ID: 1172023996

View in Genome Browser
Species Human (GRCh38)
Location 20:31935647-31935669
Sequence CAGCAGTCACATCCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172023996_1172024000 -5 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG 0: 1
1: 0
2: 2
3: 15
4: 228
Right 1172024000 20:31935665-31935687 TGCTGGCATTAAGGTGGACGTGG 0: 1
1: 0
2: 0
3: 7
4: 107
1172023996_1172024003 13 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG 0: 1
1: 0
2: 2
3: 15
4: 228
Right 1172024003 20:31935683-31935705 CGTGGTGGAGGAATAAGCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 95
1172023996_1172024004 24 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG 0: 1
1: 0
2: 2
3: 15
4: 228
Right 1172024004 20:31935694-31935716 AATAAGCTCTGGCCCATGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 115
1172023996_1172024001 -2 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG 0: 1
1: 0
2: 2
3: 15
4: 228
Right 1172024001 20:31935668-31935690 TGGCATTAAGGTGGACGTGGTGG 0: 1
1: 0
2: 3
3: 14
4: 154
1172023996_1172024002 1 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG 0: 1
1: 0
2: 2
3: 15
4: 228
Right 1172024002 20:31935671-31935693 CATTAAGGTGGACGTGGTGGAGG 0: 1
1: 0
2: 0
3: 38
4: 1242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172023996 Original CRISPR CAGCAGTCACATCCTGCTGC AGG (reversed) Intronic
900139746 1:1134723-1134745 CAGATGTCAGATGCTGCTGCGGG - Intergenic
900862140 1:5241389-5241411 CAGGAGTCAAAAACTGCTGCAGG - Intergenic
901653564 1:10756449-10756471 AAGCTGTCACAGCCGGCTGCCGG - Intronic
901861524 1:12077731-12077753 CAGCACGCACAGGCTGCTGCAGG + Intronic
903276544 1:22225715-22225737 CAGGAGTCACATCTGGCTGTAGG + Intergenic
903757568 1:25673158-25673180 CAGCGCTGTCATCCTGCTGCTGG - Intronic
904243302 1:29165952-29165974 CAAAACTCACATCCTGCTGATGG - Intronic
905283680 1:36865510-36865532 CCTCAGTCATATCCTGCTTCCGG - Intronic
905327169 1:37161825-37161847 CAGGAGTCTCATCCTGCAGGAGG + Intergenic
906178950 1:43801489-43801511 GTGCAGTCACATCCTGTTCCAGG - Intronic
906740804 1:48181973-48181995 CTGCACTCACTTCCTGCTGTTGG + Intergenic
908169453 1:61490124-61490146 GAGCAGTCTCATTCTGCTGATGG + Intergenic
914918344 1:151831682-151831704 CAGCAGTCTCTTCCACCTGCAGG + Intronic
916195896 1:162222197-162222219 AAGCTGTCACATATTGCTGCAGG - Intronic
920757663 1:208749694-208749716 CAACAGTCACATGTGGCTGCTGG - Intergenic
923948648 1:238921726-238921748 GAGTTGTCACACCCTGCTGCTGG - Intergenic
924662616 1:246035479-246035501 CGACAGTCCCGTCCTGCTGCTGG - Intronic
1062903107 10:1160576-1160598 CAACAGTCATCTCATGCTGCAGG + Intergenic
1063362277 10:5468432-5468454 CAGCACCCACTGCCTGCTGCAGG + Intergenic
1064260760 10:13784277-13784299 GGGCAGTCACATCATCCTGCTGG + Intronic
1065808456 10:29418283-29418305 TTGCAGTCATATCATGCTGCAGG + Intergenic
1070762784 10:79035173-79035195 CAGCAGACACCACCTCCTGCAGG + Intergenic
1073059121 10:100722990-100723012 CAGCTGTCCCATCCAGCTCCTGG - Intergenic
1076827032 10:132974262-132974284 CACCAGTCACAGCCTGAAGCTGG - Intergenic
1078856681 11:15210968-15210990 CATCACCCACAACCTGCTGCCGG + Intronic
1079308310 11:19344022-19344044 CAGAAGGCCAATCCTGCTGCCGG - Intergenic
1084012191 11:66358239-66358261 GTGCAGTCACAACTTGCTGCAGG + Intronic
1084039359 11:66532400-66532422 CATCACTCATCTCCTGCTGCAGG + Exonic
1084367220 11:68709784-68709806 CAGAACACACATCCTGCTGCAGG + Intronic
1084592058 11:70096391-70096413 CACCACTCACCTCCTGCTGGGGG - Intronic
1084691648 11:70730676-70730698 CAGCAGCCTCATCCTTCAGCAGG - Intronic
1085157016 11:74305076-74305098 CACCACTCACCTCCTGCTGGGGG + Intronic
1087269644 11:96098346-96098368 AAGCCTTTACATCCTGCTGCTGG - Intronic
1089400262 11:118160382-118160404 CATGAGTCACATCATGCTGATGG + Intergenic
1090924213 11:131235490-131235512 CTGCAAACACATCCTGCTTCCGG + Intergenic
1093897509 12:24591314-24591336 CAGCAGCCACATCATATTGCTGG + Intergenic
1094494785 12:30982573-30982595 CAGCACGTACATCCTGTTGCGGG + Exonic
1095605552 12:44063094-44063116 GAGCAGTCACATTCTGCAGGAGG - Intronic
1095970243 12:47896821-47896843 CAGAAGTCACTTCCTGCCCCTGG + Intronic
1102553827 12:113712630-113712652 CAGCTGTCACATCAGGCTGCAGG - Intergenic
1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG + Intronic
1104914389 12:132257396-132257418 CAGCAAGCACAACCTGGTGCAGG - Intronic
1105960547 13:25331537-25331559 CAGCAGCAACAGCCTGCTACAGG + Exonic
1106033725 13:26025367-26025389 CGGCAGCCCCATCCTGCAGCTGG - Exonic
1110077718 13:71269860-71269882 CACCACTCACCTCCTGCTGTGGG + Intergenic
1113470203 13:110538954-110538976 CCACAGTCATATCCGGCTGCTGG - Intronic
1116468899 14:45264888-45264910 GATCACTCACATACTGCTGCTGG - Intergenic
1119144990 14:72304061-72304083 CATTAGTCACATCCTCCTGTAGG + Intronic
1119829057 14:77684620-77684642 TAACAGTCACAGCTTGCTGCAGG + Intronic
1120238202 14:81917345-81917367 GAGCATTCACCTCCAGCTGCAGG + Intergenic
1121820568 14:96962469-96962491 CAGCAGTTCCTTCCTGCAGCCGG - Intergenic
1122088256 14:99321706-99321728 CTGCAGACACATCCTGCAACAGG - Intergenic
1122463921 14:101917664-101917686 CAGCAGCCGCATCATGTTGCAGG + Intronic
1122635519 14:103127881-103127903 CCTCAGTCACATTCTGCTGTTGG + Intronic
1122716871 14:103701216-103701238 CGGCAGTCCCATCCTGGAGCGGG - Intronic
1122805999 14:104257455-104257477 CAGCTGTCATATCTTACTGCTGG + Intergenic
1122909858 14:104822251-104822273 CAGCATTCCCACCCTCCTGCAGG + Intergenic
1124271116 15:28281642-28281664 CAGGTCTCACATCCTACTGCTGG - Intronic
1124658370 15:31526303-31526325 CAGAAGTCACCTCCAGCTCCAGG - Intronic
1125725997 15:41868414-41868436 CAGCAGGCACTTCTTGCTGCAGG - Exonic
1128925305 15:71649942-71649964 CAGAAGTCACTTCTTGCAGCTGG - Intronic
1129744463 15:78008310-78008332 CTGCAGTCACCTCCTGCAGTGGG - Intronic
1130192645 15:81751064-81751086 CATCACTCACATCCAGCAGCTGG + Intergenic
1131095132 15:89649762-89649784 CAGCCGTGACATCCAGCTCCGGG - Exonic
1132105018 15:99057134-99057156 CAGCAGTCACTTCCAGTTGGGGG - Intergenic
1132743525 16:1427530-1427552 CCGCAGTCACCTCCTCCTGAAGG + Intergenic
1132858038 16:2056189-2056211 CAGCAGACAGATCATCCTGCAGG - Exonic
1133211985 16:4268435-4268457 CAGGAGTCACATCCTGTTCATGG + Intronic
1133254882 16:4510465-4510487 CAGCAGCCACCTCCTGCTCTGGG + Intergenic
1133435792 16:5778464-5778486 AAGCAGTCACTTCCTCCTGTGGG + Intergenic
1134225285 16:12385337-12385359 CAGGATTCACTTCCTGCTGCAGG - Intronic
1134679445 16:16113998-16114020 CACCACTCACCTCCTGCTGTGGG + Intronic
1136419798 16:30124587-30124609 AAGCTGCCACCTCCTGCTGCTGG + Intergenic
1137571019 16:49566366-49566388 CAGGACTCACACCCTGCTCCTGG + Intronic
1137684133 16:50374076-50374098 CTGAAGGCACATCCTGCTGGAGG - Intergenic
1138094423 16:54200899-54200921 CTGCAGTCACATCCTGGCTCTGG + Intergenic
1139778864 16:69334544-69334566 CCCCAGTCACATCCTGCGCCAGG + Exonic
1140200361 16:72889938-72889960 CACCACTCTCATGCTGCTGCAGG + Exonic
1140599358 16:76456857-76456879 CCGAGGTCACATCCAGCTGCTGG - Intronic
1141848923 16:86630740-86630762 CATGAGCCACAGCCTGCTGCTGG - Intergenic
1142105971 16:88302964-88302986 CAGCAGTGCCAGCCTCCTGCAGG + Intergenic
1142539606 17:647928-647950 CAGCGGCCCCATCCTGCTCCTGG - Intronic
1143203399 17:5127310-5127332 CCCCAGCCCCATCCTGCTGCAGG + Intronic
1143574246 17:7780755-7780777 CATCAGTCAGATCCGGCTGTAGG - Exonic
1144275391 17:13663353-13663375 CAGCAATCACTTCCTTCTGAAGG + Intergenic
1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG + Intronic
1145401778 17:22544398-22544420 AAGCAGTCACATTCTGCTGGAGG + Intergenic
1146627458 17:34445293-34445315 CAGCTGCCACTTCCTGCTGGAGG - Intergenic
1148732198 17:49844121-49844143 CAGCATTCAGCTCCAGCTGCAGG - Exonic
1149575364 17:57708041-57708063 CAGAGCTCACATCCTGCTCCTGG - Intergenic
1150086685 17:62277137-62277159 CACCAGCCCCATCCTACTGCAGG - Intronic
1152668456 17:81586205-81586227 CAGCACTCACTTCCTGCAGGAGG - Intronic
1153223557 18:2881552-2881574 CAGAGGTCACAGCCCGCTGCTGG + Intronic
1153491063 18:5648426-5648448 CAGCTCTCACTGCCTGCTGCAGG - Intergenic
1153530717 18:6042767-6042789 AAGCAATCACATCCAGATGCAGG + Intronic
1154095971 18:11414863-11414885 CATCAGCCTCCTCCTGCTGCTGG - Intergenic
1160246463 18:77163968-77163990 CCGCAGGCACCTCCTGCAGCAGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161576289 19:5056257-5056279 CAGCAGTGACATCACGCTGATGG - Intronic
1161609150 19:5231412-5231434 CACCACTCAGATCCTGCTGGAGG - Exonic
1161741768 19:6025249-6025271 CCCCAGTCCCATCCTGCTACAGG + Intronic
1165708729 19:37994643-37994665 CAGCTCTCACATCCCACTGCAGG - Intronic
1167502669 19:49856573-49856595 CACCAGCCACCTCCTGCTTCTGG - Intronic
1168319031 19:55498032-55498054 CAGCAGCCAGACCCTGCTGCTGG + Exonic
1168419550 19:56192406-56192428 CAGAAGTCCCATCCTGAGGCAGG - Intronic
1168424012 19:56224224-56224246 CAGGAGTCCCATCCTGAAGCAGG - Intronic
1168426702 19:56244848-56244870 CAGGAGTCCCATCCTGAAGCAGG + Intronic
1168489516 19:56796475-56796497 CAGCAGTGGCATCCAGCTTCGGG - Intronic
926127701 2:10282101-10282123 CAGGCCTCACCTCCTGCTGCTGG - Intergenic
926604548 2:14884287-14884309 CAGTAGTCAGATGCTGGTGCCGG - Intergenic
929002471 2:37361601-37361623 CAGGTGTCTCATCCTTCTGCTGG - Intronic
930565000 2:53007686-53007708 CCACAGTAATATCCTGCTGCTGG - Intergenic
931344433 2:61433251-61433273 CAGCAGGGACTTCCTGATGCAGG + Intronic
932177678 2:69617727-69617749 GAGCAGGCACAGCGTGCTGCTGG - Intronic
932411828 2:71552090-71552112 CAGCAGCCACCTCATGGTGCTGG - Intronic
933224172 2:79726379-79726401 CACCACTCACCTCCTGCTGTGGG - Intronic
934523693 2:95035517-95035539 CAGCAGTCACTTTGTCCTGCTGG + Intronic
935575214 2:104702075-104702097 AATCAGTCACATTATGCTGCTGG - Intergenic
935697433 2:105782284-105782306 TATCAGGCACATCCTGCTGATGG + Intronic
936055720 2:109260596-109260618 CACCAGTCAGATCCTGCATCAGG - Intronic
936403951 2:112186184-112186206 CAACTGTCACATCCAGCTGTTGG - Intronic
936951050 2:117977784-117977806 CAGCAGTCTCCTCCTGGGGCTGG - Intronic
938682998 2:133711370-133711392 CAGCTGGCCCATCCAGCTGCAGG + Intergenic
941224217 2:162826059-162826081 CATCAGTCACATGCTGATACAGG - Intronic
943782267 2:191837570-191837592 CAGCACTCTCCTCCAGCTGCCGG + Intronic
944290746 2:198001716-198001738 CACCACTCACCTCCTGCTGTGGG - Intronic
946194085 2:218022852-218022874 CAGAAGTCACCTCCTGGTGAGGG + Intergenic
947643452 2:231720810-231720832 CACCAGTGACAGCCTTCTGCAGG - Intergenic
948016403 2:234694402-234694424 CAGCAGACAGATCTTGCTGATGG + Intergenic
948105894 2:235413298-235413320 CAGCAGGCCCTTCCTTCTGCTGG + Intergenic
948500430 2:238389115-238389137 GAGCAGTCACATCCAGCAGCGGG + Intronic
1169446694 20:5677653-5677675 CAGCTGTCACATCCTCTTCCTGG - Intergenic
