ID: 1172023096

View in Genome Browser
Species Human (GRCh38)
Location 20:31929116-31929138
Sequence GGATTCAAACTGTTGAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172023096_1172023104 13 Left 1172023096 20:31929116-31929138 CCTTGATTCAACAGTTTGAATCC 0: 1
1: 2
2: 1
3: 8
4: 143
Right 1172023104 20:31929152-31929174 TTCCAAGGTGCTGGGATTACAGG 0: 116
1: 12778
2: 308301
3: 323692
4: 301561
1172023096_1172023103 5 Left 1172023096 20:31929116-31929138 CCTTGATTCAACAGTTTGAATCC 0: 1
1: 2
2: 1
3: 8
4: 143
Right 1172023103 20:31929144-31929166 CCTTGATCTTCCAAGGTGCTGGG 0: 1
1: 11
2: 603
3: 11627
4: 114261
1172023096_1172023101 4 Left 1172023096 20:31929116-31929138 CCTTGATTCAACAGTTTGAATCC 0: 1
1: 2
2: 1
3: 8
4: 143
Right 1172023101 20:31929143-31929165 ACCTTGATCTTCCAAGGTGCTGG 0: 1
1: 3
2: 222
3: 4275
4: 45414
1172023096_1172023098 -2 Left 1172023096 20:31929116-31929138 CCTTGATTCAACAGTTTGAATCC 0: 1
1: 2
2: 1
3: 8
4: 143
Right 1172023098 20:31929137-31929159 CCTCCCACCTTGATCTTCCAAGG 0: 1
1: 2
2: 25
3: 206
4: 969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172023096 Original CRISPR GGATTCAAACTGTTGAATCA AGG (reversed) Intronic
900867814 1:5280942-5280964 GAATTCAAACTGTGAAAACAGGG + Intergenic
903600623 1:24536112-24536134 GGATAAAAACTGGTGAATGAAGG - Exonic
904084940 1:27899556-27899578 GGATTCAAAATGTTGTATATGGG - Intronic
904870040 1:33611040-33611062 GGATTCAAGCTGGAGTATCAGGG - Exonic
905415914 1:37804113-37804135 GGATTCAAAAGGTTTCATCAAGG - Intronic
905650325 1:39652222-39652244 GGATGCAAACTGGAGATTCAAGG + Intergenic
909999206 1:82321907-82321929 GGATCCAGACTAATGAATCATGG - Intergenic
910165889 1:84327061-84327083 GGAGTAAAACTGCTGCATCAAGG - Intronic
912071148 1:105811161-105811183 GGATGCAAACTGTTGATCCTGGG - Intergenic
912165184 1:107035151-107035173 GTATGTAAACTGTTCAATCAAGG - Intergenic
915438998 1:155932436-155932458 GGTTTCAAACTGTGGATTCTGGG + Intronic
916465919 1:165074538-165074560 GGCTTCAAACTGGTGAATGGTGG + Intergenic
916661528 1:166926292-166926314 GGATTCCAACTTATGTATCATGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
1066312614 10:34212465-34212487 GTATTCAGACTTTTGAATGATGG - Intronic
1066600093 10:37095245-37095267 TGATTTACGCTGTTGAATCAGGG - Intergenic
1066788429 10:39033187-39033209 GTTTCCAAACTGCTGAATCAAGG + Intergenic
1069449808 10:68507728-68507750 GAATTTAAATTGTTGAATAATGG - Intronic
1071169521 10:82848271-82848293 GGAATCCAACTCTTGCATCAAGG + Intronic
1071378686 10:85035784-85035806 GGATACAAACTATTGATTCTGGG + Intergenic
1071670277 10:87602745-87602767 GGATGCAAAGTGTTGATTCTAGG + Intergenic
1075578216 10:123596381-123596403 GGTTTCAAATAGTTGGATCAGGG - Intergenic
1079210214 11:18454643-18454665 GGATGCAAAGTGTTGAACCTGGG - Intergenic
1079771471 11:24465196-24465218 GGCTTCAAACTATTAAATCAGGG + Intergenic
1079853907 11:25575614-25575636 GGATGTAATCTGTTGAACCAGGG + Intergenic
1082836317 11:57653247-57653269 GGATTCTAAATATTTAATCAGGG + Intronic
1085262267 11:75213643-75213665 GGAGACAAACTCTTGATTCAGGG - Intergenic
