ID: 1172035752

View in Genome Browser
Species Human (GRCh38)
Location 20:32009974-32009996
Sequence GTGAGAAATGAAAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172035752_1172035757 -5 Left 1172035752 20:32009974-32009996 CCATCCACCTTTTCATTTCTCAC No data
Right 1172035757 20:32009992-32010014 CTCACCACAGCAGCCTAGGGAGG No data
1172035752_1172035755 -9 Left 1172035752 20:32009974-32009996 CCATCCACCTTTTCATTTCTCAC No data
Right 1172035755 20:32009988-32010010 ATTTCTCACCACAGCAGCCTAGG No data
1172035752_1172035758 -4 Left 1172035752 20:32009974-32009996 CCATCCACCTTTTCATTTCTCAC No data
Right 1172035758 20:32009993-32010015 TCACCACAGCAGCCTAGGGAGGG No data
1172035752_1172035760 -1 Left 1172035752 20:32009974-32009996 CCATCCACCTTTTCATTTCTCAC No data
Right 1172035760 20:32009996-32010018 CCACAGCAGCCTAGGGAGGGAGG No data
1172035752_1172035762 27 Left 1172035752 20:32009974-32009996 CCATCCACCTTTTCATTTCTCAC No data
Right 1172035762 20:32010024-32010046 TTGACTCCCAACTTATAGAGAGG No data
1172035752_1172035763 30 Left 1172035752 20:32009974-32009996 CCATCCACCTTTTCATTTCTCAC No data
Right 1172035763 20:32010027-32010049 ACTCCCAACTTATAGAGAGGAGG No data
1172035752_1172035756 -8 Left 1172035752 20:32009974-32009996 CCATCCACCTTTTCATTTCTCAC No data
Right 1172035756 20:32009989-32010011 TTTCTCACCACAGCAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172035752 Original CRISPR GTGAGAAATGAAAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr