ID: 1172038743

View in Genome Browser
Species Human (GRCh38)
Location 20:32029044-32029066
Sequence CAGTGGGAGCCATGGAAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 408}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172038743_1172038753 30 Left 1172038743 20:32029044-32029066 CCTTCTTTCCATGGCTCCCACTG 0: 1
1: 0
2: 4
3: 34
4: 408
Right 1172038753 20:32029097-32029119 GGAGCAGTTACAGGATTACATGG 0: 1
1: 0
2: 2
3: 10
4: 123
1172038743_1172038752 21 Left 1172038743 20:32029044-32029066 CCTTCTTTCCATGGCTCCCACTG 0: 1
1: 0
2: 4
3: 34
4: 408
Right 1172038752 20:32029088-32029110 TCTGGGCTTGGAGCAGTTACAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1172038743_1172038750 9 Left 1172038743 20:32029044-32029066 CCTTCTTTCCATGGCTCCCACTG 0: 1
1: 0
2: 4
3: 34
4: 408
Right 1172038750 20:32029076-32029098 CGACCACAGCAGTCTGGGCTTGG 0: 1
1: 0
2: 0
3: 18
4: 230
1172038743_1172038748 3 Left 1172038743 20:32029044-32029066 CCTTCTTTCCATGGCTCCCACTG 0: 1
1: 0
2: 4
3: 34
4: 408
Right 1172038748 20:32029070-32029092 CGGCAGCGACCACAGCAGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 113
1172038743_1172038749 4 Left 1172038743 20:32029044-32029066 CCTTCTTTCCATGGCTCCCACTG 0: 1
1: 0
2: 4
3: 34
4: 408
Right 1172038749 20:32029071-32029093 GGCAGCGACCACAGCAGTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172038743 Original CRISPR CAGTGGGAGCCATGGAAAGA AGG (reversed) Exonic
900422423 1:2561336-2561358 CAGTGGCAGACAAGGACAGAAGG - Intronic
901150244 1:7096498-7096520 GAGTGGGAGTCAGGGAAGGAGGG - Intronic
901906821 1:12419565-12419587 GAGTGGGAGCAAGGGAAAGAAGG + Intronic
902117019 1:14129511-14129533 CAGTGGGAGAATTGGCAAGAGGG + Intergenic
902783833 1:18720624-18720646 CAGACGGACCCATGGAAAGAAGG + Intronic
904330697 1:29756119-29756141 CAGTGGGAGACAGAGACAGATGG + Intergenic
904415978 1:30361475-30361497 CAGTGGGAGACAGAGACAGATGG - Intergenic
904988730 1:34574018-34574040 CAGTGGGTGCCAGGGGAAGGGGG + Intergenic
905337520 1:37255736-37255758 GATTGGGAGCTCTGGAAAGAAGG - Intergenic
905578795 1:39067689-39067711 CAGTGGCTGCCAAGGAATGAGGG - Intergenic
905792402 1:40797210-40797232 CAGTGGGAGCCCAGCACAGAGGG + Intronic
905905062 1:41612416-41612438 CAGTTGGAGCCATGAACAGGAGG - Intronic
906448395 1:45922771-45922793 CGGTGGGAGCCAGGGAAAAGTGG - Intronic
906697164 1:47830745-47830767 CACTGTGAGCCAGGGAAAGACGG + Intronic
906976325 1:50577013-50577035 CAGTGGGGGCCAAGGCATGAAGG - Intronic
907423447 1:54363014-54363036 CACAGGGAGTCTTGGAAAGAGGG + Intronic
907459123 1:54594743-54594765 CAGTGGGAGCCCGGGGCAGAGGG - Intronic
910604455 1:89067958-89067980 TACTGGGGGCTATGGAAAGAAGG + Intergenic
910920897 1:92345455-92345477 CAGAGGGAGGGAGGGAAAGAGGG + Intronic
911971160 1:104439664-104439686 CACTGGGAGTAATGGTAAGAGGG + Intergenic
912132377 1:106619246-106619268 CAGTGGGAGCCAGGGACAAGTGG + Intergenic
912346826 1:108971290-108971312 CAGTGGGATACATGGTAATAAGG + Exonic
913439614 1:118883992-118884014 CAGTGGTGCCCGTGGAAAGAGGG - Exonic
915029237 1:152861941-152861963 CAGTGGGAGACAAAGAAATAGGG + Intergenic
915597583 1:156904349-156904371 CAGGGGGAGCAAAGGAAACAGGG + Intronic
918370164 1:183852916-183852938 CAGTGAGAGCCATGAAATGTTGG + Intronic
919563754 1:199157867-199157889 AGCTGGGAGCCCTGGAAAGATGG - Intergenic
920112952 1:203599867-203599889 ATGGGGGAGCCCTGGAAAGAGGG - Intergenic
921648091 1:217643450-217643472 CAGTGTGTCCCATGGACAGAAGG - Intronic
921837221 1:219790707-219790729 CAGTGGGGGCCAGGGAGTGAGGG - Intronic
922614795 1:226955372-226955394 GAGTGGGAGCCAGGGAGAGTGGG - Intronic
922614870 1:226955671-226955693 GAGTGGGAGCCAGGGAGAGCGGG - Intronic
922614875 1:226955687-226955709 GAGTGGGAGCCAGGGAGAGTGGG - Intronic
923090323 1:230735673-230735695 GAGTGGAAGCCAGGGAAGGAAGG - Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924610025 1:245565956-245565978 GAGTGGGAGCAATAGAGAGAAGG + Intronic
