ID: 1172025009

View in Genome Browser
Species Human (GRCh38)
Location 20:31942645-31942667
Sequence CTCCAGATGCTGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172025009_1172025012 -6 Left 1172025009 20:31942645-31942667 CCATCCACATTCAGCATCTGGAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1172025012 20:31942662-31942684 CTGGAGCAGTTCCTGGCTTGAGG 0: 1
1: 0
2: 3
3: 28
4: 363
1172025009_1172025020 30 Left 1172025009 20:31942645-31942667 CCATCCACATTCAGCATCTGGAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1172025020 20:31942698-31942720 CTCATGTTCACTCCATAAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 76
1172025009_1172025018 27 Left 1172025009 20:31942645-31942667 CCATCCACATTCAGCATCTGGAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1172025018 20:31942695-31942717 GTCCTCATGTTCACTCCATAAGG 0: 1
1: 0
2: 0
3: 15
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172025009 Original CRISPR CTCCAGATGCTGAATGTGGA TGG (reversed) Intronic
901817776 1:11804891-11804913 CTCCAGATTCTCAGTGGGGATGG + Intronic
902890811 1:19442073-19442095 CTCCAAATGCTGAAAGATGAAGG + Intronic
903387223 1:22935325-22935347 CTCCAGATTCTGAATATGTTAGG - Intergenic
904586884 1:31585612-31585634 CTCCAGGTGCTGCCTGTGGGAGG - Intronic
907768609 1:57437128-57437150 CTTCAGATGGTGAAAGTGAATGG + Intronic
908238380 1:62168850-62168872 CTCCAGAGGCTGAGGGTGGGAGG + Intergenic
908429107 1:64038388-64038410 GTCAAGATGCTGAGTGTTGAAGG - Intronic
909390821 1:75119542-75119564 CTCATCATGCTGAATGTGGCTGG - Intergenic
911222276 1:95261707-95261729 CTCCAGCTGCTGAGTTTGGCCGG + Intergenic
911771476 1:101748178-101748200 CTCCAGAGGCTGGATGTGCTTGG - Intergenic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
913048453 1:115093720-115093742 CTCCAGAGGCTGAAGTGGGAGGG + Intergenic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
915463924 1:156084948-156084970 GTCCAGCTGCTGAATGGGGAAGG + Intronic
916476357 1:165173204-165173226 GTCCATCTGTTGAATGTGGATGG + Intergenic
918098273 1:181352000-181352022 CTCCAGATGCTGCAAGTGCATGG - Intergenic
919427935 1:197457148-197457170 CTCCAAATGCTGATTGTGTGGGG - Intronic
920189790 1:204186285-204186307 CTTCAGATGCTGACATTGGAGGG - Intergenic
923128954 1:231058080-231058102 CTCCTGATCCAGAATGTGAATGG + Intergenic
923760429 1:236837654-236837676 CTCAGGAGGCTGAGTGTGGAGGG + Intronic
1064618605 10:17191436-17191458 CTGCAGATGCTTTATCTGGAAGG + Intronic
1065022574 10:21512357-21512379 CTACAGATCTTGGATGTGGAAGG - Intergenic
1065515482 10:26520030-26520052 TTCCAGATGCTTAATTAGGAAGG + Intronic
1067004361 10:42646947-42646969 CTCCAGCAGCTGCCTGTGGAGGG + Intergenic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1072574918 10:96690682-96690704 CACCACTTGGTGAATGTGGAGGG - Intronic
1072799344 10:98382240-98382262 GTCCTGATGCTGAATGAGGGAGG + Intergenic
1075557349 10:123443218-123443240 GGCCAGAGGCTGAATCTGGAAGG + Intergenic
1075651454 10:124130299-124130321 CTCCACATGCTGGAAGGGGAGGG + Intergenic
1075968098 10:126630297-126630319 CTGCAGATGCTGGATGAAGAGGG + Intronic
1076242750 10:128922092-128922114 TTCTAGATGCTCCATGTGGAAGG - Intergenic
1076514094 10:131033456-131033478 CTCCAGCTGGTAAATGTGGCTGG - Intergenic
1076876758 10:133220040-133220062 CTCCAGCTGCTGGATGTGCATGG - Exonic
1077184230 11:1229182-1229204 CTCCTGGTGCTGCATGTTGAGGG - Exonic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1077415954 11:2424358-2424380 CTCCAGAGGCCTAATGGGGAGGG - Intergenic
1077868573 11:6242601-6242623 CTCCACATCCTGTATGTGGTAGG + Intronic
1080286633 11:30621807-30621829 CTGCAAACGCTGAATATGGAAGG + Intergenic
1084106633 11:66984839-66984861 CTCAAGATGCTCACTGTGGCTGG + Intergenic
1084412791 11:69013910-69013932 CTCCAGGGGCTCAATGGGGAAGG - Intergenic
1085464839 11:76716445-76716467 CTCCAGAGGCTGCATGTGGATGG - Intergenic
1088322709 11:108569989-108570011 CTCCCAATGCTTAATGTTGATGG + Intronic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1091345998 11:134854602-134854624 CTCCATGTGCAGAATGTGCAGGG + Intergenic
1092944707 12:13441905-13441927 CACCAGATGAGGAAGGTGGAAGG - Intergenic
1095316940 12:40775218-40775240 CTTTAGATGCTGTATTTGGAAGG + Intronic
1096562613 12:52447559-52447581 CTCCACAGGCTGAATGGCGAAGG - Exonic
1096564784 12:52469431-52469453 CTCCACAGGCTGAATGGCGAAGG - Exonic
1096566702 12:52488089-52488111 CTCCACAGGCTGAATGGCGAAGG - Exonic
1097042793 12:56165637-56165659 CTTCAGCTGCTCCATGTGGAAGG + Exonic
1098879604 12:75903623-75903645 ATCCTGATGCTGAGTGAGGAGGG + Intergenic
1099247364 12:80209262-80209284 CTTCAGATGCTGTATGTAGTTGG + Intergenic
1099466797 12:82998715-82998737 CTCAAACTGCTAAATGTGGAGGG - Intronic
1100087227 12:90926410-90926432 CTCGAGATTCTGATTTTGGATGG - Intronic
1102216675 12:111166687-111166709 CTGCAGAGGCTAAACGTGGAAGG + Intronic
1102593043 12:113971785-113971807 CTCCAAAGGCTCAAAGTGGAAGG + Intergenic
1103703840 12:122861071-122861093 CTCCCGAGGCTGAATGGGGGTGG + Intronic
1104024230 12:125014332-125014354 CTGCAGTTGCTGCATGTGGCAGG + Intronic
1105639797 13:22250386-22250408 CTCCAGATCCTGCCTGTGAAGGG + Intergenic
1106008666 13:25796522-25796544 CCCCAGATGCTGAAATTAGATGG + Intronic
1107015335 13:35704384-35704406 TTCCAGCTACTAAATGTGGAAGG - Intergenic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1109220149 13:59633396-59633418 CTCCGGATGCTGAGTCAGGAAGG - Intergenic
1110762066 13:79241718-79241740 ATCCAGATGGTGAATCTCGAGGG - Intergenic
1111013049 13:82337440-82337462 CTCGAGATGCTGAGTCAGGAGGG - Intergenic
1111533763 13:89574959-89574981 ATCCAGTCTCTGAATGTGGACGG + Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1115472619 14:33783793-33783815 CTGCAGATTCTGATTGGGGAAGG - Intronic
1115919956 14:38361467-38361489 CTCCACAAGCTGAAAGAGGAAGG + Intergenic
1115973292 14:38969683-38969705 CGGCAGATGCTGCCTGTGGAGGG - Intergenic
1121225484 14:92318847-92318869 CTCCAGATGCTGGGTGAAGAAGG + Intergenic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1127856412 15:62957317-62957339 TTCCAGATGCTAAATGAAGAGGG - Intergenic
1128328906 15:66742959-66742981 CACCACATGCTAACTGTGGAAGG - Intronic
1128350540 15:66885491-66885513 CTCTAGGTGCTGAATGGGGAAGG - Intergenic
1129615842 15:77098284-77098306 CTCCAGCTGAAGACTGTGGATGG - Intergenic
1131140982 15:89977016-89977038 CAGCGGATGCTGCATGTGGAAGG + Intergenic
1133195565 16:4167599-4167621 CTCCAGATGCTGACATTGGCTGG + Intergenic
1134400230 16:13903243-13903265 CTCCAGAAGATGAAAGTGTATGG - Intergenic
1134416820 16:14050787-14050809 CTCCAGGTGCAGAATGGGGGCGG + Intergenic
1134820351 16:17241788-17241810 CTCCACATGCTGGAGTTGGAAGG + Intronic
1135109583 16:19680398-19680420 CTCCAGGAACTCAATGTGGATGG - Intronic
1135407759 16:22210223-22210245 CTCCAGAGTCAGAAGGTGGATGG + Intronic
1136141713 16:28292756-28292778 CGCCGGATCCTGGATGTGGAAGG - Exonic
1137581463 16:49636011-49636033 CGCCAGCTTCTGCATGTGGAAGG + Exonic
1141010093 16:80388971-80388993 CTTCAGATGCTAAAGGGGGAGGG + Intergenic
1143365165 17:6403274-6403296 CTCAAGAGGCTGAAGCTGGAGGG - Intronic
1145018751 17:19414572-19414594 GTCCAGATGCTGAAAGAGAAGGG - Exonic
1145395446 17:22490580-22490602 CGACAGATGCTGTATGAGGAGGG + Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1147944575 17:44073567-44073589 CTCCAGAGGCTGAAGTGGGAAGG - Intronic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1151198497 17:72449812-72449834 CACCAGATGCTAAATCTGAAAGG + Intergenic
1152708000 17:81855271-81855293 CTCCACGTCCTGAATGAGGAGGG + Exonic
1154447213 18:14445083-14445105 CCCCAGTTCCTGAATGTAGAAGG + Intergenic
1155064084 18:22253971-22253993 CTCCAGTTCCAGGATGTGGATGG - Intergenic
1156540027 18:37900503-37900525 CTCTGGATGCTGTCTGTGGAGGG + Intergenic
1156549899 18:38004482-38004504 CTCCAGTTGCTGACAGTGGAAGG - Intergenic
1157358372 18:46955657-46955679 CTCCAGAGGCTGAAGCAGGAGGG - Intronic
1157727815 18:49978335-49978357 CTCCGGAGGCTGGGTGTGGAGGG + Intronic
1158870410 18:61681753-61681775 CTCCATGTGGTGAATGTAGAGGG - Intergenic
1160955697 19:1690843-1690865 CTCCAGAGCCTGGATGTGGAAGG + Intergenic
1161967099 19:7554876-7554898 CTCCAGCTGCGGAATACGGACGG - Exonic
1163417861 19:17197509-17197531 CCCCAGATGTTGAGTGTGGAGGG - Intronic
1164822316 19:31259707-31259729 CTCAAGATGCTGGGTGTAGACGG + Intergenic
1165103326 19:33453204-33453226 CTCCAGAGGCTGAGGGGGGAAGG + Intronic
1165337161 19:35179144-35179166 CTCCAGCTGCTGATGGTGGGAGG + Intergenic
1166259475 19:41627578-41627600 CCCCAGCTCCTGGATGTGGAGGG + Intronic
1166270041 19:41708113-41708135 CCCCAGATCCTGCATGTGGAGGG - Intronic
1166512013 19:43415316-43415338 CTCCTGATCCTGAAGTTGGAGGG + Intronic
1167124979 19:47543358-47543380 CTCCAGATGTTGTGTTTGGAGGG - Intronic
1167406097 19:49309810-49309832 CCCCAGATCCTGAATGTGAACGG - Exonic
1168689225 19:58366865-58366887 CTCCAGAGGCCGAATGGGGCAGG - Intergenic
926125998 2:10272247-10272269 CTCCATATGCTGAATGGTGGTGG + Intergenic
927089493 2:19699720-19699742 CTCCAGATGGTGAACATGGAAGG + Intergenic
927696228 2:25241502-25241524 CTCCAGGTGCTGAGTGTGCAGGG + Intronic
929440728 2:41964220-41964242 CTCCAGACCCTGACTGGGGATGG - Intergenic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
931418897 2:62107427-62107449 CTCCACTTGGTGAATATGGATGG + Intronic
934603320 2:95675520-95675542 TTACAGATGCTGCATGTGGCTGG - Intergenic
935280352 2:101512029-101512051 CTCAAGATTATGAATTTGGAGGG - Intergenic
935516554 2:104047399-104047421 CTCTAGTTGCTGATTGTGGCTGG + Intergenic
936536700 2:113317746-113317768 TTACAGATGCTGCATGTGGCTGG - Intergenic
937225499 2:120366505-120366527 CTCCAAGGGCTGAATGTGGGAGG + Intergenic
942088073 2:172462087-172462109 CTCCAGTTGCTGAATGTGGTTGG + Intronic
942425663 2:175857848-175857870 CTCCAAAGGCTGTATGTAGAAGG + Intergenic
944444314 2:199774305-199774327 CTGAAGATGCTGAATTTGTAGGG - Intronic
944454346 2:199878047-199878069 CTCCAGATCCTGCCTGTGAAGGG - Intergenic
949022342 2:241748695-241748717 CACCAGGGGCTGAAGGTGGAGGG - Intronic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1172681532 20:36719584-36719606 CTCCAGAGGCTGCAGGTGAAGGG + Intronic
1174766464 20:53258594-53258616 CTCCAGATTCTGACTGACGATGG - Intronic
1175922003 20:62454581-62454603 CAGCTGCTGCTGAATGTGGAGGG - Intergenic
1176008996 20:62881747-62881769 CTCCACAAGCTGAGTGTCGAAGG + Exonic
1176043555 20:63080879-63080901 CTCCAGCTGCTGAAAATGCAAGG - Intergenic
1176431564 21:6579335-6579357 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1177391471 21:20479003-20479025 ATACAAATGCTGAATTTGGAAGG - Intergenic
1179706958 21:43186797-43186819 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1180317452 22:11287890-11287912 CTGCAGATGCTGAATGGATAAGG - Intergenic
1182748734 22:32625187-32625209 GCCCACAGGCTGAATGTGGACGG + Intronic
1185098350 22:48823878-48823900 TTCCAGATGCTGCATGTGGTTGG - Intronic
949576509 3:5343597-5343619 ATTCAGATGCTGAATGGGAAAGG - Intergenic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
952543341 3:34391730-34391752 CTCCAAATGGGGAATGTGGGAGG + Intergenic
952899550 3:38100365-38100387 CTCCAGATGCTGGCAGTGCAGGG - Exonic
953858999 3:46526385-46526407 TTCCAGGGGCTGGATGTGGAAGG + Intronic
954224023 3:49171475-49171497 CTCCAGCTGCGGCATGTGCAGGG + Intergenic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
954491488 3:50910754-50910776 CTCCATGTGCTGATGGTGGATGG + Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
956595752 3:70965282-70965304 CTGCCCATGCTGAATGTGAATGG - Intronic
960495361 3:118367249-118367271 CTCTAGTTTCTTAATGTGGAAGG + Intergenic
961049580 3:123734994-123735016 CGCTAGATGCTGGATGTGCAGGG - Intronic
962021489 3:131506816-131506838 CTCCAGATTCTGTATCTGTAAGG - Intergenic
962839881 3:139223763-139223785 ATCCAGATAGTAAATGTGGATGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964282720 3:155084082-155084104 GTCCAAATGCTTAATGTGGCTGG - Intronic
965099279 3:164276195-164276217 ATACAGACGCTGAAAGTGGATGG + Intergenic
965179128 3:165378560-165378582 CTACAGAGGCTGAGTGGGGAGGG + Intergenic
966336809 3:178877348-178877370 TTCCTGATGCTGGATTTGGAAGG + Intergenic
967539083 3:190643641-190643663 CACCAGATGCTGAATATGCTTGG - Intronic
967788415 3:193521992-193522014 GTCCACCTGCTGACTGTGGAGGG - Intronic
968612274 4:1562739-1562761 TTCCAGAAGCTGACTGGGGATGG + Intergenic
968880436 4:3296014-3296036 CTCCAGAAGCTGACTGGGGCGGG - Intronic
969494998 4:7521408-7521430 CTCCAGATTCTGAGTGTGAAAGG - Intronic
970163179 4:13209621-13209643 CTCCAGCTGCTGACTTTGGCAGG + Intergenic
970403670 4:15741920-15741942 CTCCAGATGCATAATATGGTTGG + Intergenic
978723615 4:111944534-111944556 ATGCAGATGCTGATTGTGGTTGG - Intergenic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
982404048 4:155000970-155000992 CTCCAGAAGCTGAAGTGGGAGGG - Intergenic
982670506 4:158314386-158314408 GACAAAATGCTGAATGTGGATGG - Intergenic
983671965 4:170247711-170247733 CTCCAGTTGCTGAATGTCTGGGG + Intergenic
985945123 5:3176206-3176228 CTCCAGATCTGAAATGTGGAAGG + Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
994572463 5:101531802-101531824 CTTCAGTTTCTGAATTTGGAGGG - Intergenic
996017538 5:118557269-118557291 CCCCAGGTGCTGAATGGGGATGG - Intergenic
997540549 5:134658157-134658179 CTCGAGAGGCTGAATGAGGCAGG + Intronic
1003141331 6:3473930-3473952 TTCCAGTGACTGAATGTGGAGGG + Intergenic
1003342307 6:5233546-5233568 CTCCAGCCTCTGAATGTTGAAGG - Intronic
1004904186 6:20221040-20221062 ACACAGATGCTAAATGTGGATGG - Intergenic
1005872753 6:29987193-29987215 ATCCATTTGCTGAATTTGGAAGG - Intergenic
1008157378 6:48033427-48033449 CTCCTGTTGCTGAACTTGGATGG - Intronic
1009034235 6:58097287-58097309 GACAAAATGCTGAATGTGGATGG + Intergenic
1009209843 6:60848988-60849010 GACAAAATGCTGAATGTGGATGG + Intergenic
1010322274 6:74526258-74526280 CTACAGATGCTGCATATGTAAGG - Intergenic
1010516767 6:76782701-76782723 CTCCAGATATAGAATCTGGAGGG + Intergenic
1010616044 6:78013488-78013510 CTCCAGCTGGTTAGTGTGGAAGG + Intergenic
1012287221 6:97405631-97405653 CTCCACATTCTGAATCTGTAGGG + Intergenic
1013070882 6:106728335-106728357 CTCAAAAGGCTGAATGTGGAGGG - Intergenic
1013277250 6:108597373-108597395 CTTATGATTCTGAATGTGGAAGG + Intronic
1016152345 6:140757481-140757503 CAACAGATTTTGAATGTGGAGGG + Intergenic
1016558443 6:145367478-145367500 CAACAGATGCTGAATATGGGGGG - Intergenic
1017231011 6:152073815-152073837 TTGCAGATGCTGCATCTGGAGGG - Intronic
1018918840 6:168156764-168156786 TTGCAGGTGCTGAATGTAGACGG - Intergenic
1019717474 7:2546330-2546352 CTCGGGAAGCTGAATGGGGAGGG + Intronic
1020081401 7:5287896-5287918 CTCCAGCTGGTGACTGTCGAAGG - Exonic
1022165171 7:27752418-27752440 CTCCAGATGCTGAATCTCTCTGG - Intronic
1023214432 7:37847082-37847104 TTCCAGATGCTGCAAGTGGGAGG + Intronic
1024113299 7:46169227-46169249 CTCCAGAGGGTGCATGTGTATGG - Intergenic
1025197512 7:56944252-56944274 CTCCAGCTGGTGACTGTCGAAGG + Intergenic
1025674435 7:63632687-63632709 CTCCAGCTGGTGACTGTCGAAGG - Intergenic
1026138750 7:67686546-67686568 CTCCAGAGGCTGAGTGAGGCAGG + Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1028107640 7:86899054-86899076 CTGAAGATGATGGATGTGGATGG + Intronic
1028130433 7:87165773-87165795 GTCCAGATCATGAATGTGGTTGG + Intronic
1030622951 7:111812041-111812063 CTCCAGATGCTTACTGAAGAAGG - Intronic
1032584714 7:133135535-133135557 CTCCAGTTGCTGCAAGTAGAAGG + Intergenic
1032715687 7:134507241-134507263 CACTAGATGCTGAATCTGCAGGG + Intergenic
1033491197 7:141845565-141845587 CTCCAGTTGTTCAAAGTGGATGG - Intergenic
1033803969 7:144933863-144933885 CTCCAGATGTTGCATGTGGCAGG + Intergenic
1035446367 7:158945664-158945686 CTTCAGGTGCTGGATGTCGATGG - Exonic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1044668606 8:94655947-94655969 CTCCAGAGGCTGAAGCTGGAGGG + Intronic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047310366 8:123686748-123686770 CTCCAGAGGCTGGATGTGGTGGG + Intronic
1048524643 8:135190920-135190942 CCCCAGATGCTGAGTCTGAATGG - Intergenic
1049813663 8:144587970-144587992 CTCCAGTCTCTGAAGGTGGAAGG + Intronic
1053468579 9:38328483-38328505 CTCCAGAGTCTGGATGTAGATGG - Intergenic
1057470455 9:95351576-95351598 CAGCAGATGTTGACTGTGGATGG - Intergenic
1060077412 9:120604832-120604854 AACAAGATGATGAATGTGGAGGG - Exonic
1060316486 9:122516259-122516281 ATCAAGAGGCTGAATGTGGTGGG + Intergenic
1060799229 9:126533085-126533107 CTGTAAATGCTGAGTGTGGACGG - Intergenic
1061912614 9:133733044-133733066 CTCCAGCAGCTGAATGTGAGAGG + Intronic
1185523676 X:760797-760819 CTCCAGGTGCTGGACGTGGTGGG + Intergenic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186276095 X:7939665-7939687 CTCCACCTGCTGAGTGAGGAAGG + Intergenic
1186808525 X:13163847-13163869 CTCCAGAGGCTACATCTGGAGGG + Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1192314891 X:70043818-70043840 CTCAAGAGGCTCAATGTGGATGG + Intronic
1196065708 X:111462020-111462042 CTCTAGAAGCTGAAAATGGAAGG - Intergenic
1197093671 X:122569780-122569802 CACCAGATGCTGGATTTGGTAGG - Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197760547 X:130024980-130025002 CTACAGATGCTTCCTGTGGATGG - Exonic
1199607021 X:149585841-149585863 TTCCCGAGGCTGAATGAGGAGGG + Intronic
1199632101 X:149783527-149783549 TTCCCGAGGCTGAATGAGGAGGG - Intronic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1201317029 Y:12657591-12657613 CTCAGGTTGCTGAAGGTGGAAGG - Intergenic
1201553236 Y:15240559-15240581 CTCCAGAGGCTGAGGGGGGAGGG + Intergenic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic
1201940672 Y:19455782-19455804 CTCCAGAGGCTGATTGTGGGAGG + Intergenic