ID: 1172022647

View in Genome Browser
Species Human (GRCh38)
Location 20:31925242-31925264
Sequence GAGGGCAAATCTAGACTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172022647_1172022652 2 Left 1172022647 20:31925242-31925264 CCCCAAAGTCTAGATTTGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1172022652 20:31925267-31925289 TCTGCCCTTCTTTATTCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172022647 Original CRISPR GAGGGCAAATCTAGACTTTG GGG (reversed) Intronic