1063113935 10:3060093-3060115 CAGTGGCTGGCAAGGAAAGAAGG + Intergenic
1063833366 10:9982937-9982959 TAGTGGGAGACATGGCAAGCAGG + Intergenic
1064029908 10:11877226-11877248 CCGTGGGTGGCAAGGAAAGAAGG - Intergenic
1064464539 10:15566249-15566271 CTGTGAGAGCCGTGGAAAGCTGG - Intronic
1064587386 10:16852231-16852253 TAGAGGGAGGGATGGAAAGATGG - Intronic
1065419231 10:25523204-25523226 CAGTGGGAGCCCTGAACAAAAGG + Intronic
1066025550 10:31355742-31355764 CAGTGTGAGCGTTGAAAAGAAGG + Intronic
1066564830 10:36710557-36710579 CAGTGGGATGGATGGAAAGCTGG - Intergenic
1067556467 10:47276775-47276797 GGGTGGAAGCCATGGAAAGCTGG - Intergenic
1067770132 10:49116619-49116641 GTGTGGGTGGCATGGAAAGAGGG + Intergenic
1067831322 10:49612634-49612656 CACTGGGAGCAATGGAAGGAAGG - Exonic
1070215877 10:74380046-74380068 GAGTGGGAGGCAGGCAAAGAAGG - Intronic
1070554516 10:77517386-77517408 CACTAGGAGCCAGGGACAGAGGG - Intronic
1070560931 10:77566080-77566102 CAGTGATAGGCAAGGAAAGATGG + Intronic
1071345820 10:84691459-84691481 CCCTGGAAGCCAAGGAAAGAAGG + Intergenic
1071518106 10:86312569-86312591 CAGTGGGTGCCATGGAAGGAAGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072803872 10:98411935-98411957 CAGTGGGACTCATGAACAGATGG + Intronic
1074665024 10:115712375-115712397 CAGTGGTATCTAAGGAAAGAAGG + Intronic
1074872338 10:117587137-117587159 CTTCGGGAGCCAAGGAAAGATGG - Intergenic
1075167799 10:120084927-120084949 CAGTAGTAGCCAGGGAAATAGGG - Intergenic
1075192311 10:120320880-120320902 CACCTGGAGCCATGGAAACAGGG - Intergenic
1075812695 10:125237047-125237069 CAGTCAGAATCATGGAAAGAAGG + Intergenic
1075895505 10:125991139-125991161 CAGAGGCAGCCATGGAGAGTTGG + Intronic
1076498120 10:130912617-130912639 TAGTGGGAGCAATTGAGAGAAGG - Intergenic
1077443110 11:2577881-2577903 AAGGGGGAGCCGTGGACAGAGGG - Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079145508 11:17847670-17847692 CAGGGGGAGCAAGGGACAGAAGG + Intronic
1081567609 11:44269700-44269722 CACTGGGAGCCAAGGACAGATGG + Intronic
1083380687 11:62265917-62265939 CAGTGGGAGTCATGGACACCAGG + Intergenic
1084041496 11:66545671-66545693 AAGTGGGAGCCTTGGACAGGGGG - Intronic
1084387321 11:68852085-68852107 CTGTGGGAGACATGGAAATGGGG - Intergenic
1084472797 11:69373036-69373058 CAGTGGGAGACGTGGACAGCAGG + Intergenic
1084497531 11:69513652-69513674 GAGAGGGAGCGAAGGAAAGAAGG - Intergenic
1085276306 11:75302356-75302378 AAGAGGGGGCCATGGACAGAGGG + Intronic
1085738634 11:79060984-79061006 CAGTGGGAACTAGAGAAAGATGG + Intronic
1086089639 11:82992681-82992703 CTGGGGGAGGGATGGAAAGAAGG - Intronic
1086944895 11:92835223-92835245 CAGAAGGAGCCATAGAAAGATGG - Intronic
1087892369 11:103550103-103550125 CAGTTGGACTCATGGAAAGGAGG + Intergenic
1088711554 11:112513173-112513195 CATATGGAGCCATGGAAGGAGGG - Intergenic
1088995994 11:114997237-114997259 CACTGGGAGCTTTGGAGAGAGGG + Intergenic
1089493922 11:118899188-118899210 CAGTGGGGGCCATGGCACCATGG + Exonic
1090095042 11:123734374-123734396 GAGTGGCAGTCATGGAAGGAAGG - Intronic
1090153943 11:124416663-124416685 CAGTTGGAGCCAGATAAAGAAGG + Intergenic
1090354326 11:126129701-126129723 CAGTGGGTTCCATGCTAAGAAGG - Intergenic
1090745732 11:129703457-129703479 CAGAGTGTCCCATGGAAAGAAGG - Intergenic
1094142221 12:27192951-27192973 AAGTGAGAGGCATGGAAATAAGG - Intergenic
1094227951 12:28067456-28067478 CAGTTGGAGCCACGGAAGGTGGG + Intergenic
1094435281 12:30414271-30414293 CAGTGGTAGTCATGGATAGATGG - Intergenic
1096152646 12:49324042-49324064 CTGTTGGAGCCATGGTAACACGG + Intronic
1096843110 12:54391039-54391061 CAGCGGCAGCCTGGGAAAGAGGG + Intronic
1097312959 12:58141185-58141207 AAGTGGGAGCAAGAGAAAGAGGG - Intergenic
1098817822 12:75190228-75190250 TACTGGGAGCTATTGAAAGAGGG - Intronic
1100785278 12:98071782-98071804 AAGGGGGTGCCATGGACAGATGG + Intergenic
1100948663 12:99819903-99819925 AAGTGGGAGGCAGGGAAGGAAGG + Intronic
1102125636 12:110478210-110478232 CAGTGGGAGCCCTTTAAAGATGG + Intronic
1102500506 12:113349004-113349026 CAGAGGGAGCAAGGGAAGGAGGG - Intronic
1102923433 12:116809553-116809575 CACTGGGAGCCATGCCAAGATGG + Intronic
1104742392 12:131188288-131188310 CAGTGGGAGCCAGGAACAGGTGG + Intergenic
1105283141 13:18981398-18981420 AAGTGAGAGCCATGGAAAACAGG + Intergenic
1105706820 13:22972351-22972373 CACTGGGTGCCATGGAAAGAGGG - Intergenic
1106881907 13:34140769-34140791 CAGTGGAAGTGCTGGAAAGAGGG + Intergenic
1108104758 13:46997281-46997303 AAATGGCAGCCATGGAAATAGGG - Intergenic
1109348356 13:61145011-61145033 CAGTGGGAGCCAGGAACAGGAGG + Intergenic
1110812876 13:79829889-79829911 AAGTGGGAGTCTGGGAAAGATGG - Intergenic
1112379953 13:98879254-98879276 CAGTGGGAACCAGGGGAAGCAGG + Intronic
1112705686 13:102066998-102067020 CAGTAGGAGACATGGTGAGACGG - Intronic
1113337838 13:109393907-109393929 CAGTGAGAGACATAGCAAGAGGG - Intergenic
1113517463 13:110914661-110914683 CAGTGGGAGTCGGGGAAAGCGGG - Intronic
1113758570 13:112831664-112831686 CAGTGGGAGGGATGGTCAGAAGG + Intronic
1115111827 14:29832823-29832845 CACTGGGAGCCTTGTTAAGATGG - Intronic
1116790647 14:49336327-49336349 CAGTGACAGCCAAGCAAAGAAGG + Intergenic
1117056834 14:51920843-51920865 CTGTTGGGGCCATGGAAACATGG + Intronic
1117997655 14:61493033-61493055 AAGTTGGAGGCATGGGAAGAGGG + Intronic
1118137695 14:63046356-63046378 CAGTGTTAGCGATGGAAAAACGG + Intronic
1118253439 14:64183932-64183954 CAGAGGGAGACGTGGAAAGAAGG + Intronic
1118467145 14:66041327-66041349 CAGTGAGGGCCTTGGAAGGAAGG + Intergenic
1118876138 14:69786309-69786331 TGGTGGGAGACATGGGAAGAGGG + Intronic
1119178296 14:72586083-72586105 CAGTGGGAGCCAGGCCATGAAGG - Intergenic
1119257461 14:73210742-73210764 CAGAGGAAGCCATGCAAGGAAGG + Intronic
1119647140 14:76356034-76356056 CAGAGGGAGCCATGGGGAGCTGG + Intronic
1121323553 14:93006826-93006848 CAGTGGCAGGCCTGGAAAAAGGG - Intronic
1121714886 14:96066454-96066476 CAGTTGGACCCAGGGAAATAAGG - Intronic
1122611696 14:102988240-102988262 AAGTGGGAGACAGGCAAAGAAGG + Intronic
1122766351 14:104073739-104073761 GAGAGGGAGCCATGGATAGATGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123162248 14:106289601-106289623 TAGTAGGAGACATGGAAATAGGG - Intergenic
1123992891 15:25696489-25696511 CAGTGGGAGCAACGGGATGAAGG - Intronic
1125437834 15:39667034-39667056 CAGTGGGCGCTGTGAAAAGATGG + Intronic
1126480322 15:49111299-49111321 CAGTGGTGGCCATGGAAGGCTGG - Intronic
1128348100 15:66867492-66867514 CAGTTGGAGCACAGGAAAGATGG + Intergenic
1128565661 15:68699209-68699231 CAGTTGGACCCAAGGAGAGAAGG + Intronic
1128846746 15:70905429-70905451 GGGTGGGAGGCAGGGAAAGATGG - Intronic
1130246436 15:82254270-82254292 CAGTGGGATCTAAGGAGAGATGG - Intronic
1130458799 15:84142388-84142410 CAGTGGGAGCTCTGGCAAGTTGG + Intergenic
1132246532 15:100300478-100300500 CAGTGGGGGCATTGGAAAGTTGG - Intronic
1132390808 15:101436963-101436985 CTGTGGGATCCAGGGCAAGATGG - Intronic
1132981076 16:2738938-2738960 CAGTGAGAGCCAGGCACAGAGGG + Intergenic
1133071755 16:3251201-3251223 CAATGGGAGGCAGGGAAACAGGG - Intronic
1133102841 16:3489627-3489649 CTGAGGAAGCCATGGAAGGAAGG - Intergenic
1134366852 16:13586761-13586783 CTATGGGAGCCAGAGAAAGAGGG - Intergenic
1134628328 16:15738917-15738939 CAGTGGCAGGAATGGAAGGAGGG - Intronic
1135041564 16:19121486-19121508 CTGTGGGGGCCATGGAAATTTGG - Exonic
1135626904 16:24003326-24003348 CAGTTGACCCCATGGAAAGATGG + Intronic
1136870419 16:33802620-33802642 TAGTGGGGGACATGGAAATAGGG + Intergenic
1137382520 16:48012462-48012484 CAGTGGGAGCCCTGCATAGCTGG - Intergenic
1138774784 16:59708087-59708109 CAGTGAGGGCCATGGAAGGCTGG + Intergenic
1139058868 16:63223387-63223409 AATTGGGAGACATGGAAGGAAGG + Intergenic
1139415527 16:66805386-66805408 CAGTGGGAGAGATGGAAGGCAGG + Intronic
