ID: 1172023841

View in Genome Browser
Species Human (GRCh38)
Location 20:31934687-31934709
Sequence CAGCGTCCACTTGCAGCCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172023841_1172023847 13 Left 1172023841 20:31934687-31934709 CCCAGGGCTGCAAGTGGACGCTG 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1172023847 20:31934723-31934745 AGTACCTGGCGTCCAAACACGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1172023841_1172023846 12 Left 1172023841 20:31934687-31934709 CCCAGGGCTGCAAGTGGACGCTG 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1172023846 20:31934722-31934744 CAGTACCTGGCGTCCAAACACGG 0: 1
1: 0
2: 1
3: 5
4: 56
1172023841_1172023851 26 Left 1172023841 20:31934687-31934709 CCCAGGGCTGCAAGTGGACGCTG 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1172023851 20:31934736-31934758 CAAACACGGGCCCGAGGCAGTGG 0: 1
1: 0
2: 0
3: 12
4: 156
1172023841_1172023844 -1 Left 1172023841 20:31934687-31934709 CCCAGGGCTGCAAGTGGACGCTG 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1172023844 20:31934709-31934731 GCAGCGCTTCCGGCAGTACCTGG 0: 1
1: 0
2: 0
3: 11
4: 98
1172023841_1172023849 20 Left 1172023841 20:31934687-31934709 CCCAGGGCTGCAAGTGGACGCTG 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1172023849 20:31934730-31934752 GGCGTCCAAACACGGGCCCGAGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172023841 Original CRISPR CAGCGTCCACTTGCAGCCCT GGG (reversed) Exonic
902681396 1:18046341-18046363 CACCCTCCACTTGCTGCCCCAGG + Intergenic
903101508 1:21034937-21034959 CAGGGTCCCCCTGCAGCCCCAGG - Intronic
904417559 1:30372609-30372631 CTGCTTCCACTTGCTGCCCCAGG + Intergenic
905183391 1:36179694-36179716 CAGCCTCCTTCTGCAGCCCTGGG - Exonic
906348401 1:45036084-45036106 CATCGTCCAGCTGCAGCTCTTGG + Exonic
906416998 1:45627906-45627928 CAGCTTCTACTACCAGCCCTTGG - Exonic
917967589 1:180188205-180188227 CAGTGTCCACTGGCACCCTTAGG - Intronic
922779864 1:228243348-228243370 CAGCCTCCGTCTGCAGCCCTTGG - Exonic
923183978 1:231551681-231551703 GAGCTACCACTTCCAGCCCTAGG - Intronic
924843006 1:247734273-247734295 CAGTGTCCATCTGCAGCCCGAGG + Intergenic
924953464 1:248906503-248906525 GAGCGCCCCCTTGCGGCCCTCGG - Intronic
1062973619 10:1666576-1666598 CAGCGTCCTCCTGCAGCCGAGGG + Intronic
1069853681 10:71426559-71426581 CAGCCCCCACTTGCCTCCCTGGG - Intronic
1070322080 10:75362071-75362093 CACTGTTCAGTTGCAGCCCTGGG - Intergenic
1070472934 10:76801792-76801814 CAGAGGCCACCTGCATCCCTTGG - Intergenic
1071400766 10:85267966-85267988 CAACATCCACTTGCAGCCCATGG - Intergenic
1071741413 10:88362690-88362712 CAGCCTCCAGTTGCTGCCTTTGG + Exonic
1072259067 10:93650043-93650065 CACTGTCCACTCCCAGCCCTAGG + Intronic
1075701112 10:124470010-124470032 CAGGGCCCACTTGCTGCTCTAGG + Intronic
1077021679 11:419833-419855 TGGTGTCCCCTTGCAGCCCTAGG + Intronic
1077228533 11:1448691-1448713 CTGGGTCCAGTTCCAGCCCTGGG + Intronic
1077794090 11:5472553-5472575 CAGCTACCTCTTGGAGCCCTTGG - Intronic
1081809716 11:45908005-45908027 CACCGTCCCCTCGCAGGCCTGGG + Intergenic
1083227733 11:61295205-61295227 CCGCGTCCCCTCGCGGCCCTCGG - Exonic
1083809561 11:65096121-65096143 AAACGTCCCCCTGCAGCCCTAGG - Intronic
1084978309 11:72815116-72815138 CAGCATCCACCAGCAGCCCGGGG - Intronic
1085023194 11:73221786-73221808 CAGCGGCCAGTTGCAGGACTAGG + Intronic
1088878759 11:113957460-113957482 CAGAGCTCACTTGCTGCCCTGGG + Intergenic
1089065520 11:115659443-115659465 CAGGGTCCACTTGCCGGCTTCGG + Intergenic
1089452920 11:118609801-118609823 TAGCGGCCCCTTGCACCCCTCGG - Intronic
1091327622 11:134703042-134703064 CAGCCTCCACCTGCCTCCCTGGG - Intergenic
1098385299 12:69912125-69912147 CACTGTGCTCTTGCAGCCCTGGG - Intronic
1100584016 12:95962503-95962525 CAGCTTGTACTTGCAGCTCTTGG - Intronic
1103579378 12:121903002-121903024 CATCATCCACTTGCAGACCCTGG - Exonic
1103686234 12:122734272-122734294 CAGCATCTTCTTGAAGCCCTGGG - Intergenic
1105986628 13:25573632-25573654 CCACGTCCACATGCAGCCCATGG - Intronic
1106409504 13:29501425-29501447 CAGGGTCCTCCTGCAGCACTGGG + Intronic
1106866699 13:33972335-33972357 CAACCTCCACTTCCAGCCCTGGG + Intergenic
1113380997 13:109806238-109806260 CAGCCTCCAGTTGTAGCCCTGGG + Intergenic
1113539255 13:111093687-111093709 CAGGGTCCACGTCCAGCCCCAGG + Intergenic
1117493205 14:56273305-56273327 CAGCTTCCATTTGCCGCTCTGGG - Intronic
1119382852 14:74239864-74239886 GAGCGTCCACTTGCAGCCATTGG + Exonic
1120634128 14:86930397-86930419 CAGTTTCCAGCTGCAGCCCTTGG - Intergenic
1121533963 14:94678285-94678307 CAGCATCCGTATGCAGCCCTAGG + Intergenic
1122232502 14:100313764-100313786 CAGCGTGGGCTTGCGGCCCTTGG + Intergenic
1122890959 14:104732043-104732065 TGGCGTCCACCTGCAGCCCAAGG + Intronic
1122998795 14:105280816-105280838 CAGCCTCCACCTGCACACCTGGG - Intronic
1125579254 15:40774083-40774105 CACCCTCCACCTGCACCCCTTGG - Intronic
1126786506 15:52181154-52181176 CAGCCTCCACTTGCTGTCCCGGG + Intronic
1128062740 15:64745589-64745611 CAGCGTCCTATTGCATCCCACGG - Intronic
1128082435 15:64864626-64864648 CAGGGTCCTCTTGGAGCCCCAGG - Intronic
1128244721 15:66125351-66125373 CAGAGTCCTCTTCCAGCTCTGGG + Intronic
1131453085 15:92562495-92562517 CAGTGTCTACTTGCTGCCCTGGG + Intergenic
1131974082 15:97924877-97924899 CAACTTCCACTTTCAGCCCATGG - Intergenic
1132746500 16:1438472-1438494 CACCATCCAGCTGCAGCCCTCGG + Intronic
1135170109 16:20176450-20176472 TAGCCTCCATCTGCAGCCCTGGG - Intergenic
1136290157 16:29266900-29266922 CAGCCTCCCCACGCAGCCCTGGG - Intergenic
1136540581 16:30925715-30925737 CACCATCCACCTACAGCCCTCGG + Exonic
1136983861 16:35082394-35082416 CTGAGTCCTCTTGCAGCCCCTGG - Intergenic
1137784386 16:51125941-51125963 CAGGGTCAGCTTCCAGCCCTTGG + Intergenic
1141530569 16:84643647-84643669 CATGGTCAGCTTGCAGCCCTGGG + Intergenic
1142096040 16:88240422-88240444 CAGCCTCCCCACGCAGCCCTGGG - Intergenic
1142144501 16:88487284-88487306 CACACTCCACTTGCAGCCCCAGG + Intronic
1142211673 16:88811480-88811502 CAGAGCCCACGTGCTGCCCTCGG + Intronic
1143608020 17:8002382-8002404 CAGCTTCCCCTTTCAGCCGTCGG - Intergenic
1143655421 17:8290944-8290966 CAGCGCCAACTTCCAGCTCTGGG + Exonic
1144499236 17:15770897-15770919 CATCATCCAATTGCAGCTCTTGG + Intergenic
1144738657 17:17568991-17569013 GAGAGTCCACTTGCTGCGCTGGG - Intronic
1145014198 17:19386307-19386329 CACCGTCCACTTCCCGCCCTCGG + Exonic
1145162626 17:20585930-20585952 CATCATCCAATTGCAGCTCTTGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148371005 17:47100015-47100037 CAGCTCCCACTTGCAGACCTGGG - Intergenic
1149592247 17:57839012-57839034 CAGCATCCACCTGCCTCCCTGGG - Exonic
1150343504 17:64387203-64387225 CAACGGACACTTCCAGCCCTCGG - Intronic
1151715020 17:75826938-75826960 CAGCCTCAACCTGCACCCCTGGG + Intergenic
1151761227 17:76104271-76104293 CAGCGTCCAACTGCAGCTCCAGG + Intronic
1152433915 17:80263785-80263807 CAGCCTCCACCAGCACCCCTGGG - Intronic
1153795039 18:8614019-8614041 AAGAATTCACTTGCAGCCCTTGG - Intronic
1158428641 18:57363107-57363129 CAGAGTCCACTTTCAGCTATTGG + Exonic
1159867547 18:73724151-73724173 AGGCGTCCACGTGCAGCCCAAGG + Intergenic
1160214092 18:76911596-76911618 CAACGTGCACTTGCTGCCCAGGG + Intronic
1160229732 18:77038315-77038337 CAGTGTGAACTGGCAGCCCTGGG + Intronic
1162846607 19:13397577-13397599 CGGCGCCCACTTGCAGAGCTGGG - Intronic
1163462643 19:17448273-17448295 CCGCGTCCTCTGGCAGCCCGGGG + Exonic
1166376839 19:42332270-42332292 CAGCATCAACTGCCAGCCCTGGG - Intronic
1167002363 19:46753591-46753613 CAGCTTCCACTTTCTCCCCTGGG + Intronic
927047670 2:19296286-19296308 GATTGTCCTCTTGCAGCCCTCGG - Intergenic
927826744 2:26314577-26314599 CAGGTTCCACTTGAAGCCCTGGG + Exonic
930560337 2:52952301-52952323 CAGCAACCAATTGCAACCCTAGG + Intergenic
932050537 2:68393709-68393731 CACCCTCCGCTTGCAGCACTGGG + Intronic
932572072 2:72943374-72943396 AAGCCTCCACCTGCAGCCCCAGG - Exonic
935331265 2:101979531-101979553 CAGCCGCCACCTGCAGCCCACGG + Intergenic
937857151 2:126680678-126680700 CAGTGTGCAATTGCAGCCCAGGG + Intronic
940405218 2:153293461-153293483 CAGAGGCCACCTGCATCCCTTGG - Intergenic
940612357 2:156007030-156007052 CAGCGAGGACTTGGAGCCCTCGG - Intergenic
942297248 2:174529638-174529660 CAGCATCCACTTGGGGGCCTTGG - Intergenic
947151513 2:227121102-227121124 CAGGGTCCAATTGGACCCCTGGG - Exonic
948055350 2:235006309-235006331 GAGCGGCCACTTGCTGCCCCAGG + Intronic
948143729 2:235693023-235693045 CAGATTCCACTTGCTGGCCTAGG + Intronic
948920158 2:241062543-241062565 CAGCGTCTTCTGGGAGCCCTGGG + Intronic
1169088095 20:2839840-2839862 CATGGTCCACTTCCAGGCCTCGG - Exonic
1169928388 20:10806684-10806706 CAGCTTCCACTTCCTTCCCTAGG - Intergenic
1169959108 20:11138901-11138923 CAGCCTCCGCTTGCAGCACCTGG + Intergenic
1170241701 20:14174024-14174046 CAGAGTCCACTTCAATCCCTTGG - Intronic
1171411661 20:24952004-24952026 GAGAGACCACTTGCAGCCCGGGG + Intronic
1172023841 20:31934687-31934709 CAGCGTCCACTTGCAGCCCTGGG - Exonic
1172024011 20:31935742-31935764 GAGCATCCACTTGCAGCCCTGGG + Intronic
1173470347 20:43318868-43318890 CTGCCTCCACTTGCAGCTTTAGG - Intergenic
1173880399 20:46407143-46407165 CAGCGCCCACGGTCAGCCCTGGG - Intronic
1176217566 20:63955618-63955640 GAGCGCCCTCTTGCAGCCCCGGG + Intronic
1178173696 21:30072734-30072756 CAGCAGCAACTTGCAGCACTGGG - Intergenic
1179576129 21:42309683-42309705 CAGCCTCCACTGGGAACCCTCGG + Intergenic
1180607123 22:17067200-17067222 CAACGCCCACTGGGAGCCCTTGG - Intergenic
950113014 3:10432607-10432629 CAGCATCCTCTTGAAGTCCTGGG - Intronic
950440296 3:13006490-13006512 CAGCATCCACTGGCAGACATGGG + Intronic
960281412 3:115784708-115784730 CACCGCCCACCTGCAGCCCGGGG + Intergenic
961602657 3:128073230-128073252 GAGCTTCCCCTTGCTGCCCTTGG + Intronic
962274700 3:134003238-134003260 CACCTACCAGTTGCAGCCCTAGG + Intronic
962480861 3:135797135-135797157 CAGCTTCCACTTGGAACCCTTGG + Intergenic
967980384 3:195061878-195061900 CAGCGGGCACTCTCAGCCCTCGG + Intergenic
968121668 3:196130258-196130280 TAGAGGCCACCTGCAGCCCTTGG + Intergenic
969241812 4:5903926-5903948 CAGCGGGTACTGGCAGCCCTTGG - Intronic
972265583 4:37455771-37455793 CAGAATCCATTTGCAGCCCAAGG + Intronic
972418951 4:38868450-38868472 CCGCCTCCACTCGCAGCCCCCGG + Exonic
975512752 4:75211573-75211595 CAGGGTCCACAGGCAGCCCGAGG + Intergenic
979394071 4:120164583-120164605 CAGAGGCCACTTGCAGCCTCTGG + Intergenic
981813097 4:148797804-148797826 CTGCAAACACTTGCAGCCCTGGG - Intergenic
984116825 4:175691942-175691964 CAGAGGCCACCTGCATCCCTTGG - Intronic
988497021 5:31754176-31754198 CAGCCTCTGCCTGCAGCCCTTGG + Intronic
989932757 5:49977439-49977461 CAGCGGACACTTGGAGCCCTTGG + Intergenic
990326096 5:54676740-54676762 CAACCTCAACTTGCAGCACTTGG - Intergenic
994170012 5:96649234-96649256 CAGACTCCCATTGCAGCCCTTGG + Intronic
1001251349 5:170149294-170149316 CATATTCCACTTCCAGCCCTGGG + Intergenic
1003184153 6:3816092-3816114 CAGCCTCCACTTTCTGCCCATGG + Intergenic
1003652296 6:7972401-7972423 CAGCAGCCACCTGCAACCCTAGG + Intronic
1004085905 6:12448822-12448844 AGGCATCCTCTTGCAGCCCTGGG + Intergenic
1004086011 6:12449964-12449986 AGGCATCCTCTTGCAGCCCTGGG + Intergenic
1007659948 6:43477805-43477827 TAGGGTCCAGTGGCAGCCCTAGG + Intronic
1007962496 6:45973025-45973047 CAGTGTCCACTTTCAGCACCTGG - Intronic
1015287511 6:131503408-131503430 CAGCGTCAAATTTCAGTCCTTGG + Intergenic
1015498167 6:133902440-133902462 CAGAGTCCAATTTCAGCCTTGGG - Intergenic
1018397180 6:163387436-163387458 CAGAGTCCAATTGCAGGGCTGGG - Intergenic
1019343310 7:518486-518508 CAGCGCCAAGCTGCAGCCCTCGG - Intronic
1019445327 7:1068005-1068027 CAGCGTCCAAACGCAGCTCTGGG - Intronic
1019934104 7:4242979-4243001 CAGCATCCACCTCCAGCCCTTGG - Intronic
1020130031 7:5554670-5554692 CAGCGTCCACCTAGGGCCCTAGG - Intronic
1021913091 7:25405782-25405804 CAGCTTCCCCCAGCAGCCCTTGG - Intergenic
1024989779 7:55224153-55224175 CATCTTCCACTTGGACCCCTGGG + Intronic
1026280772 7:68919939-68919961 CAGGGCCCACTTCCAGCACTGGG + Intergenic
1026768577 7:73177019-73177041 CACGGTTCACTGGCAGCCCTGGG - Intergenic
1027009447 7:74730391-74730413 CACGGTTCACTGGCAGCCCTGGG - Intronic
1027078596 7:75215637-75215659 CACGGTTCACTGGCAGCCCTGGG + Intergenic
1030088148 7:105834947-105834969 CAGAGACCACTTTTAGCCCTGGG - Intronic
1030628094 7:111865828-111865850 CAGAGGCCACTTGCAGTCCTTGG - Intronic
1031947577 7:127857951-127857973 CAGCGACCAGATGCAGACCTGGG - Intronic
1034373898 7:150626947-150626969 CCAAGTCCACTTGCATCCCTAGG + Exonic
1034946495 7:155265761-155265783 CTTCTTCCTCTTGCAGCCCTCGG + Intergenic
1035214605 7:157355814-157355836 CAGCATCCACTAACAGCACTCGG - Intronic
1035319637 7:158020412-158020434 CAGAGGCCACCTGCAGCTCTGGG + Intronic
1035827604 8:2661232-2661254 CATCTTCCACTTGGAGTCCTCGG - Intergenic
1035997065 8:4560032-4560054 CAGCCTCCACCTGCCACCCTTGG + Intronic
1036396522 8:8376087-8376109 CAGGGTCCCAGTGCAGCCCTCGG - Intronic
1042800145 8:72709706-72709728 CAGGCCCCACCTGCAGCCCTGGG + Intronic
1044428973 8:92086594-92086616 CAGAATCCATTTGCAGACCTCGG - Intronic
1044467713 8:92526201-92526223 CAGTGTCCACATGCATCACTTGG + Intergenic
1045632394 8:104140703-104140725 CAGCCCCCACTTGCTGCCTTGGG + Intronic
1046333446 8:112752279-112752301 CAGTGCCCAATTTCAGCCCTTGG + Intronic
1048115209 8:131514104-131514126 CAGGCTCCACTTCCAGCACTGGG - Intergenic
1049531125 8:143156135-143156157 CACCGTCCGCGTGAAGCCCTTGG - Intergenic
1049565502 8:143335880-143335902 GAGCGAGCAATTGCAGCCCTCGG - Intronic
1050658408 9:7855010-7855032 CAGAGTCCACTTTCAAGCCTTGG + Intronic
1050906407 9:11011961-11011983 CTCCTTCCACTTGCAGACCTTGG + Intergenic
1060523781 9:124309127-124309149 CAGCGTCCTGTGGCAGCCCTGGG + Intronic
1061709995 9:132480835-132480857 CACCGTCCGCTTTCTGCCCTGGG - Intronic
1061715384 9:132515365-132515387 CAGAGTCCTCCTGCAGCCCTGGG - Intronic
1062180039 9:135186393-135186415 CAGTGACCACGTGCAGCACTTGG + Intergenic
1062730350 9:138105029-138105051 CAGCCTCAGCCTGCAGCCCTGGG + Intronic
1186102729 X:6173771-6173793 GAGCGACCACTACCAGCCCTTGG - Intronic
1187856625 X:23643097-23643119 GAGCCTTCTCTTGCAGCCCTTGG + Intergenic
1193485901 X:82085374-82085396 AAGCGTCTGCTTGAAGCCCTAGG - Intergenic
1195667730 X:107445756-107445778 CAGAGTCCCCTTGCTGCCTTAGG + Intergenic
1200067959 X:153514081-153514103 CCGTGTCCACTTGCAGCCCAGGG - Intergenic