ID: 1172034528

View in Genome Browser
Species Human (GRCh38)
Location 20:32001819-32001841
Sequence GGCCCCACCACAGCTTGAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172034528_1172034532 -3 Left 1172034528 20:32001819-32001841 CCAGTTCAAGCTGTGGTGGGGCC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1172034532 20:32001839-32001861 GCCTGCAGTAGAGGTTGGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 141
1172034528_1172034534 -2 Left 1172034528 20:32001819-32001841 CCAGTTCAAGCTGTGGTGGGGCC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1172034534 20:32001840-32001862 CCTGCAGTAGAGGTTGGTAGGGG 0: 1
1: 0
2: 1
3: 11
4: 150
1172034528_1172034531 -4 Left 1172034528 20:32001819-32001841 CCAGTTCAAGCTGTGGTGGGGCC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1172034531 20:32001838-32001860 GGCCTGCAGTAGAGGTTGGTAGG 0: 1
1: 0
2: 1
3: 77
4: 207
1172034528_1172034530 -8 Left 1172034528 20:32001819-32001841 CCAGTTCAAGCTGTGGTGGGGCC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1172034530 20:32001834-32001856 GTGGGGCCTGCAGTAGAGGTTGG 0: 1
1: 0
2: 1
3: 29
4: 295
1172034528_1172034535 -1 Left 1172034528 20:32001819-32001841 CCAGTTCAAGCTGTGGTGGGGCC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1172034535 20:32001841-32001863 CTGCAGTAGAGGTTGGTAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172034528 Original CRISPR GGCCCCACCACAGCTTGAAC TGG (reversed) Exonic
905922082 1:41726559-41726581 GGCCTCACCACGATTTGAACTGG + Intronic
907273638 1:53304984-53305006 GGTCCCACTACAGCTTGAAGAGG + Intronic
910072790 1:83239357-83239379 GGCAATTCCACAGCTTGAACTGG + Intergenic
915079290 1:153340570-153340592 CGCCCCACCTCAGCTTGCCCCGG - Exonic
920802492 1:209202495-209202517 GGCCCCACCACAGTTTTAACCGG - Intergenic
1068595182 10:58895585-58895607 CCCCCCCCGACAGCTTGAACAGG + Intergenic
1071003334 10:80855684-80855706 TGCCCCACCACAGCGTGAGGTGG + Intergenic
1073400666 10:103254567-103254589 GGCCTCACCATGTCTTGAACTGG + Intergenic
1074205000 10:111275446-111275468 TGCCCCATCCCAGCTGGAACAGG - Intergenic
1074880200 10:117650801-117650823 GGCCTCATCACAGCTGGAAGTGG + Intergenic
1075711198 10:124531257-124531279 GCCCACACCCCAGCTTGCACGGG - Intronic
1076167977 10:128297577-128297599 GCCCCCACCTCAGCTTGTCCGGG + Intergenic
1076615238 10:131750508-131750530 GGTCAAACCACAGCTTCAACAGG - Intergenic
1076798706 10:132810976-132810998 GGTCCTACCAGAGCTTGAAGAGG - Exonic
1076886186 10:133263680-133263702 GGCCTCACCTCAGCTGGACCAGG + Exonic
1077151212 11:1073909-1073931 GGGCCCACCACTGCTTGCCCCGG - Intergenic
1082824704 11:57568868-57568890 GGCACGAGAACAGCTTGAACCGG - Intergenic
1086062432 11:82713623-82713645 GGCCCCACCGCAGATTGCATTGG + Intergenic
1088470902 11:110186935-110186957 GGGCCCTCCACAGCCAGAACTGG + Intronic
1092194598 12:6541633-6541655 TGCCCCACCACAGCTGGAGTTGG - Exonic
1101410915 12:104467494-104467516 GCCTCCACCACCGCTAGAACTGG - Intronic
1101422552 12:104561599-104561621 GGCTCACCCACAGCTTGAATTGG + Intronic
1111337373 13:86840781-86840803 GGCCTCACCACAGCTTGGGGCGG + Intergenic
1116991927 14:51286094-51286116 GGCCCCTCTACTCCTTGAACAGG + Intergenic
1119765364 14:77184269-77184291 GGCCCAAGCACAACTTGAAGCGG - Intronic
1122256703 14:100483410-100483432 GGCCCAAGCACAGATTGGACAGG - Intronic
1122414616 14:101542912-101542934 GGCCTCACCCCATCTTGACCCGG - Intergenic
1126480315 15:49111261-49111283 GGCCCCAGGACAGCATGCACTGG - Intronic
1130892972 15:88149237-88149259 GGTTCCACCCCAGCCTGAACTGG + Intronic
1131328338 15:91470354-91470376 GGCCCCACCGCACCTTGACAAGG + Intergenic
1132463489 16:67008-67030 GGCCCAGCCACAGCGTGAAGGGG + Intronic
1132823244 16:1888089-1888111 GGCGCCACCACAGCTGGCTCAGG - Intergenic
1134836640 16:17366890-17366912 GGTACAACCACATCTTGAACTGG + Intronic
1139337512 16:66243426-66243448 GTCCTCACCACACCATGAACTGG - Intergenic
1139435585 16:66934830-66934852 GGCGTCCCCACAGCTTGGACCGG + Exonic
1142023791 16:87801505-87801527 GTTCCCACCACGGCTTTAACTGG + Intergenic
1142203945 16:88773855-88773877 GGCCCCACCGGAGCTTGCTCTGG + Intronic
1143119877 17:4599927-4599949 GCCCCCTCCACAGCTGGAGCAGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1143494882 17:7307131-7307153 CGCCCCACCTCGGCTTTAACTGG - Intronic
1144638854 17:16926752-16926774 GTCCCAACCACAGCCTGACCTGG - Intergenic
1144756821 17:17684877-17684899 GGCTCCACCACATACTGAACAGG + Intronic
1146812774 17:35917080-35917102 AGCCCCAGCACAGCTTCCACAGG - Intergenic
1148132521 17:45270653-45270675 GACCCCAGCACAGCGGGAACAGG - Intronic
1151533099 17:74720256-74720278 GGCCCCACGGCAGCATGAAGGGG + Intronic
1152523696 17:80875540-80875562 GTCACCACCATAGCTTGATCTGG + Intronic
1153682808 18:7516424-7516446 GGCCCCACTACTTCCTGAACGGG - Intergenic
1155904306 18:31430348-31430370 CCCCCCACCACCGCTGGAACAGG - Intergenic
1158280384 18:55819078-55819100 GGGGCCCCCACAGATTGAACTGG - Intergenic
1158414477 18:57237457-57237479 GGACTCACCACACCTTAAACAGG + Intergenic
1158621159 18:59033647-59033669 GGCCCCACCACAGACTTACCAGG - Intergenic
1161035140 19:2080227-2080249 GTCCTCACCACAGCATGAAGAGG + Intronic
1161338178 19:3725870-3725892 GGCCCCGCCATAGCTAGCACGGG + Intronic
1161508112 19:4655116-4655138 GGCCCCTGCACAGCTTCACCAGG - Exonic
1162697037 19:12484576-12484598 GGTCCCACCACAGCCAGATCCGG + Intronic
1163250713 19:16124946-16124968 GACCCCACCACAGAGGGAACCGG - Intronic
1166793723 19:45413794-45413816 GGCCCCTCCTCAGCTGGGACAGG - Intronic
1167066062 19:47186987-47187009 GTCCCCACCACAGCTAGCATAGG + Intronic
925776920 2:7344650-7344672 GGCCCCAGCATAGCTTGAAGTGG + Intergenic
927152065 2:20201936-20201958 GGCCCCACGGCAGCCTGGACTGG + Exonic
929561750 2:42960601-42960623 GGCCCTACCACAGCACAAACTGG - Intergenic
935984851 2:108662501-108662523 GGACCCAACAGATCTTGAACTGG - Intronic
936137288 2:109906152-109906174 GGACCCAATAGAGCTTGAACTGG - Intergenic
936207409 2:110465333-110465355 GGACCCAATAGAGCTTGAACTGG + Exonic
943903784 2:193473023-193473045 GTCCCCACCACAGGCTGGACAGG - Intergenic
944056110 2:195523505-195523527 GAGCCCACCACAGCTTGAGGAGG + Intergenic
948330510 2:237160767-237160789 GGCCCCACCAAGGCTTGACCAGG - Intergenic
948366182 2:237456315-237456337 GGCCCCACCACCGCTCCAGCGGG + Intergenic
1170196001 20:13690130-13690152 GGCCCTACACCAGCTTTAACTGG + Intergenic
1172034528 20:32001819-32001841 GGCCCCACCACAGCTTGAACTGG - Exonic
1179730490 21:43364724-43364746 GGCCCCACCACAGTCTGAACCGG - Intergenic
1179902242 21:44400264-44400286 GGCCCCACCACACCTTGGTCAGG - Exonic
1180541035 22:16447709-16447731 GAGCCCACCACAGCTTGACAAGG + Intergenic
1183276176 22:36899709-36899731 GGCCCCAGGCCAGCTGGAACTGG - Intergenic
1184853889 22:47136179-47136201 GCCCCCACCGCAGCTGGCACTGG - Intronic
953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG + Intergenic
953822083 3:46215530-46215552 GGCCCCACCACAGGTTTACTGGG + Intronic
955185540 3:56711681-56711703 GGTCCCACCACAGCAAGCACCGG - Intergenic
961514958 3:127426597-127426619 AGCCCCACCCCAGCCTGCACGGG - Intergenic
966050935 3:175617425-175617447 GTCCCCATCACAGATTGGACAGG + Intronic
968577508 4:1374748-1374770 GGCTGCACCACAGCTTCAGCAGG - Intronic
968653528 4:1769190-1769212 GGCCCCACACCTGCCTGAACTGG - Intergenic
968746475 4:2363031-2363053 GTCCCCAGCACAGCCTGACCAGG + Intronic
969054927 4:4395657-4395679 GTCCCAACCACAGCTTCGACTGG - Intronic
974143564 4:57919147-57919169 GACCCCACCACAGCTTGAGGAGG - Intergenic
977057442 4:92211349-92211371 GAGCCCACCACAGCTTAACCAGG + Intergenic
978491434 4:109315556-109315578 GTCCCCACCACAGATTGGACAGG - Intergenic
983481061 4:168274608-168274630 GGCCACACCTCAGCGTGAATTGG + Intronic
990196492 5:53322787-53322809 GGCCCCACCACAAGTTTATCTGG + Intergenic
996938326 5:128973402-128973424 GAGCCCACCACAGCTCAAACCGG - Intronic
1000118467 5:158175137-158175159 GGCACCAGCTCAGCTTGAATGGG + Intergenic
1002088874 5:176792964-176792986 GGCTCCAGCACAGCGCGAACAGG - Intergenic
1002211559 5:177602402-177602424 GGCCCCAGCACAGCAAGCACAGG - Intronic
1003568521 6:7240675-7240697 AGCCCCTCCACAGCTCGGACTGG - Intronic
1006742500 6:36319584-36319606 GGCGCCACCCCAGCTTTAAGAGG - Exonic
1012263200 6:97111565-97111587 GGCCCCACCACAGCATCTAGTGG + Intronic
1015224081 6:130836490-130836512 GCACCCACCAGAGCTGGAACTGG - Exonic
1019040102 6:169096631-169096653 GGCCCCTCCACAGCTGGGAAAGG - Intergenic
1019565365 7:1676278-1676300 GGCCCTTCCACAGCTTCCACGGG - Intergenic
1022370907 7:29770510-29770532 GGCCCCCACACAGCAGGAACAGG + Intergenic
1022664903 7:32401628-32401650 GGTCCCACCGCAGCTTGCCCTGG + Intergenic
1024346911 7:48322596-48322618 GAGCCCCCCACAGCTGGAACTGG - Intronic
1028880150 7:95871180-95871202 GTCCCCACAACAGCTTGTATAGG - Intronic
1029551863 7:101240817-101240839 GTCCCCACCTCACCTTGAGCCGG + Exonic
1034763496 7:153695982-153696004 TGCCCTGCCCCAGCTTGAACTGG + Intergenic
1035475422 7:159140707-159140729 AGCCCCACGCCAGCTTGAGCGGG - Intronic
1035731437 8:1856385-1856407 AGGCCCACGACAGCGTGAACTGG - Intronic
1044517190 8:93153345-93153367 GGACACACCGCAGCTTGGACAGG - Intronic
1047994358 8:130319417-130319439 ATCCCCACCACCCCTTGAACTGG - Intronic
1048862869 8:138736850-138736872 GGCCCCATCTCAGTTTGAGCAGG + Intronic
1049615316 8:143573318-143573340 GGCCCCTCCAGAGCTTGTGCAGG + Intergenic
1049763553 8:144342359-144342381 GGGCCCAGCCCAGCTTGAGCTGG + Intergenic
1051144282 9:14010078-14010100 GGGCCCACCACAGCTTGCTCAGG - Intergenic
1058110594 9:101028176-101028198 GGTCCCACAACAGCTTTAATGGG - Intergenic
1060170087 9:121454000-121454022 GATTCCACCACAGCTGGAACTGG + Intergenic
1061303265 9:129718404-129718426 GGCCCCACCAAAGCTTATTCGGG + Intronic
1061431279 9:130532904-130532926 GCCCCCACCACAGATCTAACAGG - Intergenic
1061610790 9:131744316-131744338 GGGCCCACCTCAGCTTGGATTGG + Intergenic
1062279025 9:135743811-135743833 GGCCCCCCCATAGCTTGGCCAGG - Intronic
1185568842 X:1117065-1117087 GGGCTCACCAGAGCTTGCACCGG + Intergenic
1193000035 X:76553546-76553568 GTCCCCACCACAGGCTGGACAGG + Intergenic
1195721911 X:107876036-107876058 GTCCCCACTACAGATTGGACAGG + Intronic
1197495530 X:127174362-127174384 GGCCCCACCAGATCCTGCACTGG - Intergenic
1198549446 X:137729377-137729399 GGCCCCACCTCACCTCCAACAGG + Intergenic
1201455051 Y:14160422-14160444 TCCCCCACTACAGCTTGAAGGGG - Intergenic