ID: 1172038139

View in Genome Browser
Species Human (GRCh38)
Location 20:32024837-32024859
Sequence AAATAACCACAGACTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172038136_1172038139 15 Left 1172038136 20:32024799-32024821 CCTGGGCGACAACAGCGAAACTC 0: 21
1: 1070
2: 14701
3: 40392
4: 31737
Right 1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG 0: 1
1: 0
2: 5
3: 36
4: 242
1172038137_1172038139 -10 Left 1172038137 20:32024824-32024846 CCTCAAAATAAATAAATAACCAC 0: 1
1: 0
2: 32
3: 417
4: 1651
Right 1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG 0: 1
1: 0
2: 5
3: 36
4: 242
1172038134_1172038139 29 Left 1172038134 20:32024785-32024807 CCACTGCACTCCAGCCTGGGCGA 0: 62339
1: 213994
2: 245652
3: 160170
4: 93749
Right 1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG 0: 1
1: 0
2: 5
3: 36
4: 242
1172038135_1172038139 19 Left 1172038135 20:32024795-32024817 CCAGCCTGGGCGACAACAGCGAA 0: 24
1: 1106
2: 15144
3: 42357
4: 32524
Right 1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG 0: 1
1: 0
2: 5
3: 36
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172038139 Original CRISPR AAATAACCACAGACTGTGCT GGG Intronic
901856014 1:12044444-12044466 AAATGAACACAGACTGGGCGTGG + Intergenic
902373063 1:16017391-16017413 ATATACACACACACTGTGCTGGG - Intronic
903063939 1:20688015-20688037 AAAAAACAACACACTGGGCTTGG - Intronic
903209850 1:21811737-21811759 AAATAATTCCAGACAGTGCTGGG + Intergenic
903777589 1:25802684-25802706 AAATAATCACTGACTGCACTAGG - Intronic
904907373 1:33907833-33907855 AAAGAAGTACAGACTGGGCTGGG + Intronic
905074775 1:35260810-35260832 AAAAAAACACAAAATGTGCTGGG + Intergenic
905638608 1:39573521-39573543 AAAGAACCAAAGGCTGGGCTGGG + Intronic
907553635 1:55325893-55325915 AAATAACCAGGGACTGGGCGTGG + Intergenic
908587565 1:65588224-65588246 AAATAACAACTGTCTGTTCTTGG + Intronic
912310644 1:108617664-108617686 AAAGAACCAGAGACTGAGGTGGG + Intronic
912811000 1:112794359-112794381 GAATAACTATAGAATGTGCTGGG - Intergenic
912995348 1:114527595-114527617 AAAAAATCATAGACTGGGCTTGG - Intergenic
913015291 1:114727266-114727288 AAATTACAGCAGACTGAGCTAGG - Intronic
916280864 1:163049629-163049651 ACATGAGCACTGACTGTGCTAGG + Intergenic
917158219 1:172027287-172027309 TAAAAAACACAGACTGGGCTGGG + Intronic
917313865 1:173704642-173704664 AAAGAAGCACAGACAGTCCTTGG - Intergenic
917426653 1:174921216-174921238 AAAGTACCACAGACTGGGCCGGG - Intronic
917655707 1:177123399-177123421 AATAAACCACAAAATGTGCTAGG - Intronic
920591680 1:207225218-207225240 ACATAACCACAAACTGTTTTTGG + Intergenic
921407075 1:214791772-214791794 AAACAACTTCAGACTGTGTTAGG + Intergenic
921467372 1:215505204-215505226 TAATAACCACTGATTATGCTTGG + Intergenic
921911610 1:220555074-220555096 AAGTAACCACAGAATGGGTTTGG + Intronic
1063515012 10:6687246-6687268 GAATAACCTTAGAATGTGCTGGG - Intergenic
1065897419 10:30176399-30176421 AAATAACCACAGACTCTCACTGG + Intergenic
1068507956 10:57926838-57926860 AAATATTCACAGAGTTTGCTAGG + Intergenic
1070737442 10:78873293-78873315 AATTAACTACAGACTTTGTTTGG + Intergenic
1070987679 10:80702295-80702317 AAATAGCCACAGAGAATGCTGGG - Intergenic
1071950944 10:90702079-90702101 AAATGACCACAGACTGGGTTTGG + Intergenic
1072903669 10:99431098-99431120 AAATACCCAGCGTCTGTGCTCGG + Intergenic
1073813278 10:107175356-107175378 AAATAACCACTGACATTACTTGG + Intergenic
1073977766 10:109119679-109119701 GAATAAGAACAGACTGTGGTGGG - Intergenic
1074467207 10:113694154-113694176 ACACAACCACAGACAATGCTTGG - Intronic
1075278824 10:121121191-121121213 CCATAACCACAGACTATGCTTGG + Intergenic
1075543059 10:123331634-123331656 AGATAAACACAGGCTGTGCTGGG - Intergenic
1078135329 11:8647342-8647364 AACTAGCCAGTGACTGTGCTGGG - Intronic
1078513609 11:12005209-12005231 AAATAACCAGTGGCTGAGCTGGG - Intronic
1079540849 11:21572921-21572943 AAATAATTATAGGCTGTGCTTGG + Intronic
1079748506 11:24163919-24163941 TACTAACCAGAGCCTGTGCTTGG - Intergenic
1080627197 11:34041287-34041309 GAATAAACACAGACAGTGCCTGG + Intergenic
1080871361 11:36239857-36239879 AAACAACCACAGACTGTGGATGG + Intergenic
1082217197 11:49585670-49585692 TGAAAAGCACAGACTGTGCTTGG + Intergenic
1082295731 11:50439545-50439567 CAATTACCACAAACTGTGATGGG - Intergenic
1082868185 11:57918860-57918882 AAAAAACCTCAGCCTGTTCTAGG + Intergenic
1083844408 11:65322405-65322427 GAATAACCACAAAGTGTGCAAGG + Exonic
1086215352 11:84373007-84373029 TAATAACTACAGACTGTACTTGG + Intronic
1086504162 11:87485892-87485914 AAATAAACCCACACTGTGCCAGG - Intergenic
1086632360 11:89038518-89038540 TGAAAAGCACAGACTGTGCTTGG - Intronic
1086971198 11:93082965-93082987 AAATAACCTCAGATCGTGATGGG - Intergenic
1087709750 11:101534865-101534887 AAATGAACACAAACTGGGCTGGG + Intronic
1088122318 11:106384973-106384995 AAATAACTATAGAATATGCTGGG + Intergenic
1088214061 11:107488510-107488532 CAATAACCACTGAATGAGCTTGG - Intergenic
1088868180 11:113869140-113869162 AATTAACCACAGGCTGGGTTCGG + Intronic
1090793433 11:130112641-130112663 AACTGACCACAGGCTGAGCTAGG - Intronic
1096296690 12:50390081-50390103 AAATAACCACAGGATGGGTTTGG + Intronic
1098745565 12:74233406-74233428 AAATAACCACAGTTTGGGTTTGG - Intergenic
1100466136 12:94847573-94847595 AAATAAAAACAGACTGGGCACGG + Intergenic
1101321174 12:103674243-103674265 AAAGAACCTCAGTCTGAGCTGGG + Intronic
1101390893 12:104299329-104299351 AAAAGACCACAGACTGTGGGAGG - Intronic
1101444427 12:104727426-104727448 CCATAGCCACAGTCTGTGCTGGG - Intronic
1103115659 12:118328378-118328400 AAATGACCAGAGTTTGTGCTAGG + Intronic
1103772265 12:123337201-123337223 AAGTAAACCCAGACTGTCCTCGG + Intronic
1106046384 13:26145927-26145949 AAATAACCACAGGATGGGTTTGG + Intronic
1106047214 13:26154148-26154170 AAATGACCACACACTGTACTTGG + Intronic
1106664898 13:31841445-31841467 AAACAACCACAGACTGTCCATGG - Intergenic
1106725216 13:32477317-32477339 AAATGACCACATGCTGTACTTGG - Intronic
1106830114 13:33571932-33571954 AAATAACCAGGGAATTTGCTAGG + Intergenic
1107160966 13:37227116-37227138 AAAGAATCACAAACTGGGCTGGG - Intergenic
1107529258 13:41266251-41266273 AAAAAACCATAGACTGGGCCAGG - Intergenic
1109053864 13:57520234-57520256 AAATAACCATAGAATGTGCTGGG - Intergenic
1109558045 13:64006727-64006749 AAATAAAAACAGACTTGGCTGGG + Intergenic
1109962456 13:69648835-69648857 AAATAACTATAGAATGTACTGGG - Intergenic
1110281212 13:73696424-73696446 AAATATGCAAAGGCTGTGCTGGG + Intronic
1112244006 13:97712347-97712369 AAATAACAACAGCCTGTAGTAGG - Intergenic
1119435130 14:74593582-74593604 AAATAACCACATACAGTTCGTGG - Intronic
1119984737 14:79124526-79124548 AAATGACCACCGATTGTGCTGGG - Intronic
1130329996 15:82914728-82914750 AAACAACAACAAAGTGTGCTGGG + Intronic
1130524768 15:84695170-84695192 AAATATCCAGAGGCTGGGCTCGG + Intronic
1133677849 16:8092423-8092445 AAATTACCTAACACTGTGCTGGG - Intergenic
1133847731 16:9471953-9471975 CAATAACCACTGAGTGAGCTTGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135251465 16:20903752-20903774 AAATAACCACATTCTGTGCAGGG - Intronic
1135661446 16:24300630-24300652 AAAAAACCATAGACTGAGCATGG + Intronic
1138207819 16:55137780-55137802 GAATAACCATAGAATATGCTGGG - Intergenic
1138867941 16:60846910-60846932 AAATAACTACAAACTGAGATAGG - Intergenic
1140597140 16:76430022-76430044 AAATAACCAAAGAATGGGTTGGG + Intronic
1141481499 16:84309572-84309594 AAATGACCACAAACTGGGGTGGG + Intronic
1142321766 16:89387700-89387722 AAAAAAAAAAAGACTGTGCTTGG + Intronic
1143160259 17:4865133-4865155 AAATAACCAGACACTGGGCCGGG + Intronic
1144169785 17:12648573-12648595 AAATAACCTCATACTATGTTTGG + Intergenic
1144276853 17:13678458-13678480 AGTTAACCACAGGCTGTGCTGGG + Intergenic
1144650166 17:17002280-17002302 AAATATCCAGAGACTGTGCCGGG + Intergenic
1144677240 17:17169501-17169523 AACTGACCAGAGATTGTGCTGGG + Intronic
1146654662 17:34628180-34628202 AAACAGCCACAGGCTCTGCTGGG - Intronic
1147348248 17:39819482-39819504 AAATGACCACATCCTGTGCCAGG + Intronic
1147783198 17:42958856-42958878 AAATAAAAACAGACTGAGCGTGG - Intronic
1150268564 17:63847680-63847702 AAATTCCCAGAGTCTGTGCTGGG - Intergenic
1153280870 18:3412668-3412690 AAGGAACCACAGCCTGTGCCAGG - Intronic
1156507090 18:37604184-37604206 AAAGAAACACAGACTGAGCCTGG - Intergenic
1156839652 18:41596237-41596259 GAAAAACCACTGGCTGTGCTTGG + Intergenic
1158045073 18:53145936-53145958 AAAATACCACAGACTGGGCCAGG + Intronic
1158089440 18:53693728-53693750 AAATAACCACAGACTGAACTTGG - Intergenic
1158990450 18:62863491-62863513 AAATAACCATAGGCTGGGCCTGG - Intronic
1159136111 18:64338437-64338459 GAATAAATACACACTGTGCTTGG + Intergenic
1160081411 18:75730999-75731021 AAAGAAATGCAGACTGTGCTTGG + Intergenic
1160275873 18:77435292-77435314 AAATATTCAGAGACTGTGGTTGG + Intergenic
1164795411 19:31023169-31023191 AAATAACTATAGAAAGTGCTGGG + Intergenic
1164899057 19:31902777-31902799 AAATGACCAAATACTGTGCCCGG - Intergenic
1165267651 19:34675186-34675208 AAATAACCATAAACTCTGGTAGG + Intronic
1165877380 19:39018202-39018224 ACATAAACACAGACTTTGCATGG + Intronic
1167720104 19:51173576-51173598 AAATAAGCACAGACTATACTGGG + Intergenic
1167734126 19:51281421-51281443 AAATGATCACAGATTGGGCTGGG + Intergenic
1168576126 19:57512340-57512362 ACATAAACACAGACTGTACTTGG + Intronic
925053990 2:841383-841405 AAATTACCCCAGACTGTGAAAGG - Intergenic
926610070 2:14937681-14937703 GAATAACAATAGAATGTGCTGGG - Intergenic
926973612 2:18491330-18491352 AAATGTGCCCAGACTGTGCTGGG - Intergenic
926977503 2:18529985-18530007 CAATAGCCACTGAGTGTGCTTGG + Intergenic
926991532 2:18685746-18685768 GAATAACTATAGACTGTGCTGGG + Intergenic
927099781 2:19779253-19779275 AAAGAACCACAAAGTGTGATCGG + Intergenic
927316184 2:21685946-21685968 AAATAAACACAGGGTGTGATTGG + Intergenic
928070157 2:28206963-28206985 AAATAACTGAATACTGTGCTTGG - Intronic
929294128 2:40227397-40227419 AAATAACCACATCCTTTGCAGGG + Intronic
929466987 2:42153925-42153947 AAATAACAAACAACTGTGCTTGG + Intergenic
930890373 2:56378525-56378547 AGAAAATCACTGACTGTGCTTGG - Intronic
931792424 2:65676507-65676529 GAATAACTATAGAATGTGCTGGG - Intergenic
933466166 2:82654971-82654993 AAATAGCCATAGACTGTTCTAGG - Intergenic
935211743 2:100944701-100944723 AAAGGGCCCCAGACTGTGCTTGG - Intronic
935350492 2:102148223-102148245 AAATAACCACAGAGCGTGCTGGG - Intronic
936020677 2:108992657-108992679 AAATATACACACACTGTGTTAGG - Intergenic
940205002 2:151192981-151193003 ATATAACTATAGAATGTGCTGGG - Intergenic
940382922 2:153036508-153036530 GAATAACCATAGAATGTGCTGGG - Intergenic
943019403 2:182553979-182554001 AAATCATCACAGACTGTTTTAGG + Intergenic
944424545 2:199566380-199566402 AGATAGTCACAGACTGTTCTAGG - Intergenic
944806659 2:203288359-203288381 AAATAAACACAGGCTGGGCTGGG - Intronic
945308183 2:208280336-208280358 AAATAACCATAGAGTGAGTTTGG + Intronic
945322163 2:208436801-208436823 GAATAACTATAGAATGTGCTGGG - Intronic
945504358 2:210620237-210620259 AAATATTCACAGACTGAGATGGG + Intronic
945759111 2:213890221-213890243 AAATATCCAGAGACTGTGTGAGG + Intronic
948239059 2:236413521-236413543 AAATAACCTAAGAATGTGGTTGG + Intronic
948260841 2:236603538-236603560 AAATAACCACAGGAGGCGCTTGG - Intergenic
948661450 2:239509008-239509030 AAATCAACACAGACTGGGTTAGG - Intergenic
1169271398 20:4202172-4202194 AAATAACTGTAGAATGTGCTGGG + Intergenic
1171444174 20:25191995-25192017 GAATAACTGCAGAATGTGCTAGG - Intergenic
1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG + Intronic
1173846530 20:46192096-46192118 AAATAAAAACAGAGGGTGCTGGG - Intronic
1175356302 20:58371478-58371500 ACATGACAACAGACTGGGCTGGG + Intergenic
1176719344 21:10380457-10380479 AAAAAACCACAGATTGGGCCGGG - Intergenic
1177077126 21:16589658-16589680 AAATAACTACAGAGTATGCGTGG + Intergenic
1177218642 21:18161739-18161761 AAATACTCGCAGCCTGTGCTGGG - Intronic
1177752002 21:25296287-25296309 GAATAACCATAGAATGTGCAAGG + Intergenic
1180300571 22:11033390-11033412 AAAAAACCACAGATTGGGCCGGG - Intergenic
1182930032 22:34164673-34164695 AAATAACCACAGCGTGTGCTCGG - Intergenic
1183469942 22:37999844-37999866 AAATAACAACACACAGTGGTTGG - Intronic
1183972951 22:41492137-41492159 AAATAGGCACAGAAAGTGCTTGG + Intronic
1185361788 22:50412471-50412493 AAATAACCCCAGGCTGGGCATGG - Intronic
950152950 3:10702664-10702686 AAATGACCAAAGATTGTGCTGGG - Intronic
950980127 3:17294693-17294715 AGATATCCAGAGACTATGCTAGG + Intronic
951108179 3:18770060-18770082 ATATATCCACAGACTATGATAGG + Intergenic
951616291 3:24549168-24549190 AAAAAAACAGAGACTGTGCAAGG - Intergenic
952889912 3:38032766-38032788 AAATAATCCCATACTGTCCTGGG - Intergenic
953767075 3:45751632-45751654 ACATAAGCACAAAATGTGCTAGG - Intergenic
955048027 3:55378066-55378088 AGAGATCCACAGACTCTGCTGGG - Intergenic
958631067 3:96684904-96684926 AAATAAGCTCAGACTGTGAAAGG - Intergenic
958962467 3:100523083-100523105 AAATAACCCCAGAATATGGTAGG - Intronic
959046779 3:101483724-101483746 AAATTAACACAAACTGGGCTGGG + Intronic
959723185 3:109515196-109515218 AAATTACCATAGACTTGGCTGGG + Intergenic
959856714 3:111167637-111167659 AAATAATGAGAGACTATGCTGGG + Intronic
960947724 3:122978319-122978341 AAAGAACCACTCACTGAGCTGGG + Intronic
961103781 3:124223733-124223755 ACAAAACCACAGACAGGGCTGGG + Intronic
963145596 3:141990522-141990544 ATAAAACCACAGACTGGGCACGG - Intronic
963893578 3:150661897-150661919 AAAAAACCACTGAGTCTGCTAGG + Intronic
963914396 3:150844496-150844518 AAATAAACACAGCCTGGGCGTGG + Intergenic
964775521 3:160272183-160272205 AAAGATCCACACACTGTGATTGG - Intronic
965656500 3:170990580-170990602 AAATAAGCACAGGCTGGGCATGG + Intergenic
966768078 3:183480072-183480094 AAATTACCCCAGGCTGTCCTTGG + Intergenic
970061340 4:12037874-12037896 AAAAAACCACAGTCTGGGCTGGG - Intergenic
970777232 4:19689863-19689885 AAATAACTACAGACTTTTCAAGG + Intergenic
970778070 4:19701653-19701675 AAATAAAAACAAACTGGGCTTGG - Intergenic
971930328 4:33073240-33073262 AATTAAACTCAGAGTGTGCTGGG - Intergenic
972870849 4:43295834-43295856 TAATATCCACTAACTGTGCTAGG + Intergenic
973097915 4:46225572-46225594 AAATAATCACAGGCTGGGTTTGG - Intergenic
973238111 4:47928015-47928037 AAATAAGCATAGCCCGTGCTTGG + Intronic
973745296 4:53958152-53958174 TAACAAGAACAGACTGTGCTCGG + Intronic
975106493 4:70573422-70573444 AAACAACCAGAGACTCAGCTGGG + Intergenic
976107903 4:81639492-81639514 CAATAACCACACCCTGTGCTGGG - Intronic
977564996 4:98571569-98571591 AAAAAACCACATACTGTGCAAGG + Intronic
977840843 4:101702153-101702175 AAAAAATCACAGAATGTTCTAGG + Intronic
978130137 4:105186067-105186089 AAATAAACAAAAAATGTGCTGGG + Intronic
978268154 4:106852720-106852742 AAATAACCACAAACTGTCATAGG - Intergenic
978370127 4:108021723-108021745 TCAAAACCACAGACTGAGCTGGG - Intronic
979595871 4:122533331-122533353 AAATAACCACAGGATGGGTTTGG + Intergenic
979612098 4:122700266-122700288 TAATAACTGCAGAATGTGCTGGG + Intergenic
980478624 4:133355741-133355763 AAATAACTATAGACTGTGTTGGG + Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
980832457 4:138148751-138148773 GAATAACTATAGAATGTGCTGGG + Intergenic
981708051 4:147681917-147681939 AAACAAACACAGACTTTGTTCGG + Intronic
982501944 4:156168627-156168649 AATTTACCAGACACTGTGCTTGG - Intergenic
983699771 4:170578127-170578149 GAATAATCACATACTGTTCTTGG - Intergenic
984077823 4:175205555-175205577 AAAAATACACAGACTCTGCTGGG + Intergenic
984124086 4:175784411-175784433 AATTAACTACAGACTTTACTTGG - Intronic
986525144 5:8665394-8665416 AAATAACCACAGGTTGGGTTTGG - Intergenic
987108365 5:14662866-14662888 AAATAACCACAGGATGGGTTTGG - Intergenic
987656977 5:20819674-20819696 GAATAACCATAGAATGTGCTAGG - Intergenic
987665462 5:20932740-20932762 AAATAACCACTGACTGGGCATGG - Intergenic
987841539 5:23228045-23228067 GAATAACCGTAGAATGTGCTGGG + Intergenic
988757230 5:34269438-34269460 AAATAACCACTGACTGGGCATGG + Intergenic
988766573 5:34384274-34384296 GAATAACCATAGAATGTGCTAGG + Intergenic
988951732 5:36268998-36269020 AAGTAACCACAGGCTGGGCGCGG - Intronic
989341894 5:40385558-40385580 AAATAACCAAACACTGTGAGAGG - Intergenic
993297808 5:86165055-86165077 AACTTACCACATACTGTGTTAGG + Intergenic
993492640 5:88570526-88570548 GAATAACTATAGAATGTGCTGGG + Intergenic
994793878 5:104268236-104268258 AAAAAACAAGAGAGTGTGCTGGG + Intergenic
995434400 5:112119578-112119600 TGGTAACGACAGACTGTGCTAGG + Intergenic
998017401 5:138743472-138743494 AAATAACCATACAATGTGTTAGG + Intronic
998177894 5:139913054-139913076 ATACATCCACAGACTGGGCTTGG - Intronic
998530801 5:142882720-142882742 AATAAACCACATACAGTGCTTGG - Intronic
1000034466 5:157434134-157434156 GAATAACTACAGAATGTGCTGGG + Intronic
1000305802 5:159993528-159993550 GAATAACTATAGAATGTGCTGGG - Intergenic
1000603455 5:163302080-163302102 AGATAACCAGAGACAGTACTTGG + Intergenic
1002323027 5:178386979-178387001 AAATACCCACAGGCTGACCTCGG + Intronic
1002357540 5:178642818-178642840 GAAAAACCATAGAATGTGCTGGG - Intergenic
1002674374 5:180898795-180898817 AAAGGACCTCAGACTGTGCCAGG + Intergenic
1003548405 6:7080813-7080835 AAATTAACAGAGACTGGGCTGGG + Intergenic
1007224422 6:40302897-40302919 ATCTAGCCACAGCCTGTGCTAGG - Intergenic
1007277388 6:40685158-40685180 CAATAACCACAGAGTGAACTTGG - Intergenic
1009625515 6:66135647-66135669 AAATATACACAGACTGGTCTAGG - Intergenic
1010055975 6:71564029-71564051 AAATAGCCATAGACTGAGCACGG + Intergenic
1010516230 6:76774782-76774804 AAATAACTATAGAATGTGCTGGG + Intergenic
1011518957 6:88183104-88183126 AAATAACCACAAAATGTGCTTGG + Intergenic
1013244961 6:108277610-108277632 AAGAAACCAGGGACTGTGCTAGG + Intergenic
1013669554 6:112384717-112384739 AGAAAACCACAGGCTGTGGTGGG + Intergenic
1014669367 6:124281480-124281502 TAATAAACACAGACTGTCATAGG - Intronic
1017770195 6:157638780-157638802 AAAAAGACACAGCCTGTGCTTGG + Intronic
1018558944 6:165080697-165080719 AAATAACAACATACTGAGTTTGG + Intergenic
1019403102 7:867647-867669 AAATCACCAATCACTGTGCTGGG + Intronic
1020142256 7:5618982-5619004 AAATAAACACAGATTGGGCCGGG + Intergenic
1020890427 7:13871075-13871097 AATTAATCATAGAATGTGCTGGG - Intergenic
1021055595 7:16042705-16042727 GAATAACCATAGAATGTGCTGGG - Intergenic
1021675966 7:23081169-23081191 GAATGACCATAGCCTGTGCTGGG + Intergenic
1024611394 7:51067159-51067181 ATATAGCCACATACTGTCCTTGG + Intronic
1024782948 7:52873690-52873712 AATTAACCACAGAATGTGTTTGG + Intergenic
1028060611 7:86309738-86309760 AAACAACTACAGACTGGGCACGG + Intergenic
1029789644 7:102828958-102828980 GAATAACTATAGAATGTGCTGGG + Intronic
1031280545 7:119795221-119795243 AAAGAACCACAGTCTCTGCCTGG - Intergenic
1031412388 7:121456138-121456160 AGAGAACAACAGACTGTGCCTGG - Intergenic
1032301736 7:130693932-130693954 AAATAACTCCAGACTCTGCATGG + Intergenic
1036825261 8:11970856-11970878 CGATAACCACCCACTGTGCTGGG - Intergenic
1038414551 8:27384843-27384865 AAACAACCTCAGACAGCGCTTGG - Intronic
1039147714 8:34467623-34467645 AAGTAACCGGAGACTGTGGTGGG - Intergenic
1039260509 8:35766194-35766216 TAATTACCACACACTGTACTAGG - Intronic
1039720481 8:40159111-40159133 AAACAACCCCAGACTGAGCCTGG + Intergenic
1041280478 8:56205905-56205927 AACTAACCACAGTGTGTGCTGGG - Intronic
1041499131 8:58520382-58520404 AAATAATCACGGCCTCTGCTAGG - Intergenic
1042062450 8:64835424-64835446 AAATAAACAGAAACTGTGCCAGG - Intergenic
1044750270 8:95409035-95409057 AAATAACCACAGAATGGGTTTGG - Intergenic
1045184371 8:99821771-99821793 AAATATCCACAAATTGTACTTGG + Intronic
1045779084 8:105842731-105842753 AGAAAACCATAGACTTTGCTGGG + Intergenic
1046753133 8:117945789-117945811 AAATAACCACAGACCAGGCGTGG - Intronic
1047499064 8:125428718-125428740 AAATAACCCCATAGTGTGGTTGG + Intergenic
1050210024 9:3243779-3243801 AAATAGTCACAAACTTTGCTGGG - Intronic
1050854711 9:10338472-10338494 GAATACCCACAGTATGTGCTGGG - Intronic
1051560328 9:18434265-18434287 AAAAAACAAGAGGCTGTGCTCGG + Intergenic
1051804941 9:20981801-20981823 AAATAACCACATTCTTTACTAGG + Intronic
1052474398 9:28939939-28939961 AAACAGCCACAGACAATGCTGGG - Intergenic
1053348765 9:37397608-37397630 AAAATACCACAGACTGGACTGGG + Intergenic
1053417461 9:37955781-37955803 AAAAATCCACAGACTGGGCCGGG - Intronic
1056289767 9:85131233-85131255 ATGTAAACAGAGACTGTGCTGGG - Intergenic
1057961152 9:99458638-99458660 AAATATACACACACTTTGCTGGG + Intergenic
1059279656 9:113121448-113121470 AAACAACAACAAACTGTTCTTGG - Intergenic
1059334591 9:113560892-113560914 AGATACCCCAAGACTGTGCTGGG - Intronic
1185541379 X:905523-905545 AAAAAACCACAGATTGGGCCAGG + Intergenic
1186171318 X:6879966-6879988 GAATAACTATAGAATGTGCTGGG - Intergenic
1187179366 X:16929206-16929228 AAATAATCACACACTGACCTTGG - Intergenic
1188764358 X:34074063-34074085 AAATAACTACAGGATGTGGTTGG - Intergenic
1189949058 X:46210008-46210030 ACATAACCACAGAATGTGCAAGG + Intergenic
1190538214 X:51450000-51450022 AAATAACCACAAAATGGGTTTGG - Intergenic
1190721994 X:53156437-53156459 AAATAACCACAGCATGGGCTTGG + Intergenic
1192204189 X:69085426-69085448 GAATGACCATAGACTGTGGTGGG + Intergenic
1193543286 X:82796907-82796929 AAATAACCACAGGATGGGTTTGG - Intergenic
1193934647 X:87601621-87601643 AAATGATCACAGCCTGTGCCAGG - Intronic
1196529064 X:116761936-116761958 AAATAACCACAGGATGTGTTTGG - Intergenic
1196709969 X:118752591-118752613 AAATGACAACACAATGTGCTGGG - Intronic
1197189182 X:123626388-123626410 AAATAACCAAAGAATGGGATAGG + Intronic
1200607132 Y:5279103-5279125 AAGTAACCACAGTGTGTGCCTGG + Intronic