ID: 1172017542

View in Genome Browser
Species Human (GRCh38)
Location 20:31886902-31886924
Sequence CCTGGTTTTCAGTACTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172017542_1172017549 25 Left 1172017542 20:31886902-31886924 CCTTTGGAGTACTGAAAACCAGG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1172017549 20:31886950-31886972 GGAGCAAACCTGCAGTAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 134
1172017542_1172017548 22 Left 1172017542 20:31886902-31886924 CCTTTGGAGTACTGAAAACCAGG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1172017548 20:31886947-31886969 TGTGGAGCAAACCTGCAGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 121
1172017542_1172017546 4 Left 1172017542 20:31886902-31886924 CCTTTGGAGTACTGAAAACCAGG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1172017546 20:31886929-31886951 TGCTATACTGGTCATACCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
1172017542_1172017544 -8 Left 1172017542 20:31886902-31886924 CCTTTGGAGTACTGAAAACCAGG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1172017544 20:31886917-31886939 AAACCAGGCATTTGCTATACTGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172017542 Original CRISPR CCTGGTTTTCAGTACTCCAA AGG (reversed) Intronic
900420199 1:2552976-2552998 CCTGGGTTCCAGCCCTCCAAGGG - Intergenic
900424232 1:2568682-2568704 CCTGGGTTCCAGCCCTCCAAGGG + Intergenic
900997089 1:6128549-6128571 CCTGATGTCCAGTCCTCCAAAGG - Exonic
901241062 1:7693737-7693759 CCTGGTTGGCAGTACTCCATGGG - Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
903570898 1:24304323-24304345 TCTGGTCTTCAGAACTCTAATGG + Intergenic
907642522 1:56205795-56205817 CCTGGGTTTCAATGCTCCACAGG - Intergenic
911450024 1:98050375-98050397 CCTGGTTTTAAGAAGTCAAAAGG - Intergenic
913121478 1:115745187-115745209 CCAGGTTTTATCTACTCCAAGGG - Intronic
913157509 1:116114506-116114528 CCTTGTCTTCTTTACTCCAAAGG + Intronic
917726468 1:177832447-177832469 TCTTGTTTTCATTACTGCAAAGG - Intergenic
918237619 1:182595908-182595930 CCTGGTTTCCAGGAATCCCATGG + Intergenic
919798538 1:201336748-201336770 TCTGGTTTTGAGTACTCCTGGGG + Intergenic
923631867 1:235655075-235655097 CTTGGTTTTCTGTACTTAAAAGG - Intergenic
923929520 1:238678317-238678339 CCTGTATTTCTGTACTTCAAAGG + Intergenic
924913995 1:248547273-248547295 CCTGGTTTTCAGTTCTTCTGTGG - Intergenic
1063502685 10:6569507-6569529 CCTGCTCTTAAGTTCTCCAAAGG - Intronic
1065306665 10:24375425-24375447 CCTGCTTCACGGTACTCCAAAGG - Intronic
1066972487 10:42324868-42324890 ACTGCTTTTCAGTAAGCCAAAGG + Intergenic
1067750563 10:48968651-48968673 CATGGTTTTCTCTACTCCATGGG + Intronic
1075018049 10:118925465-118925487 CAGGATTTTCAGTACTACAATGG + Intergenic
1081060085 11:38463375-38463397 CCAGGTCTCCAGTACTCAAAAGG + Intergenic
1081882090 11:46462308-46462330 CCTGGTTTCCCATACCCCAAGGG - Intronic
1086343778 11:85874668-85874690 CCTGGTTTACAATATTCAAAAGG - Intronic
1088506179 11:110529864-110529886 CCTAATTCTCTGTACTCCAAAGG - Intergenic
1091362859 11:134991976-134991998 CCAGGTTCTGAGTACTCCATGGG - Intergenic
1094245255 12:28284149-28284171 CCTTTTTTCCAATACTCCAATGG - Intronic
1094304825 12:29006870-29006892 CCTGATTTCCAGGCCTCCAAGGG + Intergenic
1095728269 12:45475563-45475585 CCTGGTCTTATGTAATCCAATGG + Intergenic
1098353049 12:69583742-69583764 CCTGGTTTACAGTATTCCTCAGG - Intergenic
1100151789 12:91746993-91747015 CCTGGTGCTCAGGGCTCCAAAGG - Intergenic
1101200118 12:102427005-102427027 CCTGGTTTTCAGTCATTCCAGGG - Intronic
1103336264 12:120192425-120192447 CCTTGTCTTCAGTATTCTAAAGG - Intronic
1103670720 12:122612723-122612745 TTTGGTTTTCAGTACTGCCAGGG + Intronic
1104407792 12:128532945-128532967 GTGGGTTTTCAGTATTCCAAAGG - Intronic
1106173492 13:27308884-27308906 CCCATTTTTCAGTACACCAACGG - Intergenic
1110787310 13:79544831-79544853 CCAGGGTTTCAGTAATCCATAGG + Intronic
1113156032 13:107323091-107323113 CTTGCTTGTCAATACTCCAATGG - Intronic
1116605223 14:46983654-46983676 CCTGGTTTTCAGTAATATCAAGG + Intronic
1118359634 14:65045034-65045056 CGTGGATTTCTCTACTCCAATGG - Intronic
1120832866 14:89013538-89013560 CCTGGATTTGAGTACTTTAACGG - Intergenic
1123455822 15:20423904-20423926 CCTTTTTTTCAGTTCTCCAGGGG + Intergenic
1123635747 15:22306942-22306964 CCTTTTTTTCAGTTCTCCAGGGG - Intergenic
1126345169 15:47685871-47685893 TCTGGTTTTGAGTTCTCCCAGGG - Intronic
1126381917 15:48057412-48057434 GTTGTTTTTCAGCACTCCAAGGG - Intergenic
1129341857 15:74891450-74891472 CCTGGTTCTCAGCAATCCACTGG - Exonic
1133568307 16:7016378-7016400 CCTTGTTTTCAGTATCCGAAAGG - Intronic
1133838125 16:9384505-9384527 CATGGTTTTCTGTCCTCCAGAGG + Intergenic
1135181161 16:20275854-20275876 ACTGCTTTTCAGTGCTCCCAGGG + Intergenic
1135457886 16:22614596-22614618 CGTGGAGTTCTGTACTCCAAAGG + Intergenic
1136859688 16:33690999-33691021 CCTGGTTTTCTGTGCTCTACTGG - Intergenic
1203121194 16_KI270728v1_random:1539178-1539200 CCTGGTTTTCTGTGCTCTACTGG - Intergenic
1144118955 17:12131023-12131045 AATGGTTTTTAGTCCTCCAAAGG + Intronic
1153194069 18:2573767-2573789 CTTGGTTTACAGTATTCAAAAGG - Intronic
1155207468 18:23573105-23573127 CCTAGATTTCAGGACTCAAATGG - Intronic
1159351585 18:67281812-67281834 CGTAGTTTTCAGTATTTCAAAGG + Intergenic
1159580885 18:70233246-70233268 CTTGTTTTCCAGTACTCAAAAGG + Intergenic
1162830700 19:13282483-13282505 CCTGCTTGTCAGGACTCAAAGGG + Intronic
1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG + Intergenic
1164316143 19:24089522-24089544 CCTGGGTTTCAGTACTGTATTGG + Intronic
1165467506 19:35983734-35983756 CCTGGTTACCAGGACCCCAAGGG - Intergenic
926395573 2:12439154-12439176 CTTGCTTTTAAATACTCCAAGGG + Intergenic
928369027 2:30725923-30725945 CCTGCCTTCCAGTACACCAAAGG + Intronic
929417581 2:41759408-41759430 CCTGGTTTTCTGTATACCACTGG + Intergenic
935352927 2:102169927-102169949 CATGGTTTGTGGTACTCCAAAGG - Intronic
935357325 2:102214944-102214966 CCTGGGTTTCTGTGCTCCACAGG - Intronic
936229328 2:110686185-110686207 TCTGTTTTTCAGGAATCCAAAGG - Intergenic
938250001 2:129807195-129807217 TCTGATTTTCAGCACTCTAATGG + Intergenic
938703657 2:133900933-133900955 CTTCTTTTTCAGTACTCCAGAGG - Intergenic
939524274 2:143272766-143272788 CTTGATTTTCAGTACTACTAAGG + Intronic
940794826 2:158066176-158066198 ACTGCCTTTCAGTACTCCTATGG - Intronic
941493386 2:166170418-166170440 CCAGGTTTTCTTTCCTCCAATGG + Intergenic
944353384 2:198756786-198756808 CCATGTTTTCAGCACTACAAGGG + Intergenic
945057330 2:205880364-205880386 CCTGGATTTCTTTACTCCAGAGG + Intergenic
945991959 2:216403582-216403604 CCTGGTTTTCAGTTCTCAAAGGG - Intergenic
1168991790 20:2102185-2102207 GCTGGCCTTCAGTCCTCCAACGG - Intronic
1170994308 20:21337244-21337266 CCTTTTTTACAGTAATCCAAGGG + Intronic
1172017542 20:31886902-31886924 CCTGGTTTTCAGTACTCCAAAGG - Intronic
1175114620 20:56673422-56673444 CTTGGTAGTCAGTATTCCAATGG - Intergenic
1175681952 20:60995518-60995540 CCTGGGCTGCAGTGCTCCAAAGG + Intergenic
1184160909 22:42696827-42696849 CCTGTTTTTCAGGCCTCAAACGG + Intronic
949971625 3:9411811-9411833 CCTGATTTTCAATACTTCATTGG + Intronic
951170909 3:19540730-19540752 TCTGGCTTCCAGTACCCCAAAGG + Intergenic
956810287 3:72857848-72857870 CCAAATTTTCAGTACTCCAGCGG - Intronic
957386641 3:79503970-79503992 CCTGGTTGACAGAACTCCCAAGG + Intronic
957769468 3:84671425-84671447 CCTGGTGTTCAGTTCTGCCATGG - Intergenic
963795423 3:149626641-149626663 CCTTTTTTTCCATACTCCAAGGG + Intronic
966030726 3:175344293-175344315 CCTGGAATTCAGTAGTGCAAAGG + Intronic
966035457 3:175407867-175407889 CCTAGTTTTTAGTACTCTAATGG + Intronic
970273754 4:14375049-14375071 CTTTGTTTTCTGTCCTCCAAAGG + Intergenic
970930472 4:21505653-21505675 CCTGACTTTCAGCACTCAAAAGG + Intronic
971620561 4:28849502-28849524 CCTGGGTTTCTGTGCTCTAAAGG + Intergenic
978294123 4:107183290-107183312 GCTGGTCTTCAGGAGTCCAAAGG + Intronic
992472335 5:77070326-77070348 CCTGGCTCTCAGTACTCTATGGG + Intergenic
995311832 5:110721999-110722021 CCTGGAATTCAGCACTCTAATGG - Intronic
997615099 5:135240741-135240763 CCTGGCTTTCAGTGCCCCCATGG + Intronic
998782310 5:145671336-145671358 CCTGGATTTCAGTACTCTATTGG - Intronic
1002069073 5:176668145-176668167 CCTTGATTTCTGTTCTCCAAAGG + Intergenic
1004814518 6:19298303-19298325 CCTGCATTTCAGAACCCCAAGGG + Intergenic
1006210976 6:32394583-32394605 GCTGGTTTTCAGGACACCCAGGG - Intronic
1006810565 6:36817843-36817865 CCTGGTTTCTAGAACCCCAAGGG - Intronic
1007511593 6:42378557-42378579 CATGGATTTCAGTACTAGAAGGG + Intronic
1008265731 6:49423608-49423630 CCTGTTTTTCAGGACTTCAGGGG + Intergenic
1009890826 6:69679486-69679508 AATGGATTTGAGTACTCCAATGG - Intronic
1010253441 6:73732034-73732056 CCTGGTTTTCTGTATTTAAACGG + Intronic
1010364371 6:75032154-75032176 CGTGGTTTTCAGTACCCCTCAGG - Intergenic
1014155469 6:118104206-118104228 CCTGTATTTAAATACTCCAATGG + Intronic
1015381090 6:132570233-132570255 CCTGATTTTCAGTGCTCCTGCGG - Intergenic
1019228315 6:170534020-170534042 CCTTATTTTCAGGACTTCAAGGG + Intergenic
1020423414 7:8035905-8035927 CCTGCTCTTCAATACTCCAATGG - Intronic
1022952992 7:35356134-35356156 CCTGGCTTTCTGCCCTCCAAGGG + Intergenic
1024192259 7:47024512-47024534 CCTGATTTTCAGGATACCAAGGG - Intergenic
1024535425 7:50427018-50427040 CCTGGATTTCAGAACTGTAATGG - Intergenic
1027878573 7:83802520-83802542 TCTGGTTGACATTACTCCAAAGG - Intergenic
1028952357 7:96650868-96650890 TCTGGTTTTCAGTTTGCCAATGG + Intronic
1031083782 7:117282597-117282619 GCTGGTATACAGTACTCAAAGGG + Intronic
1031321443 7:120334672-120334694 CATGGTTTTCAGTAGTGCCAAGG + Intronic
1031438867 7:121767552-121767574 CCTGTTTTTCTGCACACCAACGG + Intergenic
1032555894 7:132834768-132834790 CCTGGTTGACAGGACTCCATGGG - Intronic
1034316411 7:150137255-150137277 GCTGGTATTTAGTACTCCTAGGG - Intergenic
1047424730 8:124734803-124734825 CCTTGGTTTCAATAATCCAAGGG + Intergenic
1047710185 8:127543797-127543819 CCTGGGTCTTAGTGCTCCAAGGG - Intergenic
1049447839 8:142639577-142639599 CTTGGTTTTCAATACTCAAACGG + Intergenic
1056499480 9:87194164-87194186 GCTGGTTTTTAGCATTCCAAAGG - Intergenic
1057852799 9:98578168-98578190 TCTGGGTTTCAGTTCTCCCATGG + Intronic
1188253240 X:27926177-27926199 CCTGGTTTACAGTCTTACAAAGG - Intergenic
1193786272 X:85763048-85763070 ACTGGTTATAAGTACTACAATGG - Intergenic
1195070429 X:101273751-101273773 CCTGGCTTTAAATACTCCAAAGG + Intronic
1195319098 X:103706900-103706922 CCTGTTTTCCAATACTCCAGTGG - Intergenic
1196678867 X:118450400-118450422 CCTGGTTTTTAGAAAGCCAATGG - Intergenic
1197218717 X:123891118-123891140 CTTGCTTTTCAGTACTTCTAAGG - Intronic
1198959366 X:142168157-142168179 CCTGGTTTGCAGTATGCCACAGG - Intergenic
1198962741 X:142200146-142200168 CCTGGTTTGCAGTGCGCCACAGG - Intergenic
1200139586 X:153892715-153892737 CCTGGTTTTCAGTAGCTCTAGGG + Intronic
1200325545 X:155234445-155234467 CCTGGTTTTCAGAAATACCAAGG + Intronic
1201897798 Y:19011964-19011986 CCTGGTTTTCCTTACCCCCAGGG + Intergenic