ID: 1172022647

View in Genome Browser
Species Human (GRCh38)
Location 20:31925242-31925264
Sequence GAGGGCAAATCTAGACTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172022647_1172022652 2 Left 1172022647 20:31925242-31925264 CCCCAAAGTCTAGATTTGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1172022652 20:31925267-31925289 TCTGCCCTTCTTTATTCATTCGG 0: 1
1: 0
2: 0
3: 27
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172022647 Original CRISPR GAGGGCAAATCTAGACTTTG GGG (reversed) Intronic
901089620 1:6632652-6632674 GTGGGCACATCTGGATTTTGGGG + Intronic
907345293 1:53772958-53772980 AAGGGCAAGTCTGGATTTTGGGG - Intronic
910986368 1:93008602-93008624 GAGGGCAATTTTAGAATTTAGGG - Intergenic
911544280 1:99197898-99197920 GAAGGCTAATTTAGATTTTGCGG + Intergenic
920681854 1:208079171-208079193 GAGTGCAAATTGAGACTCTGTGG - Intronic
921627654 1:217395567-217395589 GAGGGCACAGCCAGACTTCGTGG - Intergenic
921899472 1:220435250-220435272 GAGGTCACATCTAGACTTGATGG + Intergenic
922746035 1:228044585-228044607 AAGGCCAAATATAGCCTTTGAGG - Intronic
1065115950 10:22482471-22482493 GAGACCAAATCTAGACTGTCAGG + Intergenic
1065188475 10:23191439-23191461 GAGAGCAAATCTAGACCCTAGGG - Intergenic
1066578237 10:36850125-36850147 GAAGACAAATCTGGTCTTTGGGG + Intergenic
1070748245 10:78948120-78948142 GGGGGCACATCCAGATTTTGTGG + Intergenic
1071835980 10:89417336-89417358 AAGAGCAAGTCTAGATTTTGTGG - Exonic
1072010131 10:91295729-91295751 GAGTGGAATTCTAGAGTTTGGGG + Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1074306952 10:112287901-112287923 AGGGGCAGATCTAGATTTTGTGG - Intronic
1075451851 10:122557228-122557250 GAGGGTAAAATTAGAGTTTGGGG + Intergenic
1080427399 11:32168771-32168793 GGAGGCAAATCCAGACTGTGAGG + Intergenic
1082177849 11:49082377-49082399 GAAGGCAAAGCAAGAATTTGAGG + Intergenic
1083888311 11:65583508-65583530 GAGGGCAAATCTGGGGCTTGGGG + Exonic
1086044058 11:82511865-82511887 GAGGGCTAATTTAGATGTTGGGG - Intergenic
1087163673 11:94976193-94976215 AAGGGCCAAACTAGATTTTGTGG - Intronic
1088709342 11:112493080-112493102 CAGGGAAAATATAGAATTTGGGG - Intergenic
1091811696 12:3404921-3404943 GAGGGAAAAAATAGACTTTCAGG - Intronic
1096026418 12:48367684-48367706 GATGCTAAATGTAGACTTTGTGG - Intergenic
1101058585 12:100946861-100946883 GAAGGAAAATCTAGAGTGTGTGG + Intronic
1101809591 12:108096087-108096109 GCAGGAAAATCTAGCCTTTGGGG + Intergenic
1102195774 12:111024248-111024270 GAGCCCAAAGCTAGACTTGGGGG - Intergenic
1103158389 12:118707347-118707369 GAGGGCTAATGCAGAGTTTGGGG + Intergenic
1106065720 13:26346604-26346626 CAGGGAAAGTCTAGACTTTGTGG - Intronic
1106148931 13:27079313-27079335 GAGGTGAAATTTAGACTCTGGGG - Intronic
1107471669 13:40696900-40696922 AAGGGCAAATGTAGAGTGTGAGG - Intergenic
1108063045 13:46552490-46552512 GAGGGCAACCCTAGATTCTGAGG + Intergenic
1111137869 13:84073535-84073557 GAGAGCAAAGCCAGACTGTGAGG + Intergenic
1111589595 13:90326715-90326737 TAGGGCAGATCTGGAGTTTGGGG - Intergenic
1115496410 14:34009083-34009105 GTGGGCAAATCGGGAGTTTGAGG - Intronic
1122112099 14:99510227-99510249 GAGGGGGAATCTGGACTTTGGGG - Exonic
1123715507 15:23027210-23027232 GAGTGCAAATGTAAACTATGAGG + Exonic
1126224755 15:46258166-46258188 GAGGGCAACAATAGACATTGGGG - Intergenic
1127121924 15:55779445-55779467 AAGGGCACATCCATACTTTGTGG - Intergenic
1141225240 16:82108815-82108837 GAGGCCATATCTAGGCTTGGTGG - Intergenic
1141373061 16:83505121-83505143 AAGTCCAAATCTAGAATTTGAGG - Intronic
1143833130 17:9668762-9668784 GAGAGGAAACCTAGATTTTGTGG + Intronic
1144391013 17:14793405-14793427 GAAGGGAATTCCAGACTTTGAGG - Intergenic
1146910142 17:36643035-36643057 GAGGGCAAAGCTAGAGTCTGCGG - Intergenic
1147043133 17:37733105-37733127 GAGGCCAGATCTAGAGTCTGTGG + Intronic
1151069199 17:71188921-71188943 GAGGGCAAATCTAGCCTGTGCGG - Intergenic
1151952858 17:77364738-77364760 GAGGGCAAATCCAGAGTATGAGG - Intronic
1156686593 18:39655852-39655874 GAGGCCAAAGTTAAACTTTGTGG - Intergenic
1157373684 18:47142603-47142625 GAGGGCAAAAGTGGGCTTTGAGG + Intronic
1160058131 18:75505511-75505533 GAGCTAAAATCTAGGCTTTGAGG - Intergenic
926212914 2:10884523-10884545 GAGAGAAAATCTTGAGTTTGGGG - Intergenic
926266191 2:11323852-11323874 GACGGTAACTATAGACTTTGGGG - Intronic
931266032 2:60661119-60661141 GGGGGCAGATCTAGATTTGGGGG - Intergenic
931877323 2:66528211-66528233 GAGGCCAAAGATAGAATTTGGGG + Intronic
935512527 2:103994028-103994050 GAGGGCAGAACCAAACTTTGGGG - Intergenic
937454992 2:122033432-122033454 AAGGGCAAATCTGGGCTCTGGGG + Intergenic
940123179 2:150291660-150291682 AAGGGCAAATCTAGGGTTTTTGG + Intergenic
940576845 2:155518933-155518955 GATGGCAAATCTACACTTCAAGG + Intergenic
941637186 2:167947296-167947318 AAGGGCAAATCCAGGTTTTGTGG - Intergenic
942135292 2:172919330-172919352 GGGGCAAAATCCAGACTTTGAGG - Intronic
947092977 2:226533838-226533860 CAGGGTAAATCTACATTTTGTGG + Intergenic
947583691 2:231338080-231338102 AAGGGCAGATTTAGGCTTTGTGG + Intronic
948630197 2:239297477-239297499 GAGGTCAAGTCCAGACTCTGCGG + Intronic
1168831314 20:846656-846678 GAGGGCAAATCCTGAACTTGAGG + Intronic
1170277829 20:14612402-14612424 TAGGACAACTGTAGACTTTGTGG + Intronic
1171015882 20:21541486-21541508 GAGTAGAAATCTGGACTTTGAGG - Intergenic
1172022647 20:31925242-31925264 GAGGGCAAATCTAGACTTTGGGG - Intronic
1173673303 20:44812582-44812604 GGGACCAGATCTAGACTTTGAGG + Intergenic
1173878647 20:46393833-46393855 TAGGGCAATGCTAGACTTTAAGG + Intronic
1174638280 20:52020678-52020700 CAGGACAGATCTAGATTTTGTGG - Intergenic
1175370875 20:58489793-58489815 GACGGCAGATCTAGGTTTTGTGG + Intronic
1175857711 20:62131579-62131601 GAGGGCAGAGCTGGACTCTGAGG + Intronic
1178754731 21:35337647-35337669 GATGGCAAAACTAGAATGTGTGG + Intronic
1179784417 21:43721288-43721310 AAGAGCAGCTCTAGACTTTGGGG - Intronic
1183599372 22:38831091-38831113 GAGGGGAAACCAAGGCTTTGTGG - Intronic
951938058 3:28044539-28044561 GATGGCAAAAATAGACATTGGGG - Intergenic
952858262 3:37791164-37791186 CAAGGCAAATCAAGACTTTATGG + Intronic
953311357 3:41882996-41883018 AAGGAAAAATTTAGACTTTGTGG + Intronic
954157254 3:48692918-48692940 GAGGGCAACTCTGGGCTATGTGG - Intronic
956173662 3:66453488-66453510 GAGGAAAAACCTAGACTTTGGGG - Intronic
960065106 3:113363211-113363233 GAGAGCAAATCAAAGCTTTGAGG - Exonic
965099755 3:164280021-164280043 AAGGGCAAATCTAGAGTTATTGG + Intergenic
966929660 3:184667874-184667896 CCTGGCAAATCTAGGCTTTGAGG + Intronic
971882338 4:32393273-32393295 GAGGTCAAATGTAGACCATGAGG + Intergenic
979345326 4:119580042-119580064 CAGGGCAAATCCAGCCTCTGGGG + Intronic
982274261 4:153623150-153623172 GAAGGCAGATCGAGACTGTGTGG - Intronic
982514822 4:156331940-156331962 TATGGCAAATCTAGTCTATGAGG + Intergenic
983481808 4:168284057-168284079 TAAGGCATATCTTGACTTTGGGG - Intronic
983874245 4:172857814-172857836 TAAAGCAAATCTTGACTTTGAGG + Intronic
986588902 5:9348169-9348191 GAAGGCAACTCTAGCCTGTGAGG - Intronic
986969571 5:13316180-13316202 GAGGGAAAATCCTGACTTTATGG - Intergenic
987417963 5:17684260-17684282 GAGAGCAAATCCAGGTTTTGTGG + Intergenic
989604542 5:43231387-43231409 GAGGGCTAATGAAGAATTTGTGG + Intronic
992279295 5:75157274-75157296 CAGGACAAATCTAGGCTTTCTGG - Intronic
995757795 5:115528299-115528321 GAGGTCAAGTCCAGAATTTGAGG + Intronic
997123957 5:131206948-131206970 GATAGCAACTCTAAACTTTGAGG - Intergenic
997260565 5:132462930-132462952 GAGGGCAGATCTGCTCTTTGGGG - Exonic
998080152 5:139268488-139268510 GAGGGCCAATTTGGACATTGTGG + Intronic
1000787460 5:165563535-165563557 GAGGTCAAATGTAATCTTTGTGG + Intergenic
1004464956 6:15876179-15876201 GAGGGAAAATCTGGAGTTTGAGG + Intergenic
1006466183 6:34196256-34196278 GAGGGAAAACCAAGGCTTTGAGG - Intergenic
1006823455 6:36916697-36916719 GAGGGGAGAACTAGACTGTGTGG - Intronic
1011130035 6:84043280-84043302 GAGGCCAAGTCTAGTCTTTGGGG + Intronic
1011415175 6:87111328-87111350 AAGAGCAAATCAATACTTTGAGG - Intergenic
1013172426 6:107648705-107648727 GAGGGGGAAACTTGACTTTGGGG + Intronic
1014755393 6:125297082-125297104 AAGGGTAAATCTGGACATTGTGG - Intronic
1020528243 7:9293148-9293170 GAGGGTACTTCTAGACCTTGGGG + Intergenic
1021239478 7:18182651-18182673 GACGGGAAATTGAGACTTTGAGG + Intronic
1021446308 7:20737217-20737239 GAGGGGAAGTGTGGACTTTGAGG - Intronic
1027237743 7:76307855-76307877 GAGGGCATATCAAGACATGGGGG + Intergenic
1027927212 7:84481210-84481232 GAGGGCAAATCTAAATCTTCAGG + Intronic
1031956038 7:127943612-127943634 GAGGGCAAGTCTAGATCTCGTGG + Intronic
1032377606 7:131437834-131437856 GGAGGCAAATCTACACATTGGGG + Exonic
1033100816 7:138469984-138470006 GAGGGGAAATGTAGACTTACAGG - Intronic
1033486058 7:141790257-141790279 GAGGCCAAATCCAGATTTTGTGG + Exonic
1034636959 7:152575287-152575309 GAGGGGAAGTCCAGACTCTGGGG - Intergenic
1042218582 8:66451485-66451507 GAGTGAGAATATAGACTTTGGGG - Intronic
1042816766 8:72886654-72886676 GAGGCCAGCTCTAGGCTTTGTGG - Intronic
1047844339 8:128789665-128789687 GAGGAAAAATCAGGACTTTGTGG - Intergenic
1049990883 9:990490-990512 GAGGGCAACGCTAGACTCTCAGG - Exonic
1050336390 9:4594019-4594041 AAGGGCAGCTGTAGACTTTGTGG - Intronic
1050362351 9:4842497-4842519 GTGGGCAAAGCTGGACTTTCTGG + Intronic
1050375586 9:4969570-4969592 TCGGGCTAATCTAAACTTTGAGG - Intergenic
1050875064 9:10623669-10623691 GAGGGAAAATCTAGGGTTGGAGG - Intergenic
1057470670 9:95353551-95353573 GAGGGGAAATGTAAACTCTGAGG - Intergenic
1057936037 9:99239696-99239718 GTGGGAAAATCAAGAGTTTGTGG - Intergenic
1060134620 9:121140804-121140826 GAGGCCCACTCTAGACTTGGAGG - Intronic
1186489210 X:9958456-9958478 GAGGGCCAATCTGAACTTGGAGG - Intergenic
1188103558 X:26120743-26120765 CAAGGCAAATCCAGATTTTGGGG - Intergenic
1192200074 X:69061038-69061060 GAGGCCACATCTGGACTGTGGGG + Intergenic
1194090878 X:89581092-89581114 GAAGGCAAATGCAGACTTTAGGG - Intergenic