ID: 1172025435

View in Genome Browser
Species Human (GRCh38)
Location 20:31945287-31945309
Sequence GGCTCACCACAGCCATCTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172025435 Original CRISPR GGCTCACCACAGCCATCTGT GGG (reversed) Exonic
901006155 1:6172568-6172590 GCTTCACCACTGCCAGCTGTAGG - Intronic
901441237 1:9279746-9279768 GGTTCAACACAGCCCTCGGTGGG - Intergenic
903174615 1:21573552-21573574 GGCTCCCCACAGCCAGCTTGGGG - Intronic
903608667 1:24593672-24593694 GCCTCAACACAGCCATCTACTGG - Intronic
903749397 1:25611390-25611412 GGCTCACCCCAGCAGGCTGTGGG - Intergenic
904155680 1:28481101-28481123 GGCTCACCACCTCCAACTCTTGG + Intronic
907907065 1:58792240-58792262 GGCCAACCACAGATATCTGTGGG + Intergenic
910629642 1:89341828-89341850 GGCTCAGCCCAGCAGTCTGTAGG + Intergenic
913088749 1:115461758-115461780 GGCTCACCTCACCCCTCTGCTGG - Intergenic
916194793 1:162212746-162212768 GACTCTCCACAGCCATCTCATGG - Intronic
916603964 1:166322993-166323015 AGCTGACCACAGCTTTCTGTTGG + Intergenic
923517542 1:234710110-234710132 GCCCCACCCCAGCCATCTGTTGG + Intergenic
924405085 1:243735732-243735754 TGCTCACCACAATCACCTGTGGG + Intronic
1064020353 10:11804445-11804467 GGCTCACACCAGCGATCTGCCGG - Intergenic
1064956992 10:20922296-20922318 GCCTCACAACAGCCATGGGTAGG - Intronic
1066002941 10:31121270-31121292 GGCTCACCCCAGACAGGTGTCGG - Intergenic
1068409167 10:56632705-56632727 GGGTCACCTGTGCCATCTGTGGG - Intergenic
1074386508 10:113020681-113020703 TTCTCACCACAGCCCTCTGAAGG + Intronic
1075023718 10:118968727-118968749 GGCTCACTGCAGCCATCTGGAGG - Intergenic
1076365895 10:129920951-129920973 GGCTCACAACAGCCTTCTGGTGG - Intronic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078930647 11:15909995-15910017 GGCCCAACACAGCCATCAGTAGG + Intergenic
1081709051 11:45205361-45205383 GGCTCAGCTCAGCCATCCCTGGG - Intronic
1083881725 11:65552241-65552263 GACTCACCGGTGCCATCTGTTGG + Exonic
1085051953 11:73384535-73384557 GCCTTACCACAGCCCTCTGCAGG + Intronic
1085923169 11:80982855-80982877 GGCTCATCAAAGCCATCATTAGG + Intergenic
1086092600 11:83019930-83019952 AGCTCACCACTGTCATCAGTAGG - Intronic
1087056338 11:93940106-93940128 TGCTCACTCTAGCCATCTGTGGG + Intergenic
1088842771 11:113640569-113640591 TGCTCCACACAGCCCTCTGTGGG - Intergenic
1091447034 12:549779-549801 GGCCCACCTCATCCATCTGTAGG - Exonic
1092191728 12:6526275-6526297 TGCTCTCCACAGCCTTCTCTGGG + Exonic
1092741113 12:11630508-11630530 GGCACACCCAAGCCAGCTGTTGG + Intergenic
1097009053 12:55939562-55939584 GGGTCAGCCCAGCTATCTGTGGG + Intronic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1099005645 12:77232196-77232218 TGCTAACCACAGCCAGATGTTGG + Intergenic
1099223395 12:79940380-79940402 GGTTCACCCAAGCCATCTTTGGG + Intergenic
1099661503 12:85568758-85568780 GGTTCACCACAGCCTTCCATGGG + Intergenic
1104434344 12:128743761-128743783 GCCTCACCCCAGACATTTGTGGG - Intergenic
1105281592 13:18965684-18965706 GGCGCGCCACAGCCATATGCAGG - Intergenic
1110570834 13:77001265-77001287 GGCACACCATATCTATCTGTAGG - Exonic
1112540000 13:100299785-100299807 GGCTCACTACAGCCTTCTCCTGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114200502 14:20515546-20515568 GTCTCCCCACTGCCATGTGTGGG + Intergenic
1116330954 14:43597142-43597164 GGCTCACACCAGCTTTCTGTTGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1124822515 15:33061061-33061083 CCCACCCCACAGCCATCTGTGGG - Intronic
1125492168 15:40156452-40156474 GGCTGACTACTGCCAGCTGTGGG - Intergenic
1126203103 15:46011497-46011519 GGCTCACTGCAGCCATCACTGGG + Intergenic
1129831703 15:78675205-78675227 GGCTCAGCACTGCCCTGTGTTGG + Intronic
1130859887 15:87876400-87876422 AGCTCACCACAGGCACATGTGGG - Intronic
1130992382 15:88883444-88883466 ACCTTACCACAGCCCTCTGTAGG - Intronic
1135226182 16:20660325-20660347 GGCTCAGCCCAGCCAGCTCTTGG + Intronic
1135550288 16:23392413-23392435 GGCTCAGCTCAGGGATCTGTAGG + Exonic
1139528760 16:67531353-67531375 GGCTCACCACAGCGCTCTGGGGG - Intronic
1139556138 16:67712203-67712225 AGCTCACCAAAACCATCAGTAGG + Intronic
1140988182 16:80179901-80179923 GGCTCTCCAGAGCCAGCTGTGGG - Intergenic
1141322051 16:83020383-83020405 GCCTCCCCACTGCCCTCTGTGGG + Intronic
1141743388 16:85909397-85909419 GCCTGACCACAGACATTTGTAGG + Intronic
1141855486 16:86678215-86678237 GGCTCTCCACAGCCACCGGAAGG - Intergenic
1142508284 17:379827-379849 GACTCCCCACAGCCAGCTGGGGG + Intronic
1142604962 17:1076533-1076555 GGCTCCCCGCAGCCCTCTCTTGG + Intronic
1142625201 17:1187359-1187381 GGCTCCCCAGCGCCATCTGGCGG + Intronic
1143703449 17:8679631-8679653 GCCTCACCACAGCCCTCTAAGGG - Intergenic
1144547728 17:16213708-16213730 GGCTCACAACAGCCAACCCTAGG + Intronic
1144590094 17:16516372-16516394 CACTCACCACATCCATCTGATGG + Intergenic
1144613992 17:16751837-16751859 TGCTCCCCACAGCCATCTGCTGG - Intronic
1145133654 17:20381889-20381911 TGCTCCCCACAGCCATCTGCTGG - Intergenic
1147532144 17:41289395-41289417 GGCTCATTACACCCATCTTTTGG + Intergenic
1148587627 17:48792018-48792040 GTCCCACCTCAGCCATCTGAGGG + Intronic
1148890034 17:50800630-50800652 GTCACACCACTGCCATGTGTTGG - Intergenic
1151352374 17:73539420-73539442 GGCTCAGCACAGCCAGGAGTGGG + Intronic
1152431928 17:80253071-80253093 GGCTCACCAGTGCCACCTGCGGG + Exonic
1154350662 18:13580554-13580576 GTCCCACCTCAGCCATCTGCAGG + Intronic
1155729137 18:29130338-29130360 GGCCCACCACTGCAATCTTTAGG - Intergenic
1158180802 18:54713146-54713168 GGCCCACCACACCCCTCTCTTGG - Intergenic
1158702458 18:59760746-59760768 GGGTCACCACAGTCAGCTATTGG + Intergenic
1160043458 18:75366015-75366037 GGCTCACCACTGACATCTGGTGG + Intergenic
1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG + Intergenic
1162098107 19:8322804-8322826 GGCTCACTACACCTAGCTGTGGG - Exonic
1163127910 19:15254328-15254350 GGCACACCCCATCCATCTGGAGG + Intronic
1163816260 19:19466362-19466384 GCCACACCACAGCCCTCAGTGGG - Intronic
1165988106 19:39788069-39788091 GGCTCACCACTGCCACCACTGGG + Intergenic
927252607 2:21011246-21011268 GGCTCAACACAGACATCGCTGGG - Exonic
927364714 2:22281036-22281058 TGCACACCAAAGCCTTCTGTAGG + Intergenic
928451365 2:31381357-31381379 GGCTCACCACAGCCTGCTGTTGG - Intronic
929442381 2:41974129-41974151 GGCTCACCACAGCTTACAGTGGG + Intergenic
929521518 2:42656670-42656692 CGCTCACCGCATCCATGTGTGGG + Intronic
937226497 2:120373484-120373506 GCATCACCAAAGCCAACTGTGGG - Intergenic
938636281 2:133230215-133230237 GACCCACCACAGGCATCTGGTGG + Intronic
939443918 2:142284620-142284642 GGCTCACCACAGGAATTTATTGG - Intergenic
944077767 2:195751623-195751645 GGAACACCACTTCCATCTGTTGG - Intronic
947140859 2:227018354-227018376 GGCTGACCTGGGCCATCTGTAGG - Intronic
948395029 2:237639132-237639154 AGCTAACCACAGCCACCTGAAGG - Intronic
948730422 2:239959985-239960007 GGCACTCCACAGCCGCCTGTGGG - Exonic
1169189237 20:3646888-3646910 GGCACACCAGAGCCATCTGCAGG + Exonic
1169621821 20:7515542-7515564 GACTCTCCACAGCCTGCTGTGGG + Intergenic
1170573993 20:17648944-17648966 GTCTGACCACAGCCGTCTGGGGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172025435 20:31945287-31945309 GGCTCACCACAGCCATCTGTGGG - Exonic
1175319714 20:58076606-58076628 AGCTCACCCCACCCAGCTGTGGG - Intergenic
1175543258 20:59761451-59761473 GGCTCACCACATCCATCCTTGGG + Intronic
1176307652 21:5132545-5132567 GGCACATCCCAGCCTTCTGTAGG + Intronic
1178806422 21:35843408-35843430 GATGCACCACAGCCAGCTGTGGG + Intronic
1178808744 21:35861514-35861536 GGCTCTCCACATCCATCTCCTGG - Intronic
1179849408 21:44129485-44129507 GGCACATCCCAGCCTTCTGTAGG - Intronic
1180023132 21:45141937-45141959 GGATCACCTTAGCCATTTGTGGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180852245 22:19027512-19027534 GGATCAGCACAGCCAGCTGCTGG + Intergenic
1180976501 22:19851622-19851644 GCCTCACCACAGGCAGCTGAGGG + Exonic
1181537764 22:23555577-23555599 GGCCCACCCCTGACATCTGTGGG + Intergenic
1181604334 22:23971203-23971225 TGCTCTCCACACCCATCTGCAGG - Intronic
1182612602 22:31561449-31561471 GGCCCAGCACTGCCCTCTGTGGG - Intronic
1183018023 22:35006063-35006085 GGCTCTACCCAGCCTTCTGTGGG + Intergenic
1184194597 22:42918441-42918463 AGTTCACCTCACCCATCTGTTGG - Intronic
1184322708 22:43754646-43754668 TGCTCACCACAGCCTTATTTTGG + Intronic
1184650771 22:45918622-45918644 GCCTCACCACCGGCAGCTGTGGG + Intergenic
1185132419 22:49046714-49046736 GGCTCCCCACCGCCCTCTGGAGG - Intergenic
949716300 3:6935613-6935635 GTCTCTCCAGTGCCATCTGTTGG - Intronic
953710930 3:45270180-45270202 GACTCACCAGAGCCACATGTAGG + Intergenic
953870986 3:46627546-46627568 GCCTCTCCAGAGCCATCTGCAGG - Intergenic
953923493 3:46968085-46968107 GGCTCACCATAGGTATGTGTTGG + Intronic
953969295 3:47334588-47334610 GGCTCTCCACTGCCAACTGCAGG - Intronic
962007731 3:131364031-131364053 GGTTCACCACAGCAATTGGTGGG + Intergenic
962031425 3:131604705-131604727 GTCCCACAACAGCCATCTGCAGG - Intronic
962990965 3:140577145-140577167 GGATCATCACAGGAATCTGTTGG + Exonic
965000337 3:162944850-162944872 GCCTCACCACAGCCTTTTCTGGG - Intergenic
967100245 3:186210210-186210232 GCCTAACCACAGCCAGCTGCAGG - Intronic
968742010 4:2335832-2335854 GGCCCACCACAGCCACAGGTTGG + Intronic
969492791 4:7509603-7509625 GGTTCACCCCAGCCCCCTGTGGG - Intronic
971330930 4:25680877-25680899 CACTCACCACTGCCATTTGTTGG - Intergenic
972640050 4:40917079-40917101 GGCTCATTACTGCCACCTGTGGG + Intronic
978195687 4:105969201-105969223 GACACATCAAAGCCATCTGTGGG + Exonic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986070144 5:4274802-4274824 GGGTCTCCACAGCCACCTTTGGG + Intergenic
986180488 5:5388780-5388802 GAATCACCACAGCCATGTGAGGG + Intergenic
986573625 5:9190518-9190540 GGGTGGCCACAGCCAGCTGTGGG - Intronic
993143293 5:84061786-84061808 GACTTACCATTGCCATCTGTTGG - Intronic
993362712 5:86997899-86997921 GGCAGACCACAGGCATCTGGTGG - Intergenic
996393043 5:122984154-122984176 TGATCATCACAGCAATCTGTTGG + Intronic
998127325 5:139633463-139633485 GGGTCACCACTGCCCTCTGCTGG - Intergenic
1002093668 5:176818534-176818556 GGCTAACCTCACCCACCTGTAGG - Intronic
1002347374 5:178557433-178557455 GGCTCACCAGAGCCAGCTCAGGG + Intronic
1002928259 6:1617522-1617544 GGGGCCCCACAGCCTTCTGTGGG - Intergenic
1004415298 6:15417946-15417968 GCCCTACCACAGCCATCTGTAGG + Intronic
1006309113 6:33244846-33244868 GGCTCACCACAACCTCCTCTGGG + Intergenic
1007132329 6:39487313-39487335 GGCTGACCTCTGACATCTGTGGG - Intronic
1007706720 6:43795601-43795623 GGCACACCACTGGCATCTGGGGG - Intergenic
1013803852 6:113975416-113975438 GGCTCCCCACAGTCATCTGAGGG - Intronic
1013917806 6:115363307-115363329 TGCCCACCACAGCCAGCTTTAGG + Intergenic
1014873482 6:126626594-126626616 GGCTTACCAAAGCCAACTGTGGG - Intergenic
1016431206 6:143988149-143988171 GGCTAAACACAGTCATCTGGTGG + Intronic
1018768302 6:166951350-166951372 GCCTGCCCACAGCCATCTGGAGG - Intronic
1018816598 6:167337117-167337139 TGCTGACCACAGCCAGCGGTTGG - Intronic
1019165039 6:170093155-170093177 AGCTCACAACAGCCAACTGCGGG + Intergenic
1019478072 7:1253707-1253729 GGCCCAACACACCCATCTCTGGG + Intergenic
1019934824 7:4247270-4247292 GCCTCACCACACCCACCTGCTGG - Intronic
1023103259 7:36739970-36739992 AGATTTCCACAGCCATCTGTGGG - Intergenic
1024938609 7:54739223-54739245 GGCTCTCCTCAGCAATCTTTAGG + Intergenic
1025610646 7:63073219-63073241 GGCACATCACTGCCCTCTGTGGG - Intergenic
1032078606 7:128847836-128847858 GGCCCAGCACAGCCACCTGCAGG - Exonic
1032879212 7:136071296-136071318 GGCTTAGCCTAGCCATCTGTGGG - Intergenic
1034098755 7:148433934-148433956 GGCTGTCCACAGCCTTCTGCTGG + Intergenic
1034938776 7:155216620-155216642 TACTCACCACAGTCATTTGTGGG + Intergenic
1035033491 7:155880126-155880148 GGCTCACCACAGACATCTGATGG + Intergenic
1035636466 8:1149837-1149859 GGATCACCACAGTCATCTCTAGG + Intergenic
1037831845 8:22194433-22194455 GTGTCCCCACAGCCATCTGCGGG + Exonic
1039455077 8:37700654-37700676 GGCTCCCCTCAGCCATCGCTGGG + Intergenic
1043857798 8:85281371-85281393 GTCTCTCCACAGCCATGTTTGGG - Exonic
1049751343 8:144285764-144285786 CGCCCGCCACAGCCATCTGGAGG - Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054708168 9:68483952-68483974 GGCTCCCCACAGCAAACTGCTGG - Exonic
1057132235 9:92662034-92662056 GGGTCAACACAGCCACCTGGGGG + Intronic
1057696302 9:97325105-97325127 GGCACACCAGAGCGAGCTGTTGG + Exonic
1058331178 9:103762619-103762641 GGTTCACCGCAGCCTTATGTTGG - Intergenic
1060527406 9:124328331-124328353 GTTTCACCACGCCCATCTGTGGG + Intronic
1061870051 9:133515698-133515720 GGCTCACCCCAGCCCTCTCCCGG + Intronic
1062665949 9:137671899-137671921 GCCTCTCCACAGCCACATGTCGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203462985 Un_GL000220v1:59669-59691 AGCTCACCACTGCCATCACTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1195026449 X:100882298-100882320 TGCTCACCACAGCCCTGTGATGG - Intergenic
1198644525 X:138791315-138791337 GACTAACTACAGCCATCAGTTGG - Intronic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic