ID: 1172032607

View in Genome Browser
Species Human (GRCh38)
Location 20:31992439-31992461
Sequence GCTCACACGCTCCCCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172032607_1172032610 4 Left 1172032607 20:31992439-31992461 CCTGTCCTGGGGAGCGTGTGAGC 0: 1
1: 1
2: 0
3: 16
4: 144
Right 1172032610 20:31992466-31992488 AGTGTAGATGCAGCAGGCTGAGG 0: 1
1: 0
2: 0
3: 22
4: 251
1172032607_1172032609 -2 Left 1172032607 20:31992439-31992461 CCTGTCCTGGGGAGCGTGTGAGC 0: 1
1: 1
2: 0
3: 16
4: 144
Right 1172032609 20:31992460-31992482 GCAGTGAGTGTAGATGCAGCAGG 0: 1
1: 0
2: 0
3: 36
4: 208
1172032607_1172032612 17 Left 1172032607 20:31992439-31992461 CCTGTCCTGGGGAGCGTGTGAGC 0: 1
1: 1
2: 0
3: 16
4: 144
Right 1172032612 20:31992479-31992501 CAGGCTGAGGTCCCTGTCCTGGG 0: 1
1: 0
2: 7
3: 55
4: 352
1172032607_1172032611 16 Left 1172032607 20:31992439-31992461 CCTGTCCTGGGGAGCGTGTGAGC 0: 1
1: 1
2: 0
3: 16
4: 144
Right 1172032611 20:31992478-31992500 GCAGGCTGAGGTCCCTGTCCTGG 0: 1
1: 0
2: 6
3: 39
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172032607 Original CRISPR GCTCACACGCTCCCCAGGAC AGG (reversed) Intronic
900174522 1:1285932-1285954 GCCCAGACGCCCCCCAGGCCGGG + Exonic
902079479 1:13811492-13811514 CCACACACCCTCCCCAGGCCCGG - Intronic
905815431 1:40946876-40946898 ACTGACACGCTCCCCAACACTGG - Intergenic
910437952 1:87224873-87224895 GCCTACACCCTGCCCAGGACTGG - Intergenic
910892223 1:92030032-92030054 GCTCACCCGCTCCCGAGGAAGGG + Exonic
911048678 1:93651037-93651059 GAACACTGGCTCCCCAGGACAGG + Intronic
913465093 1:119132381-119132403 TCTGACTCTCTCCCCAGGACTGG + Intronic
916982836 1:170157016-170157038 GCTCACAGGCTGCCCAGGGTTGG - Intronic
921366991 1:214383575-214383597 GCTCACACTCTTCCTTGGACCGG + Exonic
924633359 1:245762960-245762982 GCTCACATGCTCACCTGGCCAGG - Intronic
924813545 1:247423910-247423932 GCTCACACTCTCACCCAGACGGG - Exonic
1067160959 10:43825062-43825084 GGTCCCACTCTCACCAGGACGGG - Intergenic
1067275305 10:44828500-44828522 GCTCACAGTCTCCACAGGAGGGG + Intergenic
1069045326 10:63737180-63737202 ACTCACACACACCCCAGGAAGGG - Intergenic
1070935757 10:80293669-80293691 GCTCCCACCCTCCCCAGGTGGGG - Intergenic
1075100601 10:119503566-119503588 GCCCACACGCTGCCCAGCGCAGG - Intronic
1076345142 10:129774494-129774516 GCTCCCCCGCCCCCCAGGCCAGG + Intergenic
1076519709 10:131073867-131073889 GCACACACGCTCCCAAGGAAAGG - Intergenic
1077033874 11:484497-484519 GCACACACGCACCCCTGCACTGG - Intronic
1077316526 11:1921852-1921874 GCTCAGAGCCTCCCCAGGCCTGG + Intronic
1077464788 11:2728582-2728604 GCCCTCACGCTCCCAAGGCCCGG - Intronic
1077530147 11:3091228-3091250 GCTCACAAGGAACCCAGGACAGG + Intronic
1083714290 11:64567020-64567042 GCTCCCACGCTCCCAGGGGCTGG - Intronic
1084422990 11:69069908-69069930 GCTCGCACACCCTCCAGGACGGG - Intronic
1085277183 11:75307706-75307728 GCTCACACCCTCCCCTGCCCAGG + Intronic
1086160924 11:83720912-83720934 GCTCTCAGGCTCCCCAGGGTAGG - Intronic
1090518160 11:127450609-127450631 GCTCAGAAGCTCCACAGGTCAGG - Intergenic
1092989341 12:13880073-13880095 GCACACACACTCCCCAACACAGG + Intronic
1097188638 12:57209066-57209088 GCTCTCTCTCTCCCCAGGCCTGG + Exonic
1097265207 12:57740336-57740358 GATGACACCATCCCCAGGACAGG + Intronic
1102483282 12:113238725-113238747 ACCCACTCGCTCCCCAGCACCGG + Intronic
1104082785 12:125445659-125445681 GCTCACAAGCTGGCCAGGCCTGG + Intronic
1104662460 12:130620939-130620961 GCTCACAGGTGCCCCAGGCCCGG - Intronic
1104730982 12:131105175-131105197 GCTCCCACGTTCCTCAGCACAGG + Intronic
1104957303 12:132473097-132473119 GCCCACGCGCTCTCCAGGAGGGG - Intergenic
1105804767 13:23946529-23946551 GCTCACATGCCCCTAAGGACAGG + Intergenic
1107071297 13:36272474-36272496 CCTCACAGACTTCCCAGGACAGG - Intronic
1108169052 13:47722367-47722389 GCTCCTACCCTCCCCAGGACAGG + Intergenic
1118882782 14:69843107-69843129 GCTGACCTGCTCCCCAGAACAGG + Intergenic
1120378766 14:83746383-83746405 GCTCACACTATCCACAGGATAGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121636216 14:95455511-95455533 GCTCCCAGGCTCCCCTGGACCGG + Exonic
1121718010 14:96089902-96089924 GACCCCAGGCTCCCCAGGACAGG + Exonic
1122394193 14:101411281-101411303 AGTCAAACACTCCCCAGGACTGG - Intergenic
1122628591 14:103097263-103097285 GGTCCCACTCTCCCCAGGTCAGG - Intergenic
1122784877 14:104159008-104159030 GACCACACGGTCCCCAGGGCCGG - Intronic
1124253136 15:28120664-28120686 CCTCACACCCTCCCCACCACTGG - Intronic
1131769819 15:95725026-95725048 GCTCCCATGCTGCCCATGACTGG + Intergenic
1132616912 16:845779-845801 CCTCATACGCCCACCAGGACGGG - Intergenic
1132664152 16:1074002-1074024 GCACATACCCTCCCCAGGAGAGG - Intergenic
1134637538 16:15803783-15803805 GCTCACAGGGCCCCCAGGAGAGG + Intronic
1136187947 16:28599177-28599199 GGTCACAGGCAGCCCAGGACAGG + Intergenic
1136190419 16:28612171-28612193 GGTCACAGGCAGCCCAGGACAGG + Intronic
1138597596 16:58037327-58037349 GCTCACACGGTCACCTGGGCAGG + Intronic
1141609693 16:85174409-85174431 GGTCTCAGGCTCCCCTGGACGGG + Intronic
1141932729 16:87216809-87216831 GCTCACACGGGCCCCAGAAACGG + Intronic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1148219049 17:45849521-45849543 GCTCACAGGGTCCCAAGGCCAGG + Intergenic
1148969598 17:51468268-51468290 TCTCACTCTCTCCCCAGGATGGG + Intergenic
1151226591 17:72652539-72652561 ACTCACCCTCACCCCAGGACAGG - Intronic
1151376775 17:73694629-73694651 ACCCACTCCCTCCCCAGGACAGG - Intergenic
1151974092 17:77474664-77474686 GCTGACCCCCTCCCCAGGCCAGG - Intronic
1152855539 17:82663203-82663225 GGAGACAGGCTCCCCAGGACTGG + Intronic
1160379254 18:78439053-78439075 TCTCATACCCTCCCCAGGACCGG - Intergenic
1160990929 19:1860044-1860066 GCCGACACCCTCCCCAGGAGAGG - Intronic
1161040977 19:2110662-2110684 GCTCCCACAGTCCCCAGGAGAGG + Intronic
1161777650 19:6272474-6272496 GCTCACACGCTGCCCTGTCCAGG + Intronic
1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG + Intergenic
1167254424 19:48418727-48418749 GCTCCCACGCTCCTCATGATGGG - Intronic
1167293212 19:48635667-48635689 GCCCGCACCCTCCCCAGGGCCGG - Exonic
1167436252 19:49480460-49480482 GCTCACCTGCTCCCCAGGGCGGG - Exonic
1167721438 19:51182803-51182825 TCTCCCTCCCTCCCCAGGACCGG - Intergenic
1167763538 19:51463967-51463989 TCTCCCTCCCTCCCCAGGACCGG + Intergenic
1168303150 19:55418513-55418535 GCTCCCACCCTCCCCAGCACTGG - Intergenic
925140520 2:1547069-1547091 GCTCCCACTTTCCCCAGGCCTGG - Intergenic
926041371 2:9675958-9675980 GTTCACACACTCCCCATCACAGG + Intergenic
926091966 2:10057277-10057299 GCTCAAACCCTCCCCAGAGCTGG - Exonic
929546000 2:42855550-42855572 ATTCACACGCTCACCTGGACTGG - Intergenic
930065316 2:47323439-47323461 GGTCCCACTGTCCCCAGGACAGG + Intergenic
937390629 2:121482875-121482897 CCTCAAACTCTCCCCAGGACCGG + Intronic
937908622 2:127064722-127064744 GCCCACACCTTCCCCAGGGCAGG + Intronic
1172013765 20:31861321-31861343 CCTTCCACGCCCCCCAGGACGGG - Exonic
1172032607 20:31992439-31992461 GCTCACACGCTCCCCAGGACAGG - Intronic
1172032614 20:31992491-31992513 GCTCACACGCTGCCCAGGACAGG - Intronic
1172323566 20:34016915-34016937 CCTCCCAGGCTCCCCAGGCCTGG - Intronic
1172883220 20:38215050-38215072 GCACACACGCTCCCCACCAGGGG + Intronic
1175158092 20:56987614-56987636 TCCCACACTCTCCCCAGCACTGG + Intergenic
1176186605 20:63783647-63783669 GTTCTCAAGCTTCCCAGGACAGG + Intronic
1176221006 20:63969454-63969476 GCTCACCCGCGCGCCAGGCCTGG - Intronic
1179730460 21:43364627-43364649 GCTCCCACGCCCCCCAGTGCTGG + Intergenic
1181026295 22:20129650-20129672 TCTCACACAGTCCCCAGCACCGG - Intronic
1183093670 22:35540243-35540265 GCTCACACGCACGCCCGGCCTGG - Intergenic
1184142173 22:42584308-42584330 GCTCTGAGGCTGCCCAGGACGGG - Exonic
1184652528 22:45925712-45925734 GCTCGGATGCTCCCCAGGCCAGG + Intronic
1185093094 22:48786797-48786819 GCTCCCAGGCTCCCCAGCCCTGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953686034 3:45079158-45079180 GTTTGCAGGCTCCCCAGGACTGG + Intergenic
954706442 3:52483262-52483284 GCTCAGCTGCTCCCCGGGACAGG - Intronic
958531741 3:95341350-95341372 GGTCAGACACTCCGCAGGACTGG - Intergenic
968958846 4:3732565-3732587 GCTTTCAAGCTCCCCCGGACAGG - Intergenic
969666062 4:8558182-8558204 GCCCACCCTGTCCCCAGGACTGG + Intergenic
970436850 4:16043944-16043966 TCTCACACACCCCCCAGGTCAGG + Intronic
975804104 4:78095021-78095043 CATCACACTCTTCCCAGGACTGG + Intronic
977827370 4:101549815-101549837 GCTCACAAGAGCCCCAGGCCTGG - Intronic
978189829 4:105897979-105898001 GCTGACACTGTCCCCAAGACTGG - Exonic
982166064 4:152614562-152614584 CCTCACACCCTCCCCAGGGCAGG + Intergenic
985658019 5:1142181-1142203 GCCCAGACGCTCCACAGGGCAGG + Intergenic
986633998 5:9801878-9801900 GCTCAGACTCTCCCCAGGCAGGG - Intergenic
987261075 5:16204036-16204058 GCTCACAAGCTCCCGATGCCAGG - Intergenic
992152513 5:73919120-73919142 GCTCACTGGATCCCCGGGACAGG - Intronic
993320051 5:86460244-86460266 TCCCAGACACTCCCCAGGACTGG + Intergenic
997598111 5:135120690-135120712 TCTCACACGTTCCTCAGAACAGG - Intronic
999782003 5:154857584-154857606 GGCCACACGCTGCCCAGGGCCGG + Intronic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1005828611 6:29652301-29652323 CCTCCCAGCCTCCCCAGGACTGG + Intergenic
1006873719 6:37277081-37277103 ACACACACGCACACCAGGACCGG - Intronic
1007615971 6:43180018-43180040 GCCCTCAGGCTCCCCAGAACTGG + Exonic
1008487690 6:52053324-52053346 GCTCACAGGCCCCCCAGGTTGGG - Intronic
1011344103 6:86350103-86350125 GAACACAAGCTCCCCAGGGCAGG + Intergenic
1011557191 6:88583669-88583691 CCTCACAGTCTCCCCATGACAGG + Intergenic
1016438268 6:144059486-144059508 GGTCACAGGGTCCCCAGGAAAGG - Intronic
1016732247 6:147439439-147439461 TCTCCCACGCTCCACAGGCCAGG - Intergenic
1017274835 6:152554050-152554072 GCTGAGCCTCTCCCCAGGACTGG - Intronic
1017518174 6:155176691-155176713 GCTCACACGCTTCACATCACTGG - Intronic
1018788340 6:167126525-167126547 GCTCACAGGCCCCCCAGGGCTGG - Intronic
1021717708 7:23474317-23474339 GCTCCCGCGCTCCCCGGGGCCGG + Intergenic
1022018782 7:26377901-26377923 GAGCACATGCTCCCCAGTACCGG - Intergenic
1023699495 7:42878378-42878400 GCTCAGACGGTTCCCAGGTCTGG - Intergenic
1026598326 7:71752714-71752736 GCTCTCACCCTTCCGAGGACCGG + Intergenic
1026879190 7:73897892-73897914 GCTCACCTTCTCTCCAGGACCGG + Intergenic
1026899242 7:74027991-74028013 GCTCACAAGCCTCCCAGGCCCGG - Intronic
1027140125 7:75650830-75650852 GCTGCCACCCTCCCCAGGGCGGG - Intronic
1027201964 7:76069597-76069619 GCTCACACTCCACCAAGGACGGG + Intergenic
1029244106 7:99186218-99186240 GCTCAGAAGATCCCCAGGACAGG + Intronic
1031085585 7:117298911-117298933 ACTCCCACTCTCCCCAGGTCGGG + Intronic
1032978316 7:137251350-137251372 GGTCACATTCTCCCCAGGCCTGG + Exonic
1034940374 7:155226693-155226715 GCTCCCACACCTCCCAGGACAGG - Intergenic
1037166416 8:15834915-15834937 GTGCACAGGTTCCCCAGGACTGG + Intergenic
1038259546 8:25980933-25980955 GGTTACACCTTCCCCAGGACAGG - Intronic
1043401888 8:79892018-79892040 GGTCACAGGCGCCCCAGGAGGGG - Intergenic
1046153909 8:110262784-110262806 ACACACACGCACCCCAGCACAGG - Intergenic
1047028451 8:120850244-120850266 GATTACACCCTCCCCAGGAGAGG + Intergenic
1049110861 8:140642333-140642355 GCTCACAGGGTATCCAGGACTGG - Intergenic
1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG + Intronic
1049405711 8:142451054-142451076 GCTCCCAGCCTCCCCAGGAGGGG - Intronic
1051368257 9:16336517-16336539 GCTCACCCTGTCTCCAGGACTGG + Intergenic
1052603595 9:30671256-30671278 GCTCCCACTGTGCCCAGGACTGG + Intergenic
1055766789 9:79672118-79672140 GCACCCTCTCTCCCCAGGACAGG - Intronic
1057459735 9:95250253-95250275 GCTCTGACACTCCCCAGGGCAGG + Intronic
1057800904 9:98191246-98191268 TCTCAGACGGTCCCCAGGAGGGG + Intronic
1057866790 9:98687755-98687777 GCTTACTGGCTCCACAGGACAGG + Intronic
1060350480 9:122854200-122854222 GCTCAAAAGGTCCCCAGTACTGG + Exonic
1060508464 9:124215481-124215503 CATCAGACCCTCCCCAGGACAGG - Intergenic
1060545340 9:124456034-124456056 GCTTGCACACTTCCCAGGACGGG - Intronic
1061738405 9:132679567-132679589 GATGACTCGCTCCCCACGACTGG + Exonic
1061820277 9:133223519-133223541 GCCCACACCCTCCCCAGGGCAGG - Intergenic
1061820293 9:133223588-133223610 GCCTACACCCTCCCCAGGGCAGG - Intergenic
1062240341 9:135534317-135534339 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062240356 9:135534385-135534407 GCCCACACCCTCCCCAGGGCAGG + Intergenic
1062299463 9:135856948-135856970 GTGCACACACTCCCCAGCACTGG + Intronic
1185890284 X:3816262-3816284 GCACACACCACCCCCAGGACTGG - Intergenic
1186349864 X:8730831-8730853 GCTCGCACGCTCGACAGGGCTGG + Intronic