1139906099 16:70366939-70366961 CCCTGAGCGCCATGGAAAGAAGG + Intronic
1140333074 16:74076533-74076555 CAGTGGGAGGGAGGGAAAGAAGG - Intergenic
1140544921 16:75798330-75798352 ATGTGGATGCCATGGAAAGATGG + Intergenic
1140905734 16:79407465-79407487 CAGAGGGAGAGAGGGAAAGAGGG - Intergenic
1140955180 16:79856855-79856877 TAGTGTGACCCATGGACAGAAGG - Intergenic
1141312349 16:82926734-82926756 CAGTGTGAGGCATGGACAGGAGG + Intronic
1142273540 16:89103773-89103795 CAGAGGAAGCCATGCAGAGAGGG - Intronic
1142349548 16:89573867-89573889 GAGGGGGAGCCTTGGAAAGATGG + Intergenic
1203101754 16_KI270728v1_random:1313430-1313452 TAGTGGGGGACATGGAAATAGGG - Intergenic
1142467844 17:146256-146278 CAGTGTGAGCCATGGAGTGGAGG + Intergenic
1142956686 17:3527628-3527650 CAGATGGAGAGATGGAAAGATGG + Intronic
1143002075 17:3800799-3800821 AAGTGGGTGCCATGGGGAGAGGG + Intronic
1143536486 17:7543384-7543406 CAGAGGGAGGCAGGGAAGGAGGG + Intergenic
1143895811 17:10135430-10135452 CAGTCTGAGCAATGGACAGAGGG - Intronic
1145964242 17:28905678-28905700 GGGTGGGAACCATGGAAGGAAGG + Exonic
1146052098 17:29562487-29562509 AAGGGGGAGTCCTGGAAAGATGG - Exonic
1146673966 17:34760377-34760399 CACTGAGAGCCATGCACAGAGGG - Intergenic
1147155640 17:38543360-38543382 CAGGCGGAGCCCTGGGAAGAGGG + Intronic
1147764329 17:42823723-42823745 CAGCGAGACCCTTGGAAAGAGGG - Intronic
1148887763 17:50786165-50786187 CTATGGGGGCCATGGAAAGGAGG - Intergenic
1150950770 17:69800936-69800958 CAGTGGGAGCCAGGGACATGTGG + Intergenic
1151149718 17:72074671-72074693 CAGTGTGAGAAATGGAAAGGAGG - Intergenic
1151548967 17:74810393-74810415 CAGGGGGAGCCAAGGACAAAGGG + Intronic
1151683840 17:75635565-75635587 CAGTTGGAGCCAGGGCAAAAAGG + Intronic
1153646174 18:7198045-7198067 AAGTGAGAGACATGGAGAGAAGG + Intergenic
1155413643 18:25572502-25572524 CAGTGGAAGACATGAAAATATGG - Intergenic
1155880445 18:31141404-31141426 CAATGAGAGCTATGGATAGATGG + Intronic
1156092732 18:33490857-33490879 CAGCAGGAACAATGGAAAGAGGG + Intergenic
1156473758 18:37393313-37393335 CACTCAGAGCCATGGAAACAGGG + Intronic
1156497072 18:37532908-37532930 AAGTGGCTGCCCTGGAAAGAGGG + Intronic
1156530861 18:37813828-37813850 CAGTAGGATGCATGGATAGATGG - Intergenic
1156554619 18:38053208-38053230 CAGTGGGAGCCATGAGCTGATGG - Intergenic
1157394530 18:47330799-47330821 AAGTGGGAGCGATGGTGAGATGG - Intergenic
1158726880 18:59981375-59981397 CACTGGGTGCCATGGAAAGGGGG + Intergenic
1160116751 18:76085521-76085543 CAGTGGGAGTCAGGGACAAATGG - Intergenic
1160731681 19:644143-644165 CAGTGAGAGCCAGAGAGAGATGG + Intergenic
1162533316 19:11248256-11248278 CAGAGGCAGGGATGGAAAGACGG - Intronic
1162543330 19:11311765-11311787 CAGTGGGTGCCATTTATAGATGG + Intronic
1162835871 19:13317577-13317599 GAGTGGGAGACATGGAAAATTGG - Intronic
1163036785 19:14574266-14574288 CACAGGTAGCCCTGGAAAGAAGG - Intergenic
1163765774 19:19162573-19162595 CAGAGGGACCTATGGAAAAAAGG - Intronic
1164476087 19:28576987-28577009 CAGTAGGTGCCTGGGAAAGAAGG + Intergenic
1164483166 19:28632213-28632235 CAATGGGACCCAAGGAAAGCAGG + Intergenic
1164511464 19:28900665-28900687 CAGAGGGAGAGATGGAGAGACGG + Intergenic
1164519620 19:28968688-28968710 CAGTGGGAGCCATGCAAGCCTGG - Intergenic
1164799331 19:31063107-31063129 GCATGGTAGCCATGGAAAGATGG - Intergenic
1164852006 19:31491824-31491846 CAGAGGCAGCCATGCCAAGACGG - Intergenic
1164904496 19:31955957-31955979 CAGTGGGAAGGATGGAAAGCGGG - Intergenic
1165021237 19:32926012-32926034 GGGTGGGAGGCAGGGAAAGAAGG - Intronic
1165463408 19:35958144-35958166 CAGTGGGAGGCCTGGAGGGAAGG + Intergenic
1165758663 19:38308397-38308419 GATTGGGAGCCATGGATAGCAGG + Intronic
1165956650 19:39505385-39505407 CAGTTGGAGCCTTGGAAACCGGG - Exonic
1166048995 19:40246984-40247006 CAGTGGGAGCCAGGGTAGGTGGG - Intronic
1166329105 19:42068641-42068663 CCGAGGGAGACTTGGAAAGAGGG + Intronic
