ID: 1172023996

View in Genome Browser
Species Human (GRCh38)
Location 20:31935647-31935669
Sequence CAGCAGTCACATCCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172023996_1172024001 -2 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG No data
Right 1172024001 20:31935668-31935690 TGGCATTAAGGTGGACGTGGTGG No data
1172023996_1172024003 13 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG No data
Right 1172024003 20:31935683-31935705 CGTGGTGGAGGAATAAGCTCTGG No data
1172023996_1172024000 -5 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG No data
Right 1172024000 20:31935665-31935687 TGCTGGCATTAAGGTGGACGTGG No data
1172023996_1172024002 1 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG No data
Right 1172024002 20:31935671-31935693 CATTAAGGTGGACGTGGTGGAGG No data
1172023996_1172024004 24 Left 1172023996 20:31935647-31935669 CCTGCAGCAGGATGTGACTGCTG No data
Right 1172024004 20:31935694-31935716 AATAAGCTCTGGCCCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172023996 Original CRISPR CAGCAGTCACATCCTGCTGC AGG (reversed) Intronic