1085890292 11:80571629-80571651 TGATTTATGCTGTTGAATCAGGG + Intergenic
1088498694 11:110459710-110459732 GGACTCAAAGTGTGAAATCAGGG + Intronic
1091505550 12:1064087-1064109 ATATTCAAACTGCTGAATGAAGG - Intronic
1092684302 12:11024563-11024585 GGATACAAAATGTTGATTCCAGG - Intronic
1095077452 12:37948602-37948624 GGTTCCAAACTGCTCAATCAAGG + Intergenic
1096209988 12:49757640-49757662 GGATTAAAATTTTTGCATCAGGG + Intronic
1101352690 12:103946929-103946951 GGATACAAACCTTTGCATCAGGG - Exonic
1101410002 12:104459354-104459376 GGGTTCAAACAGTTTAAACAAGG + Intronic
1103881739 12:124171621-124171643 GGATTGAAATTGTTGCATAAGGG + Intronic
1104156795 12:126141234-126141256 GGATGCAAAATGTTGAGTCCAGG - Intergenic
1107817923 13:44260800-44260822 AGATTCAAACAGTTGAAATAGGG - Intergenic
1108034838 13:46279466-46279488 GGACTCAAACTGTGTCATCAAGG + Intergenic
1108246490 13:48519907-48519929 GGATTCAGATTTTTGAATTAGGG - Intronic
1109458883 13:62627708-62627730 GGATACAAACTGGTGAATGTCGG - Intergenic
1109797663 13:67337922-67337944 GGATGCAAAGTGTTGATTCTGGG + Intergenic
1117878864 14:60286989-60287011 TGGTTCAAACTATTGATTCATGG + Intronic
1118061087 14:62138320-62138342 GTATTCATACTGTTGCCTCATGG + Intergenic
1118183895 14:63521092-63521114 GTATTCATACTCTTGAATTATGG - Intronic
1118704750 14:68470543-68470565 GTTTTCAAAGTCTTGAATCAAGG - Intronic
1119615364 14:76095447-76095469 GGTTGCAAACTGTTGGCTCACGG + Intergenic
1120520319 14:85519848-85519870 GTATTCAAACAGTTCAAACATGG - Intergenic
1124786116 15:32682198-32682220 TGATTCAATAGGTTGAATCAGGG - Intronic
1125704547 15:41721828-41721850 GGAGTCAAACTGCTAGATCAAGG - Intronic
1127697538 15:61465771-61465793 GGATTCAAACAGTGAAATCCTGG - Intergenic
1135203517 16:20461428-20461450 GGATTCAGAATGGTGAGTCATGG - Intronic
1135215486 16:20563508-20563530 GGATTCAGAATGGTGAGTCATGG + Intronic
1136739195 16:32498678-32498700 GTTTCCAAACTGGTGAATCAAGG - Intergenic
1137708838 16:50552717-50552739 GGATTATAACTGTTGAACCTGGG + Intronic
1138272932 16:55709275-55709297 GGATTCACACTGTGGAGTGATGG - Intergenic
1139314669 16:66058043-66058065 GGAATCAAAGGGTTGAAACATGG - Intergenic
1139621352 16:68146093-68146115 GAATTCAAATTTTTGAATCAGGG - Intronic
1140444845 16:75017734-75017756 GGATCCAATCTGTTGAAAGAAGG + Intronic
1203014018 16_KI270728v1_random:333114-333136 GTTTCCAAACTGGTGAATCAAGG + Intergenic
1203032353 16_KI270728v1_random:606273-606295 GTTTCCAAACTGGTGAATCAAGG + Intergenic
1149043402 17:52217370-52217392 AGATTCAAACATTTGAATCTAGG + Intergenic
1149085056 17:52706814-52706836 GGATTTAAAGTGTTCAGTCATGG - Intergenic
1154075774 18:11199955-11199977 GGATTCAAAGTGTGGACTCAGGG - Intergenic
1156173085 18:34509878-34509900 GGATTCAAATTGTATAACCATGG - Intronic
1158205340 18:54986472-54986494 GAATTTAAACTGTGGGATCAGGG - Intergenic
1158352807 18:56580517-56580539 AGATTCCAACAGTTAAATCAGGG + Intergenic
1166045412 19:40226903-40226925 GATTTCAAAATGTAGAATCAGGG + Intergenic
1166638762 19:44475121-44475143 GGATTCAAATTCATGATTCAAGG + Intergenic
928846549 2:35680640-35680662 TGATTCAAGCTGTTCTATCAAGG - Intergenic
935058385 2:99587513-99587535 GAATTCAAAATGTTGAATCATGG - Intronic
937520531 2:122708178-122708200 GGAATCAAACTGGTAAATCATGG + Intergenic
938005287 2:127785056-127785078 GGAGGCAACCTGTTGATTCAAGG - Intronic
938151404 2:128888351-128888373 GGATGCAAAGTGTTGATTCTGGG + Intergenic
940773719 2:157865425-157865447 GGATTGGAATTGCTGAATCAAGG - Intronic
944526570 2:200625938-200625960 CGATCAAAACTCTTGAATCAAGG + Intronic
944924049 2:204444958-204444980 AGATTCCAACTGTTAAATGAAGG + Intergenic
944924370 2:204449097-204449119 GGACTCCAACTGTTAAATGAAGG - Intergenic
945952229 2:216050271-216050293 GGATTCAAACTGTTGAATTATGG + Intronic
947832114 2:233148775-233148797 GGATGCAAACTGTTGTGTGAAGG - Intronic
1170859390 20:20088675-20088697 AGATTCAACCTGTGGAGTCATGG + Intronic
1171205081 20:23272810-23272832 GGATTCTTACTTTTGTATCAGGG - Intergenic
1172023096 20:31929116-31929138 GGATTCAAACTGTTGAATCAAGG - Intronic
1175102869 20:56592340-56592362 GAGTTCAAACTGCTGAGTCATGG - Intergenic
1175133816 20:56808465-56808487 GGATTAAAATAGTTAAATCAAGG + Intergenic
949953815 3:9251239-9251261 GAAGTCCAACTGGTGAATCATGG + Intronic
951985391 3:28614134-28614156 GGCCTCATACTTTTGAATCATGG + Intergenic
951992791 3:28694465-28694487 GGATTCAAACTATAGAAAGAAGG + Intergenic
956298635 3:67743561-67743583 GAATTCAAACTTTACAATCAAGG + Intergenic
956763834 3:72467146-72467168 GGATTCACACTGAGGAAACAGGG + Intergenic
957636966 3:82798846-82798868 ATATTCAAGGTGTTGAATCATGG - Intergenic
959685370 3:109140355-109140377 GGATTCAATCTGTGAAATGAGGG - Intergenic
962061273 3:131930165-131930187 GCATTCATCCTGTTGAGTCAAGG + Intronic
970089638 4:12389902-12389924 GGATACAAAGTGTTGATTGAAGG - Intergenic
973295430 4:48514659-48514681 AGATTCAAATTGTGGTATCACGG + Intronic
974575011 4:63707191-63707213 GAAATCAAGCTGTTGCATCAGGG + Intergenic
975399216 4:73915155-73915177 AGATCCAAACTGTTGAATATTGG - Intergenic
978951186 4:114561566-114561588 GGATACAAACTGCTGAATGTCGG - Intergenic
979476622 4:121165784-121165806 GGAATCAAATTGTTCATTCAGGG + Intronic
979795780 4:124844609-124844631 GGATTCTTACTGTTGTCTCATGG + Intergenic
980310374 4:131121343-131121365 GGATTTAAACTGTTGCATTTTGG - Intergenic
982869953 4:160566513-160566535 TAATTGAAACTGTTGAATAAAGG + Intergenic
983027700 4:162757679-162757701 GGATACAAAGTGTTGATTCTGGG + Intergenic
988226064 5:28412535-28412557 GGATGCAAACTGTTGATCCTGGG + Intergenic
990611853 5:57465576-57465598 AGATTCAAAATGTTGTTTCAGGG - Intergenic
991080223 5:62590269-62590291 GGATTAAAACTAATAAATCAGGG + Intronic
993632836 5:90308145-90308167 GGCTGCTAACTGTTGAAACAGGG - Intergenic
995889478 5:116934792-116934814 GCACTCAAATTGTTGACTCAAGG - Intergenic
996364578 5:122687408-122687430 TCATTCAACATGTTGAATCAGGG + Intergenic
996375817 5:122805673-122805695 CAATCCAAAGTGTTGAATCAGGG + Intronic
999625368 5:153515082-153515104 TGATTCAACCAATTGAATCATGG + Intronic
1000484286 5:161820658-161820680 TGATACTAACTGTTGAAGCAAGG - Intergenic
1005676310 6:28159007-28159029 AGTTTGAATCTGTTGAATCAAGG - Exonic
1008718426 6:54318425-54318447 GGATTGAATCTGGTGAATGAGGG - Intronic
1010499327 6:76576906-76576928 GGAGTCAAAATGTTGTATTAAGG + Intergenic
1010752993 6:79635584-79635606 AGATGCAAACTGTTTAATCAAGG + Intronic
1011211554 6:84960907-84960929 GCATTCAATCTGTTGCATTACGG + Intergenic
1013672261 6:112417512-112417534 GTCTTCAAAAAGTTGAATCAAGG - Intergenic
1016559641 6:145380925-145380947 GGAATGAAAATGTTGGATCATGG - Intergenic
1017768174 6:157623916-157623938 GGACCCAAACTTTAGAATCAAGG + Intronic
1019948689 7:4351691-4351713 GTATTAAAACTGTAGAATAAGGG - Intergenic
1020902170 7:14018284-14018306 GGATTCTGAATGTTTAATCATGG + Intergenic
1022968247 7:35494176-35494198 GGATTCAAACTGTTGAGTCAGGG - Intergenic
1022980364 7:35599897-35599919 GGATTAAAACTGATGGGTCATGG + Intergenic
1024627208 7:51218121-51218143 GGATTGGAACTGTTGAGTCATGG - Intronic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1029225147 7:99021037-99021059 CAATTGAAACTGTTGAATCTGGG + Intergenic
1030797033 7:113801926-113801948 AGATACAAACTTCTGAATCATGG + Intergenic
1032280982 7:130501089-130501111 TGCTTCAAAGTATTGAATCATGG + Intronic
1033215355 7:139489525-139489547 AAATGCTAACTGTTGAATCAAGG - Intergenic
1034368603 7:150573839-150573861 GTATTCAAAGTGTTGAGTGAGGG - Exonic
1034868362 7:154660015-154660037 GGATGCAAACTTTTGATTCCTGG + Intronic
1036222381 8:6931505-6931527 GGAGTGAAAATGTTGACTCAGGG + Intergenic
1036440057 8:8773976-8773998 GTGTTCAAACTGTTGAAATAAGG - Intergenic
1038163926 8:25066753-25066775 GGATTTTAACTGTTGTACCATGG + Intergenic
1039412339 8:37365495-37365517 AGAATCAAACTGTTGGACCAGGG + Intergenic
1040126369 8:43742198-43742220 GGTTCCAACCTGCTGAATCAGGG - Intergenic
1040343020 8:46453232-46453254 TGATTCCACCTGCTGAATCAAGG + Intergenic
1043933878 8:86121020-86121042 TGATTTAAAATGTTTAATCAGGG + Intronic
1045767315 8:105689600-105689622 AGTTGAAAACTGTTGAATCAGGG + Intronic
1046132451 8:109983444-109983466 GTATTCAAACTGTTGCAACCTGG + Intergenic
1047793054 8:128224992-128225014 GGATTTAGACAGGTGAATCAAGG - Intergenic
1055786090 9:79870254-79870276 GGATGCAAACTATTGATTCTGGG + Intergenic
1059055467 9:110974529-110974551 TGATTGAAACTGTAGTATCAAGG - Intronic
1059943497 9:119381723-119381745 GGAGTCACACTGTTGAATAGGGG - Intergenic
1060614651 9:125001435-125001457 GGATTCAATCTGTAGAATATCGG - Intronic
1187660328 X:21539017-21539039 GGATTCAAAGTGTTGTTTCAAGG - Intronic
1188651287 X:32634274-32634296 GGAGCCAAACTCTGGAATCAGGG + Intronic
1189412930 X:40789976-40789998 GCATTCAAATTCTTGATTCAGGG - Intergenic
1191272654 X:58496588-58496610 GTATCCAAACTGCTCAATCAAGG - Intergenic
1193918926 X:87401620-87401642 GGAATCAAAATGTTTGATCATGG + Intergenic
1194188779 X:90808528-90808550 GGATTCAAACTCTTTCCTCAGGG + Intergenic
1199008773 X:142733489-142733511 GCATTCAAATTGTTGAATGAGGG - Intergenic
1199737265 X:150695752-150695774 AGATTCAAACTGGGGAGTCATGG + Intronic
1200535361 Y:4390425-4390447 GGATTCAAACTCTTTCCTCAGGG + Intergenic