1166333468 19:42091677-42091699 CAGTGGGACCGATGGGGAGATGG - Intronic
1166338040 19:42121053-42121075 CAGTGGGACCAAGGGAATGAAGG - Intronic
1166515130 19:43440802-43440824 GTGTGTGAGCAATGGAAAGAAGG + Intergenic
1167181498 19:47907551-47907573 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167182156 19:47912924-47912946 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167182814 19:47918302-47918324 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167183483 19:47923652-47923674 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167184122 19:47928691-47928713 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167184779 19:47934054-47934076 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167185445 19:47939414-47939436 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167186104 19:47944795-47944817 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167186762 19:47950169-47950191 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167187414 19:47955555-47955577 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1167541496 19:50090915-50090937 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167541769 19:50092714-50092736 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167542442 19:50098051-50098073 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167542879 19:50101116-50101138 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167543315 19:50104180-50104202 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167543749 19:50107239-50107261 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167544423 19:50112593-50112615 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167545098 19:50117945-50117967 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167545775 19:50123299-50123321 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167546452 19:50128627-50128649 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167547121 19:50133969-50133991 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167547780 19:50139342-50139364 CAGGGGGCGCCATGGAACGCAGG - Intergenic
1167627937 19:50604836-50604858 CAGGGGGCGCCATGGAACGCAGG + Intergenic
1168701449 19:58442011-58442033 CAGAGGGAACAATGGAAAGGCGG - Intergenic
925284267 2:2705673-2705695 CAGTGGCAGCCGTGGAGGGAGGG + Intergenic
925586591 2:5470656-5470678 CAGTGAGAGCGATGGTGAGAGGG - Intergenic
925739929 2:6996373-6996395 CAGTGGGAGGGAGGGAAGGATGG + Intronic
927657195 2:24959251-24959273 GAGTGGGAGCAATAGAGAGAAGG - Intronic
928167527 2:28981782-28981804 CACTGGGAGCCAAGGAAGGAGGG + Intronic
928593424 2:32839342-32839364 CCTTGGCTGCCATGGAAAGAAGG + Intergenic
929434119 2:41914252-41914274 GAGTGAGAGCGGTGGAAAGAGGG - Intergenic
929791205 2:45024386-45024408 CAGTGGTAGCCAGGGCAAGAGGG + Intergenic
930101819 2:47609291-47609313 CAATGGGAGCCATGCAGACAGGG + Intergenic
931222673 2:60302167-60302189 CTGTGTGACCCATGGAGAGAGGG - Intergenic
933078195 2:77955131-77955153 CAGGGGGCGCCATGGAACGCAGG - Intergenic
934552952 2:95273143-95273165 GACTGGGAGCCTTGGAGAGAAGG - Intergenic
934734133 2:96679825-96679847 CAGTGAGGGGCATGGAAATAAGG - Intergenic
935901880 2:107801696-107801718 CAGCGGGAGCCAGGTGAAGATGG - Intergenic
936233558 2:110724896-110724918 CAGAGGGAGGGAAGGAAAGAAGG + Intergenic
937333057 2:121044155-121044177 CTCTGGGAGCCTGGGAAAGAGGG + Intergenic
938114250 2:128592429-128592451 CAGGGGGAGCAAGGGAATGAGGG + Intergenic
938938942 2:136152258-136152280 TAGTGGGAGGGAGGGAAAGAAGG - Intergenic
939633334 2:144551558-144551580 CAGTGGGGGCCATGGACATTCGG + Intergenic
939864192 2:147454539-147454561 CACTTGGAACCTTGGAAAGATGG - Intergenic
939963162 2:148584215-148584237 CAGTGGGAGCCATGCCATGTTGG - Intergenic
940625261 2:156167299-156167321 TAGTGGGAGCAATGGAAAGAGGG + Intergenic
941660001 2:168186533-168186555 TAGTAGGAGCCTTGAAAAGAAGG + Intronic