1170874183 20:20235124-20235146 CAGGAGTCAGATGCAGCTGCGGG - Intronic
1171561978 20:26134750-26134772 CAGCAGTGACCTCCTTCTTCTGG - Intergenic
1172023996 20:31935647-31935669 CAGCAGTCACATCCTGCTGCAGG - Intronic
1172112173 20:32553376-32553398 CACCAGGCACTTCCTGCCGCAGG + Intronic
1173054716 20:39599838-39599860 CAGCACTCAGATCCTTCTTCAGG - Intergenic
1173864055 20:46302996-46303018 TAGAAGCCTCATCCTGCTGCTGG - Intronic
1174603810 20:51745776-51745798 CAGCAGCCACATGTGGCTGCTGG - Intronic
1175522198 20:59609126-59609148 CAGCAGCTGCATCCTTCTGCAGG + Intronic
1179924665 21:44527909-44527931 CAGCAGTCCGTTCCCGCTGCTGG - Intronic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1181430794 22:22880634-22880656 CAGCAGTCAGGGGCTGCTGCAGG - Intronic
1182283880 22:29232751-29232773 CAGGACTCACTTCCTGCCGCCGG - Intronic
1183184935 22:36286338-36286360 CAGCCGGCACATCACGCTGCAGG + Intronic
1183448643 22:37877748-37877770 GAGCATTCACCTCCAGCTGCGGG + Exonic
1184149773 22:42631252-42631274 CAGCTGTCACCTCCTCCTGAAGG + Intronic
1184177588 22:42797812-42797834 CAGGATTCACATCCTGCCTCTGG + Intronic
1184327471 22:43800127-43800149 CAGCAGTCACATGCTGTAGGAGG + Intronic
952113700 3:30154622-30154644 CAGCAATCACCTGCAGCTGCAGG - Intergenic
953678612 3:45022620-45022642 CACCACTCACCTCCTGCTGATGG + Intronic
953804957 3:46060780-46060802 CAGCACACACATCCTCCTGGAGG + Intergenic
954146246 3:48635664-48635686 CTGCAGTCCCATCCAGCTCCGGG - Intergenic
961319889 3:126065111-126065133 CAGAACTCACCTCCTGGTGCTGG - Intronic
961406407 3:126682751-126682773 CAGCCCTCAAATCCTCCTGCTGG + Intergenic
961494857 3:127284214-127284236 CAGGAGCCACCTCCTGCTCCTGG - Intergenic
962003973 3:131329775-131329797 CATTAGGCACATCCTGCTCCAGG - Intronic
962362284 3:134752513-134752535 CAGCAGCCAACTCCTCCTGCAGG + Intronic
962678550 3:137775081-137775103 CAACAGCCCCATCCTTCTGCAGG + Intergenic
966496709 3:180589938-180589960 CAGCAGTCACATCCTGGTGGTGG - Intergenic
966608780 3:181847791-181847813 CAGCAGTCACATCCTGGAGATGG - Intergenic
967906532 3:194505748-194505770 TAGCAGTCACATCCAGAAGCAGG + Intergenic
967931827 3:194695552-194695574 CAGCAGGCTCCTCCTGCTCCAGG + Intergenic
968866694 4:3217475-3217497 CAGCTGTCACAGGCTGCTGCTGG + Intronic
969179454 4:5425949-5425971 CAGTAGTCCCTTCCTGTTGCTGG + Intronic
970298124 4:14653225-14653247 TAGCAGTCACAACGTCCTGCAGG + Intergenic
970507115 4:16742936-16742958 CAGAAGTCATTTCCTGCTGTAGG - Intronic
971226641 4:24759602-24759624 TATCAGCCACATTCTGCTGCTGG - Intergenic
975102041 4:70524866-70524888 CTACAGTTAAATCCTGCTGCAGG + Exonic
978939565 4:114420300-114420322 GAGCAGTCACATCCTGGTAAGGG + Intergenic
982263314 4:153515232-153515254 AAGCAGTCACTTCCTGCCCCTGG + Intronic
984846320 4:184110996-184111018 CACCTGTCACATCCTACTGCAGG + Intronic
985292567 4:188402002-188402024 CAGCAGTCACAGCCTGATAGAGG + Intergenic
985499674 5:234874-234896 CAGGGATCACAGCCTGCTGCAGG - Intronic
985570768 5:643624-643646 CAGCAGGCACATCCTGGGGCCGG - Intronic
985633898 5:1026770-1026792 CAGCAGTGACCTCCTGCCTCGGG - Intronic
985689256 5:1298185-1298207 CAGCCGTGCCTTCCTGCTGCAGG + Intergenic
987437625 5:17915667-17915689 CAGCCCTCACATCCTGCTCCAGG + Intergenic
987702035 5:21412720-21412742 CAGTATTCACATTATGCTGCAGG - Intergenic
988141848 5:27253406-27253428 CATCAATTACATCCTCCTGCAGG + Intergenic
988882283 5:35516611-35516633 CACCACTCACCTCCTGCTGTGGG - Intergenic
989631734 5:43490699-43490721 CAACAGTAACATCATGGTGCAGG - Exonic
995526913 5:113057518-113057540 AAGCAGCAACATCCTGCAGCTGG + Intronic
996410588 5:123154791-123154813 CAGCAGTGGGATCCTTCTGCTGG - Intronic
998379718 5:141715664-141715686 CAGCCGTCTCCTCCTGGTGCGGG - Intergenic
998634644 5:143940030-143940052 CAGAAGTGACATTCTACTGCAGG - Intergenic
999175718 5:149630463-149630485 CAGCACTCACAGCCTGCGGCAGG - Intronic
999192603 5:149759737-149759759 CAGCTGCCCCATGCTGCTGCTGG - Intronic
1001932087 5:175680418-175680440 CAGCAGTCACTTCCTGGTGGAGG + Intronic
1002292811 5:178211264-178211286 CAGCAGGCTCTTCCAGCTGCAGG + Intronic
1003057541 6:2835891-2835913 CAGCATGGTCATCCTGCTGCCGG - Exonic
1003448079 6:6203486-6203508 CAGCAGAGACATTCTCCTGCTGG + Intronic
1004800472 6:19141244-19141266 CAGCAGACACAGGCTTCTGCTGG + Intergenic
1005998479 6:30947144-30947166 CACCAGCCACATCCTGGGGCCGG + Intronic
1011811189 6:91134088-91134110 CAGCAGGGACATCCTGGAGCTGG - Intergenic
1014139517 6:117925393-117925415 CATTAGTAACATCCTACTGCTGG - Intronic
1015206739 6:130649202-130649224 CTGCAGTCGGCTCCTGCTGCAGG + Intergenic
1018111805 6:160543876-160543898 CACCAACCACATCCTTCTGCAGG + Intronic
1019544846 7:1569234-1569256 CAGCAGTCACATCCTGGTGGTGG - Exonic
1020256622 7:6506038-6506060 CTGCAGTCTCCTCCTGCTCCGGG - Intronic
1020465818 7:8477663-8477685 TAGGAATCACCTCCTGCTGCAGG + Intronic
1021195226 7:17666988-17667010 CAGCTGTCACAACCTGGTTCAGG + Intergenic
1022260118 7:28695768-28695790 CAGAGGTCACATCCTGCAGGTGG - Intronic
1022580504 7:31548664-31548686 GAGCAATCACATCATGCTGTTGG - Intronic
1025212165 7:57026000-57026022 CAGCAGCCACCTCCTGGGGCTGG - Intergenic
1025659789 7:63550828-63550850 CAGCAGCCACCTCCTGGGGCTGG + Intergenic
1027161267 7:75804191-75804213 CAGTAGTCACATGCTTGTGCAGG + Intergenic
1031521454 7:122771156-122771178 CAGCTGTCAACTCCTACTGCAGG - Intronic
1034667552 7:152831681-152831703 CTGCACACAGATCCTGCTGCTGG - Intronic
1034832199 7:154319040-154319062 TGGCAGACACCTCCTGCTGCTGG - Intronic
1034940494 7:155227333-155227355 CAGCTGCCACCTCCTCCTGCAGG - Intergenic
1035963969 8:4169621-4169643 CATCAGTCCCTTGCTGCTGCAGG + Intronic
1038517338 8:28198319-28198341 CAGCAGCCTCAACCTCCTGCTGG - Intergenic
1041483090 8:58344900-58344922 CAGAAGTCAGATCATGATGCTGG + Intergenic
1041912441 8:63103218-63103240 CAGCACTCAGATCCTGCTCGTGG - Intergenic
1042685435 8:71433738-71433760 CAGCAGTCACCTCCTCCTCTTGG - Intronic
1042915870 8:73875587-73875609 CAGCAGCAACATCCTGGTGTGGG + Intronic
1043552495 8:81390534-81390556 TAGAAGTCACATGATGCTGCTGG + Intergenic
1043947552 8:86271587-86271609 CAGGAGTCACATACTGCAGAAGG + Intronic
1046694104 8:117319103-117319125 AAGCAGTTACAATCTGCTGCTGG - Intergenic
1046797436 8:118388199-118388221 CAGCAGTAACTCCTTGCTGCGGG - Intronic
1047407278 8:124596058-124596080 CAGCAGTGTCATCCTGAGGCAGG - Intronic
1049195722 8:141314607-141314629 AAGCGTGCACATCCTGCTGCCGG - Intergenic
1049324797 8:142016306-142016328 CAGCTGTCACACACTGCGGCAGG + Intergenic
1049347154 8:142145158-142145180 CAGCAGTCAAAAACTGCTCCAGG - Intergenic
1049438308 8:142597794-142597816 CAGCTCCCAGATCCTGCTGCAGG - Intergenic
1050299267 9:4240387-4240409 CACCACTCACCTCCTGCTGTGGG + Intronic
1050629513 9:7543696-7543718 CAGCAGCCACATCATGGAGCAGG + Intergenic
1052326335 9:27220046-27220068 CAGGAGGCACACCCTACTGCGGG + Exonic
1054800167 9:69339815-69339837 CAGCAGTCACTTCCTGCCAGAGG + Intronic
1057004964 9:91549017-91549039 CAGCAGCCTCAGCCTGTTGCAGG + Intergenic
1057727167 9:97575864-97575886 CAGCTGTCACACACTGCTGAAGG + Intronic
1059724645 9:116994568-116994590 CAGCAGTCACATCTGGCTGGTGG - Intronic
1060300840 9:122373754-122373776 CAGCAGGCTCTTCCAGCTGCTGG + Intronic
1062216027 9:135390321-135390343 CAGCAGGCCCATGCGGCTGCCGG - Intergenic
1062477964 9:136738743-136738765 CAGAAGTCACATCCTGTTCTGGG + Intronic
1185589268 X:1263135-1263157 CAACAGTGACATACTCCTGCAGG - Intergenic
1186770339 X:12811912-12811934 CCACAGCCACTTCCTGCTGCTGG - Intronic
1187084090 X:16023646-16023668 CAGAAGAGACATCCTGCTTCAGG - Intergenic
1187562365 X:20414821-20414843 CAGCTGTTTCATTCTGCTGCTGG - Intergenic
1189611737 X:42744041-42744063 CAGCACTCACATCTTGTTTCTGG + Intergenic
1190641265 X:52483751-52483773 CAGAAGTCCCCTCATGCTGCTGG - Intergenic
1190646407 X:52529114-52529136 CAGAAGTCCCCTCATGCTGCTGG + Intergenic
1196207770 X:112960470-112960492 CAACAGCAACCTCCTGCTGCTGG - Intergenic
1198019058 X:132640599-132640621 CAGTAGTCACATGTTGCTGATGG - Intronic
1199211875 X:145222119-145222141 AAGCAGTCAAAATCTGCTGCAGG - Intergenic