502938 CTGGGAAAACATATGCAAAAAGG - Intronic
1041619182 8:59945504-59945526 CATGATAAACATATGGGATAGGG + Intergenic
1042455023 8:68990882-68990904 ATGAATAAACATATGTGAAATGG + Intergenic
1042997978 8:74721869-74721891 CTGCATAACCATCTGGAATATGG - Intronic
1044643399 8:94410647-94410669 CTAGATTAACATATGGAAATTGG - Intronic
1044692020 8:94890507-94890529 CTGGCTAAACATGTTAAAAAAGG - Exonic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1046539922 8:115566565-115566587 TCAGAAAAACATATGGAAAATGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052634127 9:31078886-31078908 GTGGATAAGAATATGGATAATGG + Intergenic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1054719171 9:68586423-68586445 CTGTATATACATATATAAAATGG - Intergenic
1055546977 9:77387523-77387545 CTTGAATAACATATTGAAAACGG + Intronic
1056159471 9:83874085-83874107 CTGGAGCAACATGTGGAAGAGGG - Intronic
1056351100 9:85749840-85749862 CTGGAGCAACATGTGGAAGAGGG + Intergenic
1056454879 9:86750773-86750795 TTGCATTAACGTATGGAAAATGG - Intergenic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059849235 9:118318709-118318731 ATGGATCAACGGATGGAAAAAGG + Intergenic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1061749022 9:132762617-132762639 CTGGATAGCCACATAGAAAACGG + Intronic
1062013974 9:134282112-134282134 CTGTAAAAACATTTGTAAAATGG + Intergenic
1203717290 Un_KI270742v1:165370-165392 CTGGTTCAACATATGAAAATCGG - Intergenic
1203533927 Un_KI270743v1:12863-12885 CTGGTTCAACATATGAAAATCGG + Intergenic
1185834431 X:3331837-3331859 CTGGATAAGCAATTTGAAAAAGG + Intronic
1186009680 X:5115563-5115585 CTGGGGAAAGATATGGAAACAGG + Intergenic
1186129002 X:6446163-6446185 TAGGATAAACATGTGGAAAGAGG - Intergenic
1187650923 X:21404998-21405020 ATGGATAAATATATCCAAAAAGG - Intronic
1188314554 X:28657329-28657351 CTGGAAAAAAATGTGGAAAATGG - Intronic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1189993119 X:46613132-46613154 ATCTATAAACATATGGAAGATGG + Intronic
1190720657 X:53144801-53144823 CTGGCTGATCATATGCAAAACGG - Intergenic
1190751438 X:53365241-53365263 ATAAATAAACATATGGAAGACGG - Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1191707366 X:64107797-64107819 CTGGATAAACACATGGAATGTGG - Intergenic
1193624809 X:83804919-83804941 TTGGATAAATATCTGGAAATGGG - Intergenic
1193935657 X:87616920-87616942 TTGCATAACCATAAGGAAAAGGG - Intronic
1194275302 X:91872797-91872819 ATGGTCAAACATATGGCAAAAGG + Intronic
1194806965 X:98341601-98341623 CTGGAAAAACCTAAAGAAAATGG - Intergenic
1194992490 X:100559765-100559787 AAAGATAAAGATATGGAAAATGG + Intergenic
1195004816 X:100675483-100675505 CTGGATAAACTTCTGGAACTTGG - Exonic
1195914692 X:109924613-109924635 ATGCATAATCATATGGAAACAGG + Intergenic
1197331837 X:125162208-125162230 GTGGATAAGCATATGGAATGGGG + Intergenic
1197582158 X:128296749-128296771 CTAGATATTCATATGCAAAAGGG + Intergenic
1197582160 X:128296777-128296799 CTAGATATTCATATGCAAAAGGG + Intergenic
1198133993 X:133728520-133728542 TTGGATAAACATATTGAGTAGGG - Intronic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199114553 X:143975905-143975927 CTGGATAAGCATTTGGAATATGG - Intergenic
1199353675 X:146834958-146834980 TAGGATATACATATAGAAAAGGG - Intergenic
1200592547 Y:5094194-5094216 ATGGTCAAACATATGGCAAAAGG + Intronic
1200912622 Y:8544517-8544539 CTGGATCAGTATTTGGAAAATGG + Intergenic
1200925662 Y:8652215-8652237 CTGGATTAGTATTTGGAAAATGG + Intergenic
1200983239 Y:9281110-9281132 CTGGATCAATATTTGGAAAATGG - Intergenic
1201494962 Y:14583077-14583099 AGGGATAAACATAGGGGAAATGG + Intronic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic
1202127144 Y:21578587-21578609 CTGGATCAATATTTGGAAAATGG + Intergenic