942516403 2:176757965-176757987 CAGTAAGAGCCAAGCAAAGAGGG - Intergenic
943050756 2:182910455-182910477 CAGTTGGAGCCTTGGGAACAAGG + Intronic
943355029 2:186843787-186843809 CAGTTGGAGACATGGAAAATGGG + Intronic
943705637 2:191031022-191031044 CACTTGGAGACATGGGAAGAAGG + Exonic
944672422 2:202006218-202006240 CAGTGAGAGCTTTGGAAAGCAGG - Intergenic
947187571 2:227468895-227468917 CAGTGGGAACCACTGAAAGCTGG - Intergenic
947871481 2:233441215-233441237 CAGGGGGAGCCCAGGAAGGAAGG + Intronic
948046306 2:234948040-234948062 AAGTGGGAGCAAGAGAAAGAGGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
949022307 2:241748568-241748590 CAGTGGCAGCCATGGTGGGAGGG - Intronic
1168795033 20:605655-605677 AAGTGGCAGCCATTGGAAGATGG + Intronic
1168833989 20:864779-864801 CAGTGGGATCCTGGGAAAGGTGG + Intergenic
1168889703 20:1286993-1287015 AAGTGGGTCCCAAGGAAAGATGG - Intronic
1169169436 20:3452807-3452829 CAATGAGAGCCATTGAAATATGG - Intergenic
1170592623 20:17782354-17782376 GGGTGGGAGCCAGGGAGAGAGGG + Intergenic
1170886004 20:20340351-20340373 CAGAGGGAGGCAAGGAGAGAGGG + Intronic
1171036302 20:21714999-21715021 CAGAGGGAGCCCTGGAAGGTCGG - Exonic
1171289808 20:23975985-23976007 CTGGGGCAGCCATGGAACGAAGG + Intergenic
1172038743 20:32029044-32029066 CAGTGGGAGCCATGGAAAGAAGG - Exonic
1172302988 20:33862986-33863008 GAGTGGGAAGCATGGAGAGAGGG - Intergenic
1173022539 20:39279065-39279087 AAGTAGGAGCTATGGAAGGAGGG - Intergenic
1173249035 20:41354892-41354914 CAGGGGGAGCCTGGGAAAGATGG + Intronic
1174221542 20:48959521-48959543 CAGAGGGAGGGAGGGAAAGAGGG - Intronic
1174334094 20:49845555-49845577 GAGAGGGAGACATGGAAGGATGG - Intronic
1175523419 20:59617785-59617807 CAGAGGGAGGGATGGAAGGAGGG - Intronic
1175584315 20:60125958-60125980 CAGCGGGAGCCATGGGATGGGGG + Intergenic
1175588577 20:60168309-60168331 CAGTGGGAGACATGTAGAGTTGG + Intergenic
1175950145 20:62579084-62579106 CAGAGGGAGGCAGGGACAGAGGG - Intergenic
1175950247 20:62579898-62579920 CAGAGGGAGACAGGGACAGAGGG - Intergenic
1179081359 21:38173561-38173583 GTCTGGGAGCCATGGAGAGAGGG + Intronic
1181375571 22:22455173-22455195 CGGAGGGAGCCAGGGAGAGAGGG + Intergenic
1182008253 22:26979364-26979386 CAGTGGGAGCTGTGGAAGGCAGG - Intergenic
1182114982 22:27751203-27751225 CAGCTTTAGCCATGGAAAGAGGG - Intronic
1183026652 22:35070436-35070458 CAGTGGTAGAGATGCAAAGATGG - Intronic
1183271478 22:36865224-36865246 CAGGGGGAGCCATGCAGGGAGGG - Intronic
1183453224 22:37907568-37907590 CTGGGGGAGCCCTGGCAAGAGGG - Intronic
1183502351 22:38188555-38188577 CAGTGGGTGCCCTGGAAGGTTGG + Intronic
1183704463 22:39468449-39468471 CAGGAGGAGCTATGGGAAGACGG - Intronic
1184262867 22:43329331-43329353 CATTGGGCGCCATGGAAACGAGG + Intronic
1184694405 22:46131553-46131575 CAGTGTGGGCCATGGAAGGAGGG + Intergenic
1185088520 22:48753416-48753438 CAGTGGGGGCCCTGGGCAGAGGG - Intronic
951034793 3:17921227-17921249 AAGAGGGAGCCATGGGAAGATGG + Intronic
951718601 3:25674483-25674505 CAGTGGGAGCCATGGACAAGTGG - Intergenic
953381491 3:42476103-42476125 CAATGGGAGCCCTTGAAAGTGGG + Intergenic
954696974 3:52432733-52432755 GAGTGGGAGCCATGCCCAGACGG + Intergenic
955139062 3:56250870-56250892 CAGTGAGACCCAGTGAAAGATGG + Intronic
955824603 3:62932140-62932162 CAGGGAAAGCCATGAAAAGAGGG + Intergenic
956749052 3:72331913-72331935 CAGAGGGCGCCATGCACAGAGGG - Intergenic
956763327 3:72462746-72462768 CACTGGGAGCCCTGGACAGTAGG - Intergenic
956857156 3:73286544-73286566 CAGTAGGAGAGAAGGAAAGAGGG + Intergenic
960082955 3:113560490-113560512 GAGTGGGAGCATGGGAAAGATGG + Intronic
960949546 3:122990280-122990302 CAATGGGAGACATGGAAAGAAGG + Intronic
961827696 3:129607309-129607331 CAGAGGGAGCCACGGAGAGAGGG - Intergenic
961973123 3:130991214-130991236 TAGTGGAAGCCAAGGGAAGATGG + Intronic
964382966 3:156116291-156116313 CATTGGGAGTCAAGGGAAGAAGG - Intronic
965025981 3:163302493-163302515 CAGTGAGAACCATGGACACAGGG + Intergenic
965088540 3:164133012-164133034 TAGTGGTAGCCATGGAACCAAGG + Intergenic
965899945 3:173627196-173627218 GAGTGGGAGGAATGGGAAGATGG - Intronic
966116045 3:176462500-176462522 CAAGGGGAGCCATGAATAGAAGG - Intergenic
967261511 3:187647442-187647464 GAGTGAGAGACATGGACAGAGGG + Intergenic
967640611 3:191858240-191858262 CAGTGGCAGCCCTTGACAGAAGG + Intergenic
968149378 3:196324965-196324987 AAGTGGGAGGGAGGGAAAGAAGG + Intronic
969243785 4:5919281-5919303 CTGTGGTAGCCATGGAAATCGGG - Intronic
969596653 4:8152849-8152871 GAGGGGCAGCAATGGAAAGAAGG + Intronic
970144477 4:13020654-13020676 CACTGCCAGCCTTGGAAAGAGGG + Intergenic
970828511 4:20307190-20307212 GAGAGGGAGTCAGGGAAAGAAGG - Intronic
970970422 4:21976806-21976828 TAGTGGGAGGGAGGGAAAGATGG + Intergenic
971170008 4:24224250-24224272 AATTGGGATCCATAGAAAGAGGG + Intergenic
973072987 4:45888434-45888456 CAGTGGGAGCAGTGTTAAGAGGG - Intergenic
973095811 4:46197914-46197936 CAGTGGGGGTAATGGAAAGAAGG - Intergenic
974717355 4:65685248-65685270 AAGTAGGAGTGATGGAAAGACGG + Intergenic
975321191 4:73011594-73011616 CAGTGGGAGCCAGGGACAAATGG + Intergenic
975615483 4:76242324-76242346 CAGTGGGAGCAAGAGAAAGAGGG - Intronic
975732500 4:77351467-77351489 CAATGAGAGCCATGGGTAGAGGG + Intronic
975910126 4:79258078-79258100 CAGTGGGAGCCAGGGAAAAGTGG + Intronic
976190337 4:82480886-82480908 CAGTGTGAGCAACTGAAAGACGG + Intergenic
976369988 4:84276586-84276608 CAGTGGGAGGCATGGCAAATAGG + Intergenic
976691548 4:87872814-87872836 CAGTGGCAGAGTTGGAAAGATGG - Intergenic
977216252 4:94287325-94287347 CACTGTGAGAGATGGAAAGAAGG - Intronic
977253268 4:94711928-94711950 TTGTGGCAGCCATGGAGAGATGG + Intergenic
977296580 4:95216364-95216386 CAGAGGGAGCCGTGGTAAGGAGG - Intronic
977740207 4:100470943-100470965 CAGAGAAAGCAATGGAAAGAAGG + Intronic
978281664 4:107023706-107023728 TAGTGGAAGCTAGGGAAAGAAGG + Intronic
978698217 4:111608993-111609015 CATGGAGGGCCATGGAAAGAAGG + Intergenic
981148248 4:141350678-141350700 CAGGGGGTGCAAGGGAAAGAAGG - Intergenic
981268995 4:142821985-142822007 AGGTGGAAGCCATGGGAAGATGG + Intronic
984880439 4:184405769-184405791 CAGCGGCAGCCAGGGAGAGAGGG + Intronic
985002653 4:185501039-185501061 CAGTGGGGGACATGGAAAGTAGG + Intronic
985012669 4:185600238-185600260 CTGTGGGTGCCATGTTAAGATGG - Intronic
985763406 5:1763555-1763577 CACCGAGAGCCATGGAATGAGGG + Intergenic
988474017 5:31566769-31566791 CAGTGGGAGGTATTGAAACATGG - Intergenic
988518123 5:31922577-31922599 CAGAGGGAGACAAGGAAGGAAGG + Intronic
989341498 5:40380309-40380331 CACTGGTAGCCCTGGAAAGCTGG + Intergenic
989744105 5:44807402-44807424 GAGTCAGAGCCATGGAAAGTAGG - Intergenic
992142613 5:73814393-73814415 TAGTGTGGGCCATGGAAACAAGG + Intronic
993860819 5:93134866-93134888 AAGTGGAAGAAATGGAAAGAAGG - Intergenic
994838534 5:104889888-104889910 CAAAGAGAGACATGGAAAGAAGG + Intergenic
995246202 5:109938177-109938199 CAGTGGGAGCTACAGAAACACGG - Intergenic
996762043 5:126996153-126996175 CAGTGGGACTCATGGAGAAAAGG - Intronic
996810347 5:127510024-127510046 CAGTGGGTGCCTGGGAAATATGG + Intergenic
996975944 5:129434675-129434697 GAGGGAGAGCCTTGGAAAGAAGG + Intergenic
997403866 5:133627345-133627367 CAATGAGAGCCAAGGAAAAAGGG + Intergenic
998429068 5:142054878-142054900 GAGAGAGAGCCATAGAAAGAGGG + Intergenic
998487382 5:142514890-142514912 CACTGTGATGCATGGAAAGAGGG - Intergenic
999445007 5:151632288-151632310 CAGTGGGAGAGATGGAGGGAAGG + Intergenic
999875694 5:155803365-155803387 CAGTTGGGACCATGGAGAGAAGG + Intergenic
999926586 5:156385334-156385356 CAGTGGGAGGCTTTGAAACAGGG + Intronic
1000342443 5:160288020-160288042 CAGGTGGAGGCATGGACAGATGG + Intronic
1001204099 5:169745915-169745937 CAGAGGGAGCTATGGAACTAGGG + Intronic
1001650299 5:173311176-173311198 CAGAGGGAGCCCTGGCAGGAAGG + Intergenic
1001830160 5:174779891-174779913 TAGTGGTGGCCAGGGAAAGAAGG - Intergenic
1002186657 5:177457855-177457877 CAGTGGTTGCCAGGGAAACAAGG + Intronic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002692100 5:181057415-181057437 CAGTGGCAGCCCTGGAATGGTGG - Intronic
1002720799 5:181260580-181260602 CGGTGGGGGCCATGGATGGATGG - Exonic
1003245945 6:4382409-4382431 GAACGGGAGCCAGGGAAAGAGGG + Intergenic
1003312676 6:4983273-4983295 CAGGGAGAGTCATGGAAAGGTGG - Intergenic
1003529766 6:6927958-6927980 GAGTGGGACCCATGGAAGGACGG + Intergenic
1004069713 6:12287568-12287590 CAGAGGGAGAAATGGAGAGATGG + Intergenic
1004405320 6:15327655-15327677 CACAGGAAGCCTTGGAAAGAAGG + Intronic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1004923484 6:20398392-20398414 CAGTCAGAGCAAGGGAAAGAGGG + Intergenic
1006605894 6:35257808-35257830 CAGAGAGAGCTATGGAAAAAGGG + Intergenic
1009894183 6:69726744-69726766 CAGTGGGAGGCAGGTAAGGATGG + Intronic
1011943733 6:92874513-92874535 CATTGGGAGCCAAGGCAACATGG + Intergenic
1013126613 6:107190677-107190699 CAGAGGGAGCCAGATAAAGACGG + Intronic
1013430429 6:110050451-110050473 CAGTGTGAGGCAGGGAAGGATGG - Intergenic
1014310472 6:119794243-119794265 CAGTGGGAGCCATTGGAAATTGG - Intergenic
1017114292 6:150962468-150962490 CAGTGGGAGCTATTGAGAGTTGG + Intronic
1017821323 6:158050914-158050936 CATTGGGTGTCATGGAAAGGTGG - Intronic
1018118079 6:160607445-160607467 CAGTGGGACCCATGGCATAAAGG + Intronic
1018118699 6:160613894-160613916 CAGTGGGACCCATGGCATAAAGG + Intronic
1018119300 6:160619446-160619468 CAGTGGGACCCATGGCATAAAGG + Intronic
1018119903 6:160624992-160625014 CAGTGGGACCCATGGCATAAAGG + Intronic
1018121100 6:160636085-160636107 CAGTGGGACCCATGGCATAAAGG + Intronic
1018121702 6:160641628-160641650 CAGTGGGACCCATGGCATAAAGG + Intronic
1018492580 6:164309317-164309339 AAGTGTGAGTCATGCAAAGAAGG + Intergenic
1019206267 6:170364635-170364657 CAGAGGGAGCTCTGCAAAGATGG - Intronic
1020781309 7:12519490-12519512 CACTGGGAGCCAAGGCAAGCGGG - Intergenic
1021143364 7:17054540-17054562 CAGTGGAAGCCATTAAAAGCTGG + Intergenic
1021405769 7:20265677-20265699 TTGTGGGAGCGATGGAAGGAAGG + Intergenic
1021993536 7:26158684-26158706 AAGTAGGGGTCATGGAAAGAAGG - Intronic
1022530130 7:31061744-31061766 CTGTGGGAGGCAAGGAGAGAGGG + Intronic
1023757255 7:43431430-43431452 CAGTGAGAGCTATGGAATGTGGG - Intronic
1028988399 7:97025210-97025232 TAGTGGGAAGCAAGGAAAGATGG - Intergenic
1033018036 7:137691910-137691932 CAGTGGGAGCTTTTGAAAGTAGG - Intronic
1033095297 7:138425289-138425311 CAGCTGGTGCCAGGGAAAGATGG - Intergenic
1033820048 7:145124242-145124264 CAGTGGGAGCAAGAGAGAGAGGG + Intergenic
1033961756 7:146921989-146922011 CAGTGGCATCCATGGAAGGAAGG - Intronic
1034521477 7:151623858-151623880 GACTGAGAGCCAAGGAAAGAGGG + Intronic
1035826895 8:2654244-2654266 CAGTGAGACCCATGGACAGGTGG + Intergenic
1035827740 8:2662316-2662338 CAGTGGGAGACAGAGGAAGAGGG - Intergenic
1037496849 8:19448595-19448617 CACTGGGTGCCAGGGAAAGGGGG + Intronic
1037764892 8:21766638-21766660 TTAGGGGAGCCATGGAAAGAGGG - Intronic
1038605779 8:29002301-29002323 CAGTGGGAGAGAGGGAGAGAGGG + Intronic
1039720038 8:40153590-40153612 AAGTGGTAGCCATGGATGGATGG - Exonic
1040414440 8:47183808-47183830 CAGTGAGAGCCACTGAAGGATGG - Intergenic
1043692759 8:83176499-83176521 CACTGGGTGGAATGGAAAGATGG - Intergenic
1043861829 8:85326623-85326645 AGGTGGGAGCCAAAGAAAGAGGG - Intergenic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1044769723 8:95618462-95618484 CCCTGGGAGCCATGGAGAAATGG - Intergenic
1044808385 8:96032209-96032231 GAATGGGAGGGATGGAAAGAAGG + Intergenic
1044836057 8:96296943-96296965 CACTGGGAAGCAGGGAAAGAAGG - Intronic
1045422532 8:102030358-102030380 CAGTGGAAGCCTTTGAAAGTTGG - Intronic
1048414788 8:134214326-134214348 CAGTGGGAGCCACTGCAAGTGGG + Intergenic
1049207602 8:141370718-141370740 CAGTGGGAACCAAGGAAACTