ID: 1172024411

View in Genome Browser
Species Human (GRCh38)
Location 20:31938170-31938192
Sequence TTATTCCAGCAGAAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 223}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172024397_1172024411 30 Left 1172024397 20:31938117-31938139 CCTCTCCCTCTCCCTCCCTCCCT 0: 18
1: 209
2: 1352
3: 11960
4: 28175
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024399_1172024411 24 Left 1172024399 20:31938123-31938145 CCTCTCCCTCCCTCCCTTCTCTT 0: 3
1: 15
2: 180
3: 1205
4: 6316
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024402_1172024411 15 Left 1172024402 20:31938132-31938154 CCCTCCCTTCTCTTTCCTCTGTA 0: 1
1: 0
2: 8
3: 163
4: 1306
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024404_1172024411 11 Left 1172024404 20:31938136-31938158 CCCTTCTCTTTCCTCTGTATTAG 0: 1
1: 0
2: 8
3: 64
4: 602
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024406_1172024411 0 Left 1172024406 20:31938147-31938169 CCTCTGTATTAGCTTTTCCCCGA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024405_1172024411 10 Left 1172024405 20:31938137-31938159 CCTTCTCTTTCCTCTGTATTAGC No data
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024400_1172024411 19 Left 1172024400 20:31938128-31938150 CCCTCCCTCCCTTCTCTTTCCTC 0: 1
1: 11
2: 139
3: 1147
4: 6432
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024401_1172024411 18 Left 1172024401 20:31938129-31938151 CCTCCCTCCCTTCTCTTTCCTCT 0: 1
1: 3
2: 71
3: 639
4: 4005
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024398_1172024411 25 Left 1172024398 20:31938122-31938144 CCCTCTCCCTCCCTCCCTTCTCT 0: 1
1: 18
2: 208
3: 1300
4: 6677
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223
1172024403_1172024411 14 Left 1172024403 20:31938133-31938155 CCTCCCTTCTCTTTCCTCTGTAT 0: 1
1: 0
2: 5
3: 98
4: 888
Right 1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG 0: 1
1: 0
2: 4
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172024411 Original CRISPR TTATTCCAGCAGAAGTTTGA GGG Intronic
900302004 1:1982493-1982515 TCACTCCAGCAGATGTTTGCAGG - Intronic
902803711 1:18847636-18847658 CTACTCCAGCAGAATTCTGATGG + Intronic
904205363 1:28851297-28851319 ATTTTCCATCAGAATTTTGAAGG - Intronic
906952439 1:50345706-50345728 TGATTCCATCGGAAGTTTCAGGG + Intergenic
907108450 1:51905266-51905288 AGATCCCAGCAGAAGTATGAGGG - Intergenic
907956821 1:59236776-59236798 TTCTTCCAACAGAAGCTTGAAGG + Intergenic
908017795 1:59863204-59863226 GAATTCCAGCAGAACTATGAAGG - Intronic
908137442 1:61147788-61147810 TTAATCCAACCGAAGTTTCAGGG - Intronic
908596899 1:65697769-65697791 TTATTCTAGGAGATGTTTCAGGG - Intergenic
908887620 1:68808237-68808259 TTATAGCAGCAGAAGTTTGAGGG + Intergenic
909152727 1:72028692-72028714 ATATTTCAGCAGAATCTTGAAGG - Intronic
909308122 1:74107668-74107690 TGAAGCCAGCAGAAGATTGAAGG + Intronic
909782927 1:79570337-79570359 TTATCCCACCAGAAGGGTGAGGG + Intergenic
909814404 1:79974058-79974080 TTATTCCAACATAACTTTAAAGG + Intergenic
910784264 1:90977673-90977695 TTATTACATCAGAAGTTAAAGGG + Intronic
911384683 1:97160479-97160501 AGAGTCCAGCAGAATTTTGAAGG + Intronic
914227400 1:145732158-145732180 TTTTTCCCACAGAATTTTGAAGG - Intronic
915729106 1:158040440-158040462 CTACTCCAGCAAAGGTTTGATGG + Intronic
916393935 1:164364937-164364959 TTATTCAAACATAATTTTGAAGG - Intergenic
919532011 1:198733725-198733747 ATATTCCAGCAGAAGTTAAGAGG + Intronic
919816617 1:201444873-201444895 CTATGCAAGCAAAAGTTTGAAGG + Intergenic
920670300 1:207998970-207998992 GCATTTGAGCAGAAGTTTGAGGG - Intergenic
920871321 1:209797513-209797535 CTAATGAAGCAGAAGTTTGAGGG - Intronic
921918020 1:220634704-220634726 TGATTCCAACAAAAGTTTGCTGG + Intronic
922192328 1:223330406-223330428 ATATTCCAGCAGAACTTGGAAGG - Intronic
923024186 1:230191482-230191504 TTATTTGAGCAGAAATTAGAGGG + Intronic
923200173 1:231703810-231703832 TTACTACATCAGAAGTTTCAGGG + Intronic
923534068 1:234834946-234834968 TGATTCCAACAGCAGGTTGAAGG + Intergenic
924063571 1:240201333-240201355 TTAATCATGCAGAAGTTGGAGGG + Intronic
1064245549 10:13665244-13665266 TTATTCAAACAGAAGATGGATGG - Intronic
1065756945 10:28939542-28939564 TTATCCCAGCTGGAGTCTGAAGG + Intergenic
1066674107 10:37870661-37870683 TTCTTTCAGCAAAAGTTTTATGG + Intergenic
1068894304 10:62182656-62182678 TTATTCCAGATGAGGGTTGAGGG + Intergenic
1068935367 10:62630726-62630748 TTAATCCAAGTGAAGTTTGAAGG - Intronic
1071701718 10:87945988-87946010 TGGTTCCAGCAGAAGTATGATGG + Intronic
1071720409 10:88138343-88138365 TTATTCAAGCCCAAGTTAGATGG + Intergenic
1077483737 11:2828970-2828992 TTTTTCCCTCAGATGTTTGAAGG - Intronic
1079497418 11:21061391-21061413 ATATTTCAGTAGAACTTTGAAGG + Intronic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1084344341 11:68534814-68534836 TTATTCCACCAGAAGCATGGTGG + Intronic
1087097504 11:94333520-94333542 TTATTCATGCTGAAGTTTGAGGG + Intergenic
1090156739 11:124446218-124446240 TTGTGCCACCAGAAGTCTGAGGG - Intergenic
1090415430 11:126537063-126537085 TTGTTCCAGCAGCAGATTGAGGG + Intronic
1090647018 11:128774569-128774591 TGATTCCAGCAGGAGTTTGCAGG + Intronic
1090718347 11:129450576-129450598 TTATAACAGCAAAAGTTGGAGGG - Intronic
1091167075 11:133488561-133488583 TTATTCCATCATAATTTTGTAGG - Intronic
1091261239 11:134236019-134236041 TTCTTCCATCAGAAGAGTGAAGG + Intronic
1091927445 12:4366644-4366666 TTATTCCATCTTAATTTTGAAGG + Intergenic
1092320461 12:7468393-7468415 TTATTACTGCAGAAATTCGAAGG + Intronic
1092744260 12:11658794-11658816 ATCTTACAGCAGAATTTTGAAGG + Intronic
1093061576 12:14612888-14612910 TTATTCCAGCAGTTGTTCCAGGG - Exonic
1093082514 12:14829245-14829267 TGGTTTCAGCAGAAGTATGATGG + Exonic
1096006000 12:48172429-48172451 GAATTCCATCAGAGGTTTGATGG + Intronic
1097466528 12:59932304-59932326 TTGATACAGCAGAAATTTGAAGG + Intergenic
1098535510 12:71590050-71590072 TTGTTTCATCAGTAGTTTGAGGG - Intergenic
1099232186 12:80039708-80039730 TTATGGCAGCAGTAGTTTTAGGG - Intergenic
1099465184 12:82976278-82976300 TTTTTCAAGTTGAAGTTTGATGG + Intronic
1099624339 12:85049849-85049871 TTATGCCAGCAAAAATTTGATGG + Intronic
1100589539 12:96012904-96012926 TTTTTATTGCAGAAGTTTGAAGG + Intronic
1101666371 12:106819400-106819422 TTATTTCACAAGAAGTTAGAAGG - Intronic
1102133064 12:110548662-110548684 TTCTTGCAGCAGAATTTTCAAGG - Intronic
1102975228 12:117202187-117202209 TTATTGCTGCAGAGGTTGGAGGG - Intergenic
1103991774 12:124804224-124804246 TCACTCCAGCAGAAGTTCCAGGG - Intronic
1104407679 12:128531869-128531891 TTACTCCAGCAGCAGCTTTATGG - Intronic
1108552507 13:51560479-51560501 TTATTCCAGCAGCAATAAGAAGG + Intergenic
1108771354 13:53704913-53704935 TTATTTCAGCTGAAGTCTGTGGG - Intergenic
1110084316 13:71358162-71358184 TTATTCCATCAGAAACTTGTAGG + Intergenic
1110880739 13:80569259-80569281 TTAATCCAGCAGTAGGTTGTAGG - Intergenic
1111800490 13:92974792-92974814 TTATGCCAGCAGGGGTCTGAAGG - Intergenic
1111823826 13:93244245-93244267 TTCTGCCAGCAGAAGTCTGTGGG - Intronic
1112577541 13:100649294-100649316 TTATGTGGGCAGAAGTTTGATGG - Intronic
1112924851 13:104661333-104661355 TTATTCCAGCAGAGGTTGACAGG - Intergenic
1113587542 13:111475606-111475628 TTGTTCCAGCAGAAGCGTGTGGG + Intergenic
1113762014 13:112854872-112854894 TTCCTCCAGCAGATGCTTGAAGG - Intronic
1113825259 13:113247599-113247621 TCATTCCAGGAGAACTTTGGGGG + Intronic
1114862572 14:26543243-26543265 TTGTTCCAAAAAAAGTTTGAGGG - Intronic
1114922868 14:27356561-27356583 TTATTCCAATCAAAGTTTGAAGG + Intergenic
1115519673 14:34220966-34220988 TTATCACAGGAGAAGGTTGAAGG + Intronic
1116878925 14:50144183-50144205 TTATTCCAACAGTAGATTGTGGG - Intronic
1117997883 14:61495080-61495102 GTATTAAAGCAGATGTTTGATGG + Intronic
1118725206 14:68624189-68624211 TGATTTCAGCACATGTTTGATGG + Intronic
1121367564 14:93328451-93328473 TTATTCGACCACAAGTTTGAGGG - Intronic
1123668395 15:22628627-22628649 TCATTCCAGGAGAAGCTTCAGGG - Intergenic
1123713157 15:23005870-23005892 GTATTCTAGCAGTAGTTTTATGG - Intronic
1125283788 15:38071517-38071539 TAAGTTCAGGAGAAGTTTGAAGG - Intergenic
1126263753 15:46728265-46728287 TTAATCAAGCAGAAGCTGGAAGG - Intergenic
1126670107 15:51108449-51108471 TTGTTCCAGAAGTATTTTGAGGG - Intergenic
1126724378 15:51616595-51616617 ATATTTCAGTAGAAGTTTTAGGG - Intronic
1130387651 15:83425744-83425766 TTCTTCCAACAGTATTTTGAAGG + Intergenic
1130857190 15:87850928-87850950 ATGTCTCAGCAGAAGTTTGAGGG + Intergenic
1131543986 15:93300326-93300348 TCATTCCAGCAACAGTATGAGGG + Intergenic
1133652392 16:7824921-7824943 TGATTCTAACAGAGGTTTGATGG + Intergenic
1133913168 16:10084390-10084412 TTATCCCAGCAGCAGTTTTTCGG - Intronic
1134908680 16:18004540-18004562 ATATTCCAGCAGAAGTGTGAGGG + Intergenic
1140950391 16:79811286-79811308 TATTTGCAACAGAAGTTTGATGG - Intergenic
1141960419 16:87403431-87403453 TAATTCCAGCAGTAATTTAAAGG + Exonic
1142906563 17:3046849-3046871 TTATTTCCACAGAATTTTGAGGG + Intergenic
1144271531 17:13621941-13621963 GAGTTCCAGCAGAAGTTTTAGGG - Intergenic
1144927564 17:18825638-18825660 TTTTTCCAACAGAATTTTCAAGG + Intergenic
1145953948 17:28841822-28841844 TTTTTCCTACAGAAGTCTGATGG + Intronic
1146105304 17:30030278-30030300 TTTTTCCATCAGAACTTTCAGGG + Intronic
1146904870 17:36611820-36611842 TCATTCCAGCCTGAGTTTGAAGG - Intergenic
1148990686 17:51664243-51664265 ATATTCCAGCAGATATTTGAGGG + Intronic
1150199981 17:63345027-63345049 TTATTCAAGCATATGTTTGGTGG - Intronic
1153624333 18:7009599-7009621 TTCTTCCAGCAGATGTTTACTGG - Intronic
1153717157 18:7861436-7861458 TTATTGCAGCAGGACTTTGCAGG + Intronic
1155324310 18:24650682-24650704 TTATTCAGGCAGATGTTTGCAGG + Intergenic
1155820691 18:30371389-30371411 TTATTCTAACAGAAGTTGGGAGG - Intergenic
1155994217 18:32312899-32312921 TTTTTCCAGCCAAAGTTGGAAGG + Intronic
1156082826 18:33359872-33359894 TTTATCAAGCAGAAGTTTGTGGG - Intronic
927487795 2:23501056-23501078 TACTTCCTGCAGTAGTTTGAGGG + Intronic
928918423 2:36499891-36499913 TTATTCCGGCAGAAGAATTAGGG - Intronic
930741265 2:54835107-54835129 TTATTTGAGCAAAGGTTTGAAGG - Intronic
931259021 2:60600422-60600444 TTATTCCACGAGCAGTGTGATGG - Intergenic
935364147 2:102271596-102271618 TCATTTCAGCAGAACCTTGAAGG + Intergenic
936143943 2:109966573-109966595 TGATGCAAGCAGAGGTTTGATGG - Intergenic
936180625 2:110264534-110264556 TGATGCAAGCAGAGGTTTGATGG - Intergenic
936200744 2:110404896-110404918 TGATGCAAGCAGAGGTTTGATGG + Intronic
936926172 2:117739213-117739235 TCATTTCAGCAGAAGTTTGAAGG - Intergenic
939439441 2:142225271-142225293 TTATTCCAGGATAATTTTGAGGG - Intergenic
941703279 2:168628844-168628866 TGATTCTAGCAGTAGGTTGAAGG + Intronic
942884842 2:180910595-180910617 ATATTCAAGCAGAAGGTAGAGGG + Intergenic
945863192 2:215147310-215147332 TTAATCCAGCAGAACTTTGTAGG + Intergenic
946328076 2:218994949-218994971 ATATTCCAGCAGAGGTGAGAGGG + Intergenic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
948017805 2:234704124-234704146 TTGTTTCAGCAGAAGTGTGTGGG - Intergenic
1169466607 20:5846744-5846766 TTATTCCAGCTGAAGCTGCAAGG + Intronic
1169765061 20:9140043-9140065 TTACTCCAGAAAAAGTTAGAAGG - Intronic
1170539352 20:17372482-17372504 ATATTCAAGAGGAAGTTTGATGG + Intronic
1171289712 20:23975346-23975368 CTACTCCAGCAGCAGTGTGAAGG + Intergenic
1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG + Intronic
1177959597 21:27646118-27646140 TGAATACAGCAGAAGTTTCATGG + Intergenic
1178272833 21:31208908-31208930 TTATCCTAGAAGAAGTTGGATGG - Intronic
1178499086 21:33110832-33110854 TTATTGCAGCAAAAGTTCCAGGG - Intergenic
1179089493 21:38251465-38251487 TAACTCCAGTAGAAGTTTAAAGG + Intronic
1179127803 21:38607136-38607158 ATTTTCCAGCAGCACTTTGAAGG - Intronic
1179418268 21:41215566-41215588 GTTTTCCAGCAGAAGCTGGATGG - Intronic
1183113614 22:35672102-35672124 GTAAACCAGTAGAAGTTTGAAGG + Intergenic
949858820 3:8486791-8486813 TCTTTCCAGGAGTAGTTTGAGGG - Intergenic
952542354 3:34379685-34379707 TTATTGCAGAAGAAGTATAAAGG + Intergenic
952801147 3:37293100-37293122 TTATTCTAGCAAATGTGTGAGGG + Intronic
953183561 3:40618268-40618290 TTATTCCACCTGAAGTGTGGTGG + Intergenic
953233006 3:41081160-41081182 TTATTGCAGGAGAACTTTGAGGG + Intergenic
954506339 3:51078630-51078652 ATATTCCCTCAGAATTTTGAAGG - Intronic
959353088 3:105292841-105292863 TTTTTCCAACGGGAGTTTGAAGG + Intergenic
960739353 3:120816023-120816045 TTATTGCAGCAGAGCTTGGAAGG + Intergenic
962210782 3:133475902-133475924 GTAGACCAACAGAAGTTTGAGGG - Intergenic
962273571 3:133995910-133995932 CTATTCCTGCAGAAATTTGGGGG - Intronic
962626790 3:137233604-137233626 TCCTTCCAGTAGAAGTTTGAGGG - Intergenic
963419363 3:145040567-145040589 TTTATCTAGCAAAAGTTTGATGG + Intergenic
965679114 3:171232077-171232099 TTATTGCAATAGAATTTTGAAGG + Intronic
965783533 3:172313089-172313111 TGATACCAGCAGGAATTTGAAGG - Intronic
966720445 3:183057194-183057216 GTTGTCCAGCAGGAGTTTGAGGG + Intronic
967452972 3:189648055-189648077 TTACTCCAGTAGAAGTATGTAGG + Intronic
967457139 3:189701639-189701661 TTATTCCAACAGAAAATGGAGGG + Intronic
968190501 3:196663845-196663867 TTATTTCAGCAGAAGGTGGCAGG - Intronic
971116367 4:23650628-23650650 TTATCCTGGCAGAAGTATGAAGG - Intergenic
971583465 4:28373980-28374002 GTATTTCAGCAGAGGTCTGAGGG - Intronic
974751247 4:66144467-66144489 TTATTCCAGCAATGGTTTGAAGG - Intergenic
976934270 4:90609541-90609563 GTATTCCCACTGAAGTTTGAAGG - Intronic
977407484 4:96618278-96618300 CAATCCCAGGAGAAGTTTGAAGG + Intergenic
977522532 4:98102750-98102772 TTCTACCACCAGAACTTTGATGG - Intronic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
978071308 4:104475168-104475190 TTATTGCAGGAGAAGTGAGAAGG + Intronic
979491823 4:121337030-121337052 TTATTCCAGCAGCAGTTTTGAGG - Intronic
979708850 4:123753426-123753448 TAATTCCAGCAGATTTTTAAAGG + Intergenic
979859261 4:125673760-125673782 TTACTCTAGCAGCAGTTTGTGGG - Intergenic
981281107 4:142959975-142959997 TTATTACAGAACAAGTATGATGG - Intergenic
982872517 4:160600745-160600767 TTATTCCAGAAAAAGGATGAGGG - Intergenic
985009753 4:185570296-185570318 ATATTTCAGCTGAATTTTGAAGG + Intergenic
987782329 5:22455207-22455229 TTGTCCCAGCTGAAATTTGAAGG + Intronic
989484516 5:41973865-41973887 TTTTTCAGGCAGAAGTTTAATGG - Intergenic
989744063 5:44806981-44807003 TTCTTCTAGCAAAGGTTTGAAGG - Intergenic
990279175 5:54231435-54231457 TTATTCAAGGTGAAGTGTGAGGG - Intronic
991078628 5:62570095-62570117 TTAATCCAGCAGAAGCTGGAGGG + Intronic
991996743 5:72395341-72395363 TTTTTCCAGAAGAAATTTTAAGG + Intergenic
992819985 5:80486863-80486885 TTATTCCAGCATAAGAAGGAAGG + Intergenic
997103115 5:130990384-130990406 TGCTTCCAGCATAAGTATGATGG + Intergenic
999547373 5:152644767-152644789 TTATTCAAGCAGTGGCTTGAAGG - Intergenic
999651012 5:153767572-153767594 TTATCCCACCAGGAGTTTGGTGG + Intronic
999924879 5:156364169-156364191 TTATGACAGCAGAAGTCTGGGGG + Intronic
1000675518 5:164117889-164117911 TTATTTCAGCAGAACTGTAATGG - Intergenic
1001467032 5:171976657-171976679 TTATCCCAGCAGAAGATGGAAGG - Intronic
1003749226 6:9038314-9038336 TTATTGCTGCAAAAGTTTTAAGG + Intergenic
1004168530 6:13277460-13277482 TTGTTCCTGCAGCAGGTTGAGGG + Intronic
1004333129 6:14739827-14739849 ATCTTCCAGCAGAATCTTGAAGG + Intergenic
1006943684 6:37769932-37769954 TCACTCCAGCAGAAGACTGAAGG + Intergenic
1010578228 6:77560815-77560837 TTATACGACCAGAAGTTTGTTGG + Intergenic
1014797641 6:125745584-125745606 TTGTTACAGCAGAAGCTTCAAGG - Intergenic
1014955692 6:127612888-127612910 TTATTTCAGCAGAGATGTGAAGG - Intergenic
1015281954 6:131443446-131443468 TTCTTCCAGCAGGGGTCTGAAGG - Intergenic
1015479862 6:133696830-133696852 AAATTTCAGCAAAAGTTTGAGGG - Intergenic
1015559666 6:134501126-134501148 TTAATCAACCAGAAGTTTGAAGG - Intergenic
1017528932 6:155268308-155268330 TTCTTCAAGAAGGAGTTTGAAGG - Intronic
1018343316 6:162875683-162875705 TTATTGCAGCAGAATTTTTGGGG - Intronic
1018788437 6:167127327-167127349 TTATTCCAGCAGGGCTCTGAAGG + Intronic
1019964343 7:4486397-4486419 TTAATTCACCAGAAGTGTGACGG + Intergenic
1020459006 7:8406862-8406884 TTATTACTGCAGTATTTTGATGG + Intergenic
1020518111 7:9151298-9151320 TGATAAGAGCAGAAGTTTGAGGG - Intergenic
1022436064 7:30386829-30386851 TTATTCCAGCACTAGTTCAATGG - Intronic
1023185258 7:37526329-37526351 TTTTTCCAACAGCATTTTGAAGG - Intergenic
1023784794 7:43695231-43695253 TGATTCCATCTGAAATTTGAGGG - Intronic
1023786376 7:43712409-43712431 ATATTCCTCCAGAATTTTGAAGG + Intronic
1024145359 7:46511230-46511252 TGAAACCAGGAGAAGTTTGATGG + Intergenic
1024790687 7:52962132-52962154 GTATTGGAGCTGAAGTTTGAAGG + Intergenic
1026344099 7:69459623-69459645 TTTCTCCTGCAGAAGTTTGGAGG + Intergenic
1026674041 7:72414597-72414619 TAATTCAAGCAAATGTTTGAAGG + Intronic
1028718369 7:94000634-94000656 TTAGTCCAGGAGAAGGTGGATGG + Intronic
1029868224 7:103659268-103659290 TAATTCTAGCAGGAGTATGATGG - Intronic
1030816403 7:114044536-114044558 TTATTTCTGGAGAAGTTTCAGGG - Intronic
1032002902 7:128276785-128276807 TTCTTCCAGCAGGAGGGTGAAGG + Intergenic
1032232938 7:130091865-130091887 TTATTTCATTAGAAGTCTGAAGG + Intronic
1033052168 7:138015421-138015443 TTATACCAGCAGAGAGTTGAAGG - Intronic
1033984495 7:147207086-147207108 GCATTTCAGCAGAATTTTGAAGG - Intronic
1036469307 8:9037140-9037162 TTATCCCATCAGAAATGTGAAGG - Intronic
1037058990 8:14482857-14482879 TAATTCCAGCCTAAGTCTGAAGG - Intronic
1038324518 8:26562487-26562509 TTATTCCAGCTGTAGTGTGGTGG - Intronic
1038397306 8:27256849-27256871 GCATTCAAGCAGAAGTTGGATGG - Intronic
1044557426 8:93578953-93578975 TTAGTCCAACAGATGTGTGATGG - Intergenic
1046353364 8:113046155-113046177 GTATCCCAGCAGAGGTCTGAAGG - Intronic
1046893676 8:119450130-119450152 TTGTTCCAGTAGAAATTTGTGGG - Intergenic
1046972906 8:120242615-120242637 TTATTCCAGAATGAGTTAGACGG - Intronic
1047451676 8:124970614-124970636 ATATTTCAGCAGAAGTATGAAGG - Intergenic
1047674647 8:127187070-127187092 TTGTTGCAGCAGAAGTATTATGG - Intergenic
1049819849 8:144626930-144626952 TTATCCCAGCAGGAGTTTCAGGG - Intergenic
1054722683 9:68618891-68618913 CTTTTCCTTCAGAAGTTTGAAGG + Intergenic
1055222934 9:73959822-73959844 CTATTTCAGCAAAAGTTTGTTGG + Intergenic
1056338120 9:85597768-85597790 TTATTGCATCAGCAGTTTAAAGG - Intronic
1058166611 9:101626335-101626357 TAAGTCCAGGAGAATTTTGATGG + Intronic
1059220378 9:112610756-112610778 TTATGCCAGCAGAACTATAATGG + Intronic
1061270753 9:129540395-129540417 TTTTTGCAGCAAAAGTTTGGGGG - Intergenic
1189046364 X:37596105-37596127 TAATTACATCAGAAGTTGGAAGG + Intronic
1190019762 X:46863508-46863530 ATATTCTAGCAGGAGTTGGATGG + Intronic
1190422087 X:50295360-50295382 TTATTCCATTAGAAGCTTTACGG + Intronic
1191682490 X:63855543-63855565 TTCTTCCTGCAGCAGGTTGAGGG - Intergenic
1192823449 X:74668594-74668616 TTTTTCCAGCAAAATTTTGTTGG - Intergenic
1193838772 X:86382049-86382071 TGATTCCAGCAGTACTTTTATGG + Intronic
1194048453 X:89037269-89037291 TGTTTCCAGCAGAAGTCTGTGGG - Intergenic
1195494604 X:105515980-105516002 TTATTCCTGAAGAAGTTGTATGG + Intronic
1196820662 X:119697859-119697881 ATATTGAAGGAGAAGTTTGAAGG + Intergenic
1197937315 X:131753074-131753096 TTATTCCAGGGGAAGTTTATAGG + Intergenic
1197949520 X:131879201-131879223 TTATGTCAGCAGGAATTTGAAGG - Intergenic
1198209735 X:134505916-134505938 TCATTCCAGGAGAAGCTTCAGGG + Intronic
1198716768 X:139566040-139566062 TTACTCCAGAAGCTGTTTGAGGG + Intergenic
1199276996 X:145956478-145956500 TTATTCCAGCAGCAGTTTTAAGG - Intergenic
1199766899 X:150947881-150947903 GTATTCCAGAAGATGTTTGTAGG + Intergenic
1199810774 X:151346510-151346532 TGATTGCTTCAGAAGTTTGAGGG + Intergenic
1200311084 X:155077993-155078015 TAATTGCAGCTGAAGTTTGCAGG - Intronic
1202094227 Y:21228217-21228239 TTAATCCAGCCCAAGTTAGAGGG - Intergenic