ID: 1172037260

View in Genome Browser
Species Human (GRCh38)
Location 20:32018999-32019021
Sequence CGCGACCCCGGCCCGCCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172037248_1172037260 20 Left 1172037248 20:32018956-32018978 CCCGGTGCCGGCCGGCGTGGATG 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG 0: 1
1: 0
2: 3
3: 17
4: 128
1172037250_1172037260 13 Left 1172037250 20:32018963-32018985 CCGGCCGGCGTGGATGCCAGCCC 0: 1
1: 1
2: 0
3: 8
4: 100
Right 1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG 0: 1
1: 0
2: 3
3: 17
4: 128
1172037255_1172037260 -3 Left 1172037255 20:32018979-32019001 CCAGCCCAGGCGGCGCAGGACGC 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG 0: 1
1: 0
2: 3
3: 17
4: 128
1172037257_1172037260 -8 Left 1172037257 20:32018984-32019006 CCAGGCGGCGCAGGACGCGACCC 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG 0: 1
1: 0
2: 3
3: 17
4: 128
1172037256_1172037260 -7 Left 1172037256 20:32018983-32019005 CCCAGGCGGCGCAGGACGCGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG 0: 1
1: 0
2: 3
3: 17
4: 128
1172037249_1172037260 19 Left 1172037249 20:32018957-32018979 CCGGTGCCGGCCGGCGTGGATGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG 0: 1
1: 0
2: 3
3: 17
4: 128
1172037252_1172037260 9 Left 1172037252 20:32018967-32018989 CCGGCGTGGATGCCAGCCCAGGC 0: 1
1: 0
2: 0
3: 23
4: 188
Right 1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG 0: 1
1: 0
2: 3
3: 17
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172037260 Original CRISPR CGCGACCCCGGCCCGCCAGG CGG Exonic
900113671 1:1019928-1019950 CCCTCCCCCGGCCCGCCCGGAGG - Intergenic
900408093 1:2501202-2501224 AGCGGCCCAGGCCCGGCAGGTGG - Intronic
901242606 1:7704167-7704189 CGCGGCCCCGGCGCGCCCTGCGG - Intronic
903830231 1:26170134-26170156 TTCGACCCCGACCTGCCAGGGGG + Exonic
905167021 1:36088772-36088794 CGCGACTCCGGGCCGCTGGGCGG + Intergenic
905212759 1:36385789-36385811 CCCGGCCCCGGCCCCCCGGGAGG - Exonic
905300189 1:36981665-36981687 CCCGACCCTGGCCCTCCTGGAGG - Intronic
914377043 1:147080661-147080683 CGCGACCCAGGCCCTCCAGGAGG - Intergenic
914474692 1:148013637-148013659 CGCGACCCAGGCCCTCCAGGAGG + Intergenic
914492325 1:148160236-148160258 CACGACCCAGGCCTTCCAGGAGG + Intergenic
915393395 1:155563377-155563399 CGGGACTCCGGACCTCCAGGAGG + Intergenic
915409518 1:155689222-155689244 CGGGACTCCGGACCTCCAGGAGG + Intronic
915574637 1:156767666-156767688 CGGTTCCCCGCCCCGCCAGGTGG + Exonic
916890361 1:169107017-169107039 CGCCACCCCGGCCAGCGCGGTGG - Intronic
921599263 1:217089657-217089679 CGCGACCTCGGCAGGCGAGGGGG + Intronic
922539495 1:226408154-226408176 CGCGCCCCCTGCCGGCCGGGGGG + Intergenic
1065845044 10:29736729-29736751 CCCGGCCCGGGCCCGGCAGGTGG - Intronic
1071598205 10:86943019-86943041 CGCGGCCGAGGCCCGCCACGAGG - Exonic
1071997639 10:91163215-91163237 TGTGACCCCGGGGCGCCAGGCGG - Intronic
1077177657 11:1197955-1197977 CGCGATCCCGACCTACCAGGAGG + Intronic
1083759845 11:64809889-64809911 CCCGCCCCCGACCCGCCTGGCGG - Exonic
1084004808 11:66317097-66317119 CCCGCCCCCGGCCCGCCCGCAGG - Intergenic
1085506990 11:77066559-77066581 CGCGGCCCCGGCCCGCCCTGTGG + Intergenic
1089694974 11:120211237-120211259 CGCGGCCCCGGCGCGCCGCGTGG - Exonic
1095752558 12:45728797-45728819 CGCGTCCCCGGCCCGGCTGTTGG - Intergenic
1096241297 12:49961680-49961702 CGCGACCCCCGCCCCCCGGCCGG - Intergenic
1096668230 12:53181030-53181052 CGCGTCCCCGGCCCGGGAGAGGG + Intronic
1101365354 12:104064982-104065004 CCCCACCCCAGCCCGACAGGCGG + Intronic
1105799240 13:23889242-23889264 GGCTTCCCCGGCCCGCCCGGCGG + Exonic
1106157349 13:27171358-27171380 CGCCGCCCTGGCCCACCAGGCGG + Intronic
1110219640 13:73059435-73059457 CGCGAATCCGGCCCGCGACGCGG + Exonic
1113876330 13:113597065-113597087 GGCAACCCCGGCCAGACAGGGGG - Intronic
1116828280 14:49693140-49693162 CACAACCCCTGCCCGCCCGGCGG - Exonic
1118339340 14:64880706-64880728 GGAGACCCGGGCCGGCCAGGAGG - Intergenic
1119219395 14:72893691-72893713 CGCGCTCCCTGCCCGCGAGGCGG + Intronic
1124497092 15:30193219-30193241 CGGGGCCCCAGCTCGCCAGGTGG + Intergenic
1124746484 15:32345428-32345450 CGGGGCCCCAGCTCGCCAGGTGG - Intergenic
1125536043 15:40441557-40441579 CCCGCCCCCGGCCTGCAAGGCGG - Intronic
1125874733 15:43133909-43133931 CGCGCCCCGCGCCCCCCAGGAGG + Exonic
1130224604 15:82047155-82047177 CGCGGCCCCGCCCCGACGGGAGG + Intergenic
1130531236 15:84748835-84748857 GGCGGCCCGGGCCCGCCAGGCGG - Intronic
1131119602 15:89814340-89814362 GGCGAACCCGGCCCGCCTGTGGG - Intronic
1132656697 16:1044483-1044505 CCCCACCTCGGCCCCCCAGGCGG - Intergenic
1133220184 16:4316314-4316336 CGCAGCCCCGGCGCGACAGGCGG - Intronic
1136497421 16:30652806-30652828 CGCCACCCCGGCAGGCCGGGTGG + Exonic
1136579432 16:31142740-31142762 CGCGGCCCCAGCGGGCCAGGCGG + Exonic
1142156418 16:88534604-88534626 CGCGCCCCTGGCCGGCCCGGGGG + Exonic
1142474424 17:180888-180910 CCCGACCCAGGCCGGACAGGAGG - Intronic
1142876089 17:2853012-2853034 GGGGCGCCCGGCCCGCCAGGAGG + Intronic
1143608305 17:8003303-8003325 CGCGACCCCGGCCTGGCAGGCGG + Exonic
1144339974 17:14302689-14302711 CGCGCCGCCCGCCCGCCAGGCGG - Intronic
1144873353 17:18383482-18383504 CGGTACCCAGGCCCACCAGGAGG + Exonic
1145979923 17:29005406-29005428 CGGGACCACGGGCCGCCAGCTGG + Intronic
1147148238 17:38498489-38498511 CCTGACCCCGGGTCGCCAGGGGG - Exonic
1147179345 17:38674620-38674642 GGCGCCCCCGGCCCGCCACCCGG + Exonic
1147987573 17:44315324-44315346 CGCGACGCCGGCGGGCCCGGGGG + Intronic
1148183104 17:45620671-45620693 CGCGGCCCCGGCCCGCCCCCCGG - Intergenic
1148262243 17:46193559-46193581 CGCCCCCGCGGGCCGCCAGGAGG + Intronic
1148265747 17:46225020-46225042 CGCGGCCCCGGCCCGCCCCCCGG + Intronic
1148370978 17:47099953-47099975 CGCGGCCCCGGCCCGCCTCCTGG + Intergenic
1149658616 17:58323238-58323260 CTTCACCCCGGCCAGCCAGGTGG - Intronic
1151612166 17:75183144-75183166 CGCGCACCCGGCCCGCCGCGGGG + Intergenic
1151625043 17:75271140-75271162 CGCGCCACCGGCCCGGCAGGTGG - Exonic
1151946376 17:77322065-77322087 CGAGGCCCCTGCCAGCCAGGCGG - Intronic
1152541754 17:80980115-80980137 CGCGACCCCTTCTCCCCAGGGGG + Intergenic
1157613802 18:48975559-48975581 CGCCACCCCGGCGCGCACGGAGG + Intergenic
1160242485 18:77133190-77133212 CGCAGCCCCGGCCCTGCAGGAGG + Intronic
1160583129 18:79898981-79899003 GGCGCCCCCGGCCCTCCAAGAGG + Intronic
1160672231 19:371163-371185 CGCGACTCACCCCCGCCAGGCGG - Intronic
1160788628 19:912831-912853 CGAGCCCCCGGAGCGCCAGGAGG + Intronic
1161442197 19:4298253-4298275 GGCGACCCTGGTCTGCCAGGTGG - Exonic
1161560384 19:4969499-4969521 CGCGCCCCCGGCCCGGGAAGGGG - Intronic
1162416878 19:10543809-10543831 CCCGATCCCGGGTCGCCAGGCGG - Intergenic
1162421601 19:10568805-10568827 CGAGACCCCGGCCCTCCCGGCGG + Exonic
1162523073 19:11193344-11193366 TGCGACCCCGGCCCGCTGTGGGG + Exonic
1163635104 19:18433914-18433936 CGTGACCGCGGCGGGCCAGGTGG + Intronic
1165089301 19:33374175-33374197 CGCGCTCCCGGCCCGCCGCGAGG - Intronic
1166219018 19:41353557-41353579 CGCGACGCTGCCCCGCGAGGAGG - Exonic
1166547028 19:43639871-43639893 CCCGCCCCCTGCCCGCCCGGGGG + Intergenic
1168691613 19:58380895-58380917 CGCAACCTCGGCCTGCGAGGCGG - Intronic
925394022 2:3519408-3519430 CCCGACCCCGGCCGCCCAGTGGG - Exonic
927150262 2:20191512-20191534 CACAATCCCTGCCCGCCAGGGGG - Intergenic
927168770 2:20350952-20350974 GGCGCCCCCGGCCCGCGCGGCGG - Intronic
927751249 2:25673044-25673066 CCCGAGCCCGGCTCGCCTGGAGG - Intronic
930136344 2:47906515-47906537 CGCGCCCCCGGCCAGCCCCGCGG - Intergenic
938451458 2:131425042-131425064 CGCGCCCCCGGCCCACCTGGTGG - Intergenic
938455651 2:131460918-131460940 CTCAGCCCCGGCCCGCCTGGGGG - Intergenic
941476159 2:165953817-165953839 CGCGACCCCGCCCCTCCCGCTGG - Exonic
947632301 2:231662141-231662163 GCCCACCCCGGCCCGCGAGGCGG + Intergenic
948880818 2:240856320-240856342 TGCGACCCCGGCCAGCCCGAGGG - Intergenic
1172037260 20:32018999-32019021 CGCGACCCCGGCCCGCCAGGCGG + Exonic
1172097223 20:32466414-32466436 CTGGGCCCCGGCCCGCCAAGGGG - Intronic
1176042320 20:63072200-63072222 CCCGAGCCCGGCCCACCCGGAGG - Intergenic
1179775595 21:43659822-43659844 CCGGCCCCCGGCCCGCCATGTGG - Intronic
1179810328 21:43865574-43865596 CGCAACCCCGGCCTCCCCGGCGG + Intronic
1180260156 21:46662972-46662994 CGACTCCCCGGCCCGCCAGGAGG - Intronic
1180949387 22:19714399-19714421 CGCGACCCAGGGCGGCCCGGGGG - Intergenic
1182554085 22:31119639-31119661 CCTGACCCAGGCCCGCCATGAGG - Intronic
1183524786 22:38316861-38316883 CGAGGCCCCGGCCGGCCAGGCGG - Intronic
1185037900 22:48489378-48489400 CCCCGCGCCGGCCCGCCAGGGGG - Intergenic
953947880 3:47164392-47164414 CGCTGCCCCCGGCCGCCAGGCGG - Intergenic
954198091 3:49007960-49007982 GGCGGCCCCGGCCCCTCAGGGGG + Intronic
954382581 3:50227483-50227505 CGCACCCCAGGCCCGCCAGGAGG + Intronic
955368784 3:58333124-58333146 GGCGGCCCCGGGCCGCGAGGGGG + Intronic
964570377 3:158103579-158103601 TGCGACCCCGGTCGGGCAGGCGG - Intronic
966982614 3:185152557-185152579 AGCGACCCCGGACGGCCCGGCGG + Intronic
975666976 4:76741802-76741824 CCCGGCCCTGGCCCCCCAGGAGG - Exonic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
982068262 4:151673247-151673269 CGCGGCCCCCCCCCGCCATGTGG - Intronic
984928387 4:184826102-184826124 CGCGGCCCCGCCCCGCCCGCAGG + Intronic
987258307 5:16179605-16179627 CCAGAGCCCGGCCCGCCAGCCGG - Exonic
990382993 5:55233757-55233779 CGCCTCCGCGGCCCGCCGGGGGG + Intergenic
993901131 5:93584882-93584904 TGCGACCCCGGGGCGCCCGGCGG + Exonic
997265228 5:132491139-132491161 CCCGCCCCCGCCCCGCCAGGAGG - Intergenic
997402387 5:133612608-133612630 CGCGCCGCCCGCCCGCCAGCCGG + Intergenic
1004519326 6:16347068-16347090 CCCGAGCCCTGCCCGCCAGAAGG - Intronic
1005676896 6:28164023-28164045 AGCGACCGCGCCCGGCCAGGAGG + Intergenic
1007701779 6:43770119-43770141 CCCGCCCCCGGCCCGCCCCGGGG - Intergenic
1015181295 6:130365473-130365495 GGGGACCCCGGCCCGCCGGGCGG + Intergenic
1015965379 6:138692386-138692408 GCCGACCCAGGGCCGCCAGGGGG + Intronic
1027423538 7:78040372-78040394 CACGACCAGGGGCCGCCAGGGGG - Intronic
1027829686 7:83162466-83162488 CGCGATCCCGGCCGGCATGGAGG - Exonic
1032525730 7:132577184-132577206 CGCGCCCCCGGCCCCCCGGGCGG + Exonic
1036795739 8:11755217-11755239 GGCCAGCCCGGGCCGCCAGGGGG + Intronic
1045547372 8:103140806-103140828 CGCAGCCCCGGCCCGCAAGGAGG - Exonic
1046369697 8:113285542-113285564 AGCCACCCCGCCCCGCCAGTTGG + Intronic
1049243616 8:141550684-141550706 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243660 8:141550807-141550829 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243676 8:141550848-141550870 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243737 8:141551012-141551034 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243824 8:141551258-141551280 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049693731 8:143973665-143973687 CGCGGAACCGGCCCGCCGGGAGG - Intronic
1052997506 9:34559097-34559119 CCCGCCCCCGGCCTGACAGGTGG + Intronic
1055611728 9:78031410-78031432 CGCGCCCCCGGCCCACCTGGTGG - Exonic
1057199889 9:93134302-93134324 CCCGCCCCCGGCCCGCCCGGCGG + Intergenic
1057619096 9:96619382-96619404 GGCGGCCGCGGCCCGTCAGGGGG + Exonic
1059003443 9:110375379-110375401 CGAGACCCCGTCCAGCCAGGCGG + Exonic
1060106694 9:120877191-120877213 CCCGACCCCGGCCCCACGGGCGG - Exonic
1060812076 9:126615625-126615647 CGCGGGCCGGGCCCGGCAGGGGG - Intronic
1061061063 9:128250771-128250793 CGCGACCCGGGCCGGGCTGGGGG - Exonic
1061610045 9:131740039-131740061 CGCTCCCCCGGCCCGCGAGCCGG + Intronic
1062289507 9:135788237-135788259 CGCCATCCCGGCCAGGCAGGTGG + Intronic
1062306175 9:135908013-135908035 CGAGACCTCGGCCGGCCAGGGGG - Intergenic
1062491714 9:136808092-136808114 GGCGGCCCCGGCCCCCCCGGAGG - Exonic
1187281496 X:17861060-17861082 GGTGACCCCGGCCCGCACGGGGG + Intronic
1187698116 X:21940920-21940942 CCCCGCCCCAGCCCGCCAGGCGG - Intronic
1187888123 X:23907932-23907954 CGCAAACCCCGCCCTCCAGGAGG + Exonic
1195711389 X:107776042-107776064 CGGGGCCCCCGCCCGCCAGCCGG - Intronic
1200143452 X:153913444-153913466 CGCGCCTCCGGCCCGCCTGCCGG + Exonic