ID: 1172025272

View in Genome Browser
Species Human (GRCh38)
Location 20:31944124-31944146
Sequence CCTCATGCTCTGAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172025272_1172025276 6 Left 1172025272 20:31944124-31944146 CCTTCTGCCTTCAGAGCATGAGG 0: 1
1: 0
2: 1
3: 26
4: 246
Right 1172025276 20:31944153-31944175 CCCACTCATCCCTGTACCTGAGG 0: 1
1: 0
2: 0
3: 23
4: 347
1172025272_1172025281 24 Left 1172025272 20:31944124-31944146 CCTTCTGCCTTCAGAGCATGAGG 0: 1
1: 0
2: 1
3: 26
4: 246
Right 1172025281 20:31944171-31944193 TGAGGCACACCAACCCAGACAGG 0: 1
1: 0
2: 0
3: 9
4: 106
1172025272_1172025282 30 Left 1172025272 20:31944124-31944146 CCTTCTGCCTTCAGAGCATGAGG 0: 1
1: 0
2: 1
3: 26
4: 246
Right 1172025282 20:31944177-31944199 ACACCAACCCAGACAGGTCCAGG 0: 1
1: 0
2: 0
3: 19
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172025272 Original CRISPR CCTCATGCTCTGAAGGCAGA AGG (reversed) Exonic
900142009 1:1142640-1142662 CCTCGGCCTCTGAAGGCAGCCGG + Intergenic
901200638 1:7465239-7465261 CCCCATTCTGAGAAGGCAGATGG + Intronic
901739314 1:11331820-11331842 CCTCAGGCTGGGGAGGCAGAGGG + Intergenic
902179217 1:14675202-14675224 CCTCTTGGTGTGAAGGCAGTGGG - Intronic
902216861 1:14939832-14939854 GCTCCTCCTCTGGAGGCAGAAGG + Intronic
903269669 1:22179475-22179497 CCCCAGGCTCTGAAGACAGTGGG + Intergenic
903672607 1:25045591-25045613 GCTCAGGCTCTGGAGCCAGATGG + Intergenic
903996310 1:27307314-27307336 CCTGCTGCTCTGAGGGGAGAGGG + Exonic
905131299 1:35760542-35760564 CCTCATGCCCTGGAGGGTGAAGG - Exonic
907378596 1:54065826-54065848 CCTCAGCCTCTGAAAGCACATGG - Intronic
907622286 1:55993702-55993724 CCTCAGGCTCTGGAATCAGATGG - Intergenic
908756483 1:67473524-67473546 TCTGATTCTCTGAAGGAAGATGG + Intergenic
917669733 1:177262099-177262121 CCTTTTGCTATGAAGGCAAATGG + Intronic
917995906 1:180438169-180438191 CCTGATGATCTGAAGTCAAATGG + Intronic
918421740 1:184371131-184371153 CATCGTGCTCTCTAGGCAGAGGG - Intergenic
919582963 1:199400350-199400372 ACTCATTCTCTGAAGGTAGATGG - Intergenic
920721428 1:208390565-208390587 CTGCAAGCTCTGAAGGTAGAGGG - Intergenic
921571615 1:216786255-216786277 CCTCCTGTTATGAAGCCAGAAGG - Intronic
921576608 1:216842486-216842508 GCTGATGCTCTGAAGACAAATGG - Intronic
923000846 1:230005214-230005236 CCTCATGATGGGAGGGCAGAAGG - Intergenic
923103712 1:230838062-230838084 CCCCATGCCCTCCAGGCAGAAGG + Exonic
923184528 1:231558057-231558079 CCTCATCCTGTGAAGGGTGAGGG - Intronic
923800942 1:237207586-237207608 CTGCATGGTCTCAAGGCAGAAGG - Intronic
1063385005 10:5610889-5610911 CCTCATTCTCTGATGACAGGTGG + Intergenic
1065047078 10:21754303-21754325 CCTCACTCTCTCAAGGCAGCTGG + Intergenic
1065125908 10:22573999-22574021 GCTCCTGCTCTGCCGGCAGATGG + Intronic
1070283505 10:75067378-75067400 CCTCTTCATCTGAAGTCAGAGGG - Intergenic
1070735526 10:78861398-78861420 CCTCATTCTCTGCAGGGAAAAGG - Intergenic
1070944428 10:80377271-80377293 CCTCATGGGCTGCAGGCATATGG - Intergenic
1072039555 10:91594084-91594106 CCTGATACTCTGAAGGCCCAGGG + Intergenic
1072496660 10:95967933-95967955 CCTCTTTCTCAGAAGGGAGAAGG - Intronic
1073481595 10:103789337-103789359 CCTCATGCTCTGCCAGCTGAGGG + Intronic
1074891895 10:117742884-117742906 CCTTATGCTTTGCAGTCAGAAGG - Intergenic
1074931445 10:118130486-118130508 CCTCAGGCTTTGGAGTCAGATGG + Intergenic
1075749816 10:124757247-124757269 TCTCATACTCTCAAAGCAGAGGG + Intronic
1075874972 10:125798574-125798596 GCTCATGCTCAGGAGGCAGCCGG + Intronic
1075906184 10:126083755-126083777 CCTCATGGTGTGATGGGAGAGGG + Intronic
1076180178 10:128401209-128401231 GCTGATGTTCTGGAGGCAGATGG + Intergenic
1076895944 10:133312226-133312248 GGTCATGCTAGGAAGGCAGACGG - Intronic
1078064080 11:8066500-8066522 CCTCGTTCTCTGGAGGCAGCAGG + Intronic
1078131910 11:8620377-8620399 CCTCAGACCCTGTAGGCAGAAGG + Intronic
1078507580 11:11964324-11964346 CCTCATGCTGTCAAGCCAGAGGG + Exonic
1079303240 11:19298165-19298187 CACCATGATTTGAAGGCAGAGGG + Intergenic
1079999276 11:27328997-27329019 CCTTATGCGCAGAAGTCAGAGGG - Intergenic
1086981148 11:93198634-93198656 GCTCCAGCTCTGAAGGCAGAAGG - Intergenic
1091100389 11:132867498-132867520 CCTGAAGCTCTGCTGGCAGAGGG - Intronic
1091239523 11:134043184-134043206 ACAGATGCTCAGAAGGCAGAAGG - Intergenic
1091596446 12:1882113-1882135 CCTCATGCTCAGGAGGCTGGTGG - Intronic
1091667677 12:2431000-2431022 CTTCCTGCCCTGCAGGCAGAGGG + Intronic
1091694861 12:2621630-2621652 CCTGATGCTGGGAAGGCAGGTGG + Intronic
1093033791 12:14314117-14314139 CGTCTTGCTCTGATGGCATATGG - Intergenic
1094033663 12:26043170-26043192 CCTAATGCTTTGAAAGCACAGGG + Intronic
1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG + Intergenic
1104607119 12:130198326-130198348 TCTCATGCTCTGCAGGGAGGAGG - Intergenic
1105433864 13:20360820-20360842 CCTTATGTTCAGGAGGCAGATGG + Intergenic
1106844493 13:33723543-33723565 CCTCTTGTTCTGAATCCAGAGGG - Intergenic
1112822085 13:103349331-103349353 CATCCTGCTTTGAAGGCAGGTGG + Intergenic
1113058597 13:106296914-106296936 CCACATGCACTGAAACCAGAGGG + Intergenic
1114073299 14:19132250-19132272 CCTGATGCTCTGGAGGTAGTGGG + Intergenic
1114088967 14:19267733-19267755 CCTGATGCTCTGGAGGTAGTGGG - Intergenic
1114364566 14:22012823-22012845 CCTTTTGTTCTGAAGCCAGATGG + Intergenic
1114591262 14:23866906-23866928 CCACAGGCTCTGGAGGCAGACGG - Intergenic
1115460481 14:33654643-33654665 ATACATGCTTTGAAGGCAGATGG - Intronic
1117071394 14:52060175-52060197 GCTGATGATCTGAAGTCAGAAGG - Exonic
1117083485 14:52176022-52176044 CGTCCTGTTCTGAAGGCAGCGGG - Intergenic
1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG + Intronic
1119512874 14:75225499-75225521 CCTGCTGCTCAGAAGGCTGAGGG + Intergenic
1121659586 14:95624776-95624798 CCTCATGGTCAGGAGGCAGTAGG + Intergenic
1121698020 14:95928590-95928612 TCTCATGCTCTGCAGGCAGCTGG - Intergenic
1121791724 14:96704272-96704294 CCCCATGACCTCAAGGCAGATGG + Intergenic
1124022876 15:25939821-25939843 CCCCATGCTCTGGAGCCAGGTGG - Intergenic
1125032572 15:35087234-35087256 CCACATGCTGTGAGGGCAGGTGG - Intergenic
1125746041 15:41997838-41997860 CCTCATAGTCTGCAGGCAGGTGG + Intronic
1128732682 15:70031745-70031767 CCTGATGCTCTGTAGGCACAAGG - Intergenic
1129525691 15:76212676-76212698 GCTCAGGCTCTGGAGGCAGCAGG + Intronic
1130848252 15:87767647-87767669 CACCAAGCTCTGAATGCAGATGG + Intergenic
1132109960 15:99095830-99095852 CCTCACCCCCTGCAGGCAGAAGG + Intergenic
1132777902 16:1606089-1606111 CCGCTGGCTCTGAAGGCTGAGGG - Intronic
1134814967 16:17198283-17198305 CCGCATGCTCTGCAGGTAGGTGG + Exonic
1134827898 16:17299187-17299209 CCTACTGCACTTAAGGCAGACGG + Intronic
1135487635 16:22879847-22879869 CCCCATGCTTTGATGGCAGAAGG - Intronic
1135659872 16:24286916-24286938 CCTCCTGCTGTGAAGGAGGAAGG + Intronic
1135688812 16:24519933-24519955 CCTGTTGCTCTGAAGACAGGAGG - Intergenic
1137569110 16:49553119-49553141 GCACAGACTCTGAAGGCAGAAGG + Intronic
1137903335 16:52293189-52293211 CCTCATGTTCACAAGGAAGATGG - Intergenic
1140065957 16:71611275-71611297 ACTCAAGCTCTGGTGGCAGAGGG - Intergenic
1141570304 16:84930013-84930035 CCCCACGCTCTCAAGCCAGAAGG + Intergenic
1142249799 16:88986065-88986087 CCTCATGCTGTGACAGCAGGAGG - Intergenic
1143243765 17:5466078-5466100 CCTCAACCTCTGAATACAGATGG + Intronic
1144951767 17:18998220-18998242 CCAGCTGCTCTCAAGGCAGAGGG + Intronic
1145745987 17:27320035-27320057 CCTCCTGATCTGAGGCCAGATGG - Intergenic
1146949241 17:36894338-36894360 CCTCATGCCCTGAAGCATGAGGG + Intergenic
1147153116 17:38529892-38529914 CCTCATGCTCTGCCAGCTGAAGG + Intergenic
1147982004 17:44280511-44280533 CCTGCTGCCCTGAAAGCAGAGGG - Intergenic
1149541014 17:57468060-57468082 GCTCAGGCTCTAGAGGCAGATGG + Intronic
1150552962 17:66227925-66227947 CGTCATGCTCAGAGTGCAGAGGG - Intronic
1150618280 17:66789153-66789175 CCTTACTCTCTGAAGGCAGCAGG - Intronic
1150649220 17:66999028-66999050 TCTCAGGCTCTGAAGGATGATGG + Intronic
1150976457 17:70092787-70092809 CCTGAAGCTCTGATGGCTGAGGG + Intronic
1151221049 17:72613428-72613450 CCCCACCCTCTGAAGTCAGACGG + Intergenic
1152117839 17:78399568-78399590 CCTCCTGCTCTGCAGGCTGGAGG + Intronic
1152248021 17:79196023-79196045 CAGCCTCCTCTGAAGGCAGAGGG + Intronic
1152763485 17:82122161-82122183 CCACAGGCTCTGAAGGAGGAAGG - Intronic
1153456252 18:5285566-5285588 GCACAGGCTCTGGAGGCAGATGG + Intergenic
1153752069 18:8242686-8242708 TTTCATACTTTGAAGGCAGAAGG - Intronic
1155239419 18:23851367-23851389 CTTCTTGGTCTGGAGGCAGAAGG - Intronic
1156515185 18:37673411-37673433 CCTCCTGCTCTGCCAGCAGACGG - Intergenic
1157404843 18:47414191-47414213 GCCCAGGCTCTGAAGGCAGGAGG - Intergenic
1160013626 18:75125091-75125113 CCAAATGCTCTGAGTGCAGAGGG - Intergenic
1160014563 18:75130655-75130677 TGTGATGCTCTGATGGCAGAGGG + Intergenic
1160265985 18:77341140-77341162 CCACATGCTGTGAGTGCAGAAGG - Intergenic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1164684476 19:30157839-30157861 CCTCACGTGGTGAAGGCAGAAGG - Intergenic
1164773948 19:30836191-30836213 CCTCAAGTTCTGAAAACAGACGG + Intergenic
1165045637 19:33102853-33102875 CCCCATGCTCTGAAGCTAGCAGG + Intronic
1166996706 19:46722942-46722964 CCCCGTGCTCTGAGGGCACAGGG + Exonic
1167769093 19:51502621-51502643 CCTCATGCTCTGGAGTAAGGAGG - Intergenic
1168256118 19:55166277-55166299 GCTCAGGCTGGGAAGGCAGACGG + Intronic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
927671883 2:25075216-25075238 CCTGCAGCTCTGAAGTCAGAGGG + Intronic
927972956 2:27317094-27317116 TTTCATGCGCAGAAGGCAGAGGG + Intronic
928948338 2:36792016-36792038 CTTCCTGCTCTGAAGTCTGAGGG - Intronic
930002726 2:46871872-46871894 ACTCATGCTGGGAGGGCAGAAGG - Intergenic
930501077 2:52218322-52218344 CTTCCAGCTCTGAAGACAGAGGG + Intergenic
931219625 2:60277477-60277499 CCTCAGGATCTGAAGGGAAAGGG + Intergenic
931627314 2:64268334-64268356 CCCCATGCTATGGAGGCAAATGG + Intergenic
931653157 2:64486916-64486938 CCTTATGCTCTGCAGGCACTGGG + Intergenic
931723247 2:65082912-65082934 CCTCATCCTCAGCAGGCAGCAGG - Intronic
931843285 2:66176990-66177012 CCAGATGCCCTGAAGACAGATGG + Intergenic
933221521 2:79695599-79695621 CTTCATGTTTTGAAGACAGAGGG - Intronic
933336607 2:80967230-80967252 CCTCATGATCTCAGGGAAGAAGG - Intergenic
933895340 2:86806276-86806298 CCTCATGCTCTGAGGGTAAGTGG - Intronic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
941721040 2:168813215-168813237 CTTCCTGCTCTGCAGGCAGAAGG - Intronic
942231008 2:173860851-173860873 CCTCTTCCTCTGAGGGCGGAGGG + Intergenic
944597448 2:201274185-201274207 CCTTAGGCTCAGCAGGCAGAGGG - Intronic
944673676 2:202017041-202017063 CCTCCAGTTCTGAAGCCAGATGG + Intergenic
945044665 2:205771227-205771249 CACCATGCTCATAAGGCAGATGG + Intronic
945049087 2:205806483-205806505 CCTGATGCCCAGAAGGCTGAGGG - Intergenic
946604967 2:221393529-221393551 CCTCTTGCTCAAAAGGCAGGTGG + Intergenic
947081741 2:226405843-226405865 CATCATGCTCTGAAGAAAAAAGG - Intergenic
949057774 2:241937845-241937867 CCTCAGCCTCTGAAGGCACTGGG + Intergenic
1169209286 20:3756632-3756654 CCTCATGCTCTGCTGGTAGGGGG + Intronic
1172025272 20:31944124-31944146 CCTCATGCTCTGAAGGCAGAAGG - Exonic
1172383546 20:34516516-34516538 CCTCATCCTCGGAAGACTGAAGG - Intronic
1172601576 20:36187523-36187545 CCTCCTGCTCTGAGGGCAGAGGG + Intronic
1175766471 20:61596074-61596096 CCTCATGCTCTGAGGACAGTTGG - Intronic
1176257515 20:64159934-64159956 CCTCAGGCCCTGCAGGCAGAGGG - Intronic
1176880570 21:14187370-14187392 CCTCAGGCTTTCAAGGCACAAGG + Intronic
1177029825 21:15968516-15968538 GGACATGCTCTAAAGGCAGAAGG - Intergenic
1177326155 21:19591827-19591849 CCACCTGCTCAGGAGGCAGAGGG - Intergenic
1177500365 21:21947200-21947222 CCACCTGCTCAGAAGGCTGAGGG + Intergenic
1177776548 21:25573939-25573961 CCTCATCCTCTGAGTGCTGAAGG + Intergenic
1178627560 21:34230998-34231020 CCTCAGGCAAGGAAGGCAGATGG - Intergenic
1179128254 21:38611484-38611506 CCTCAAGCTCAGAAGGCAACTGG + Intronic
1179291322 21:40020649-40020671 GCTCATGGTCTGACGGCAGGAGG + Intronic
1180137424 21:45870830-45870852 CATCCTGTTCTGAAGGCAGAGGG + Intronic
1180491739 22:15854603-15854625 CCTGATGCTCTGGAGGTAGTGGG + Intergenic
1182286855 22:29253916-29253938 CCTGCTGCGCTGAAGGCAGGGGG - Intronic
1182444842 22:30384098-30384120 CCTCATGTTCTGCAGGCATTGGG - Intronic
1182460284 22:30478683-30478705 CCCCAGGCTCTGTTGGCAGAGGG + Intergenic
1182576784 22:31278363-31278385 CCTCCAGCTCTGCAGGCAGCGGG - Intronic
1183309259 22:37100631-37100653 CCTCATGGTCTGAAAGCATAGGG + Intronic
1185117232 22:48944806-48944828 CCTCACGCTCTGATTGCTGATGG - Intergenic
1185137016 22:49078987-49079009 CCCCATGCTCTGGAGCCAGCTGG + Intergenic
1185312570 22:50164487-50164509 GCGAAGGCTCTGAAGGCAGAGGG + Intergenic
1185376473 22:50484745-50484767 CCTCATGCCCTGTAGTCAGGAGG + Exonic
949858683 3:8485759-8485781 CATCCTGCTCTGGAGACAGAAGG + Intergenic
950105242 3:10384470-10384492 TCTGTTGCTCTGAAGCCAGAAGG + Intronic
950554272 3:13685860-13685882 GCTCAGGCTGTGAAGCCAGAGGG + Intergenic
950777829 3:15365621-15365643 CCTCACTCACTGCAGGCAGAGGG - Intergenic
952375564 3:32764370-32764392 CCTCGGGCTCAGAAGGTAGAGGG - Intronic
953363466 3:42321795-42321817 CCCTTTGCTCTGAAGCCAGATGG + Intergenic
953454294 3:43029683-43029705 CCTCATGTCCAGGAGGCAGAAGG + Intronic
959651866 3:108758042-108758064 CCTCATGGTCACAAGGTAGAAGG + Intergenic
960417079 3:117397863-117397885 CCGCATGCTCTGGATGCAGGGGG + Intergenic
961465252 3:127077350-127077372 CCTCCTGGCCTAAAGGCAGAAGG + Intergenic
962378013 3:134874887-134874909 CCGCCTGGTATGAAGGCAGAGGG - Intronic
962964966 3:140345026-140345048 CGACATGCCCTGAAAGCAGATGG - Intronic
963234839 3:142946588-142946610 CCTCATGCTGTGAATGGAAAGGG + Intergenic
966631767 3:182084127-182084149 CCGCATGCTCTGAGGGAAGAGGG - Intergenic
968904396 4:3444805-3444827 CATCAGGCTCTGCGGGCAGAGGG - Exonic
970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG + Intronic
971983022 4:33779726-33779748 GCTCATGATTTGAAAGCAGATGG + Intergenic
972335542 4:38104512-38104534 CCACATGCTCTAAAAGCAGCAGG - Intronic
976830189 4:89306923-89306945 CTTCATGCTCTCCAGGCAGATGG - Intronic
983640874 4:169942969-169942991 CCTCATCCTCTGGGGGCAGAAGG + Intergenic
983777406 4:171625166-171625188 CCTCAGGCTCTGAAGTCACTGGG - Intergenic
984034490 4:174648682-174648704 CCTCATTCTGGGAAGGCAGGAGG + Intronic
984100871 4:175484349-175484371 CCACCTGCTCTGATGGCTGAGGG + Intergenic
984642261 4:182180455-182180477 CCAGATGCTATGAAGGTAGATGG - Intronic
985546775 5:513903-513925 CCTCTCCCTCTGAAGGCAGGCGG + Intronic
985661714 5:1160561-1160583 CCCCATGATCTCGAGGCAGAGGG - Intergenic
985733315 5:1563664-1563686 CCTCTGTCCCTGAAGGCAGAGGG + Intergenic
986203724 5:5602945-5602967 CCCCATGCTGTGATGGTAGATGG + Intergenic
986243260 5:5980605-5980627 CCTCTTCCCCTGAAGCCAGAGGG - Intergenic
987049685 5:14139032-14139054 CCACATGCTCAGATAGCAGAAGG + Intergenic
987081957 5:14433360-14433382 CCTCCTGCTCTGGAGGGAAAGGG - Intronic
987246348 5:16053095-16053117 CCTTTTACTCAGAAGGCAGAAGG + Intergenic
987246497 5:16054363-16054385 CCTTTAACTCTGAAGGCAGAAGG - Intergenic
987428091 5:17796283-17796305 CCTCTTGCTCTGGAGGAAGCTGG + Intergenic
990357106 5:54979427-54979449 TGTCATGCTCTGAAAGTAGACGG + Exonic
991193153 5:63899906-63899928 CTTCATGTTCTGTAGGCAGTTGG - Intergenic
992459203 5:76944350-76944372 CCTGGTGCTCTGGAGGAAGATGG + Intergenic
992527638 5:77628280-77628302 CTCCAGGCTCTGAAGGCCGAGGG + Intergenic
994385652 5:99128353-99128375 CCTCATACAATCAAGGCAGACGG - Intergenic
995964559 5:117888912-117888934 CCTCTTGCTCTGAAGATAAAAGG - Intergenic
996857070 5:128020220-128020242 GCATATGCTCTGAATGCAGATGG + Intergenic
1000365354 5:160485536-160485558 TCTCAGGCTCTGAAGGTATAAGG + Intergenic
1001343022 5:170864440-170864462 CCTAATGCTTGGAGGGCAGAGGG + Intronic
1001700518 5:173703398-173703420 ACACATGCTATCAAGGCAGAGGG + Intergenic
1001911483 5:175522269-175522291 CGTAATGCTCTGAAGAAAGAAGG + Intronic
1002643538 5:180641692-180641714 CCTTAAGCTCTGAAGGCACAGGG - Intronic
1003116187 6:3285329-3285351 CCTCAGGCTCTGAGGCCAGCAGG - Intronic
1003931953 6:10932581-10932603 TCTCATGCTCTGTAAGGAGAGGG + Intronic
1006104790 6:31710138-31710160 CATCGTGCTCTGGAGGCAGAGGG + Exonic
1007198876 6:40088447-40088469 CCTCAAGCTCTGAAGGGGGAGGG - Intergenic
1007251819 6:40500357-40500379 TCTGAGGCTCTGAAGCCAGAGGG - Intronic
1007304888 6:40896110-40896132 CATCATGTTTTGAAGGAAGAAGG - Intergenic
1008028262 6:46663408-46663430 CTACATGCTTTGAAGGCTGAAGG - Intronic
1009874492 6:69488808-69488830 AATCCTGCTCTGAAGCCAGATGG - Intergenic
1011344700 6:86356089-86356111 CCTCATGCTTGCAAGGCACATGG - Intergenic
1011899551 6:92275264-92275286 CCTCAGGTTCTGTGGGCAGAGGG - Intergenic
1013139034 6:107312365-107312387 CCTCATGTTCATAAGACAGAGGG - Intronic
1013545250 6:111150509-111150531 CCTCATCCTTTAAATGCAGAGGG - Intronic
1014803755 6:125806367-125806389 ACCCATGCTATTAAGGCAGAAGG - Intronic
1015571045 6:134621798-134621820 AAACATGCTCTGAAGGCCGAAGG + Intergenic
1017671117 6:156770477-156770499 CCTCATGCTGTGCAAGCAGGTGG + Intergenic
1018569141 6:165188391-165188413 GCTCAGGCTCTGAATACAGAAGG - Intergenic
1018945885 6:168346407-168346429 CCACATCCTCTGGAGCCAGATGG + Intergenic
1019194677 6:170274160-170274182 GCTGGTGCTCAGAAGGCAGATGG - Intergenic
1019387871 7:768624-768646 GCTCATGCTGGGAAGGCAGATGG + Intronic
1024005149 7:45219848-45219870 CCTCAGGCACAGGAGGCAGATGG - Intergenic
1024083080 7:45872407-45872429 CCTCATGCTCTAGATGCAAAAGG - Intergenic
1024991954 7:55241807-55241829 CATCAGGCTCTGAAGCCACAGGG - Intronic
1030492796 7:110258977-110258999 CCTCATGCTCTGAGGGTACTTGG - Intergenic
1031987433 7:128172219-128172241 CCCCAGGCTGTGAAGGCAGGTGG - Intergenic
1033267399 7:139897931-139897953 CCTCTTGCTCTAATGACAGACGG + Intronic
1033532556 7:142279852-142279874 TCTCATGCTTTGCAGGCAGCTGG - Intergenic
1034485198 7:151356480-151356502 CTGCATGCACTGAAGGCAGTGGG - Intronic
1035552435 8:539286-539308 CTACATCCTCTCAAGGCAGAGGG - Intronic
1037480820 8:19303564-19303586 CCTAATGTTCTGGAGGGAGATGG + Intergenic
1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG + Intronic
1038671814 8:29589141-29589163 CTTCATGCTCTGAAGCCAGTAGG + Intergenic
1038882244 8:31627762-31627784 CCTCAAGCTCTTAAGGCTCAAGG + Intergenic
1039167848 8:34706307-34706329 CCTCATGCACTGTAAGCAGAAGG - Intergenic
1044213433 8:89579108-89579130 CCGCATCCTCACAAGGCAGAAGG - Intergenic
1045677241 8:104620767-104620789 ACTGATGGACTGAAGGCAGAAGG + Intronic
1046783056 8:118236277-118236299 TCTAATGCTATGAAGGCACATGG - Intronic
1047181827 8:122595760-122595782 CCTGATGGTCCTAAGGCAGATGG + Intergenic
1049612350 8:143561496-143561518 CCTCATGTTCTCAGGGCACAGGG + Intronic
1051354919 9:16232589-16232611 CCTAATGCCCTGAAGGCATTAGG - Intronic
1052647808 9:31259928-31259950 CCTCATGCTGTGTAGCCACATGG - Intergenic
1053275836 9:36782686-36782708 CCCCATGCTCTGGAGGCAGCTGG - Intergenic
1055891514 9:81129146-81129168 TCTCATCCCCTGAAGACAGAGGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058410343 9:104724702-104724724 CCTCCTGGTCAGAACGCAGAGGG + Intergenic
1060932300 9:127496828-127496850 GCTCAGGCTCTGGAGGCTGAGGG + Intronic
1062495361 9:136828967-136828989 CCCCATGCTCTAAAGGGAGTGGG - Intronic
1185639962 X:1584434-1584456 CCTCAGCCTCTGAAAGCAGTGGG + Intergenic
1186107311 X:6221558-6221580 CCTCATGCCCTGAAGCTACATGG - Intronic
1186984613 X:14998619-14998641 CCTAATGACCTAAAGGCAGAGGG - Intergenic
1189076509 X:37921046-37921068 CCTCATGCACAGAAAGCACAAGG - Intronic
1189922136 X:45912897-45912919 CCCCAGGCTGTGAAGGCAGCAGG - Intergenic
1189952727 X:46248901-46248923 CCTCAAGGTCTGAAGGGACAAGG - Intergenic
1193127279 X:77883289-77883311 CCTCGTGATCTGCCGGCAGATGG - Intronic
1193693775 X:84681058-84681080 GCTCAGGCTCTGAAGGCGGAAGG + Intergenic
1194590776 X:95797625-95797647 CCTGAGGCTCTGAAGGCAGTGGG - Intergenic
1195044203 X:101041459-101041481 TCTCATGCTCTCTAGGGAGATGG + Intronic
1196195295 X:112832911-112832933 AGTCACTCTCTGAAGGCAGAAGG + Intronic
1196709276 X:118745608-118745630 CCTCATGCTCAGCTGGCAGCAGG + Intronic
1197808087 X:130416377-130416399 CCTCATGCACTGAGGTCAGCAGG - Intergenic
1198742999 X:139860910-139860932 CCTCATGCTTTGATCTCAGATGG - Intronic
1200746289 Y:6906991-6907013 CCTCATGCTCTCAAAGCAGTGGG + Intergenic