ID: 1172030995

View in Genome Browser
Species Human (GRCh38)
Location 20:31981997-31982019
Sequence AGTGCTATTGGAGGACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172030995_1172030998 0 Left 1172030995 20:31981997-31982019 CCTGGCTGTCCTCCAATAGCACT No data
Right 1172030998 20:31982020-31982042 GCCATCCACAGTGCTGAAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 241
1172030995_1172031002 13 Left 1172030995 20:31981997-31982019 CCTGGCTGTCCTCCAATAGCACT No data
Right 1172031002 20:31982033-31982055 CTGAAGCAGGGACCTCTGTTTGG 0: 1
1: 0
2: 1
3: 22
4: 233
1172030995_1172031000 1 Left 1172030995 20:31981997-31982019 CCTGGCTGTCCTCCAATAGCACT No data
Right 1172031000 20:31982021-31982043 CCATCCACAGTGCTGAAGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 193
1172030995_1172031003 24 Left 1172030995 20:31981997-31982019 CCTGGCTGTCCTCCAATAGCACT No data
Right 1172031003 20:31982044-31982066 ACCTCTGTTTGGAGCATTTCTGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172030995 Original CRISPR AGTGCTATTGGAGGACAGCC AGG (reversed) Intronic
No off target data available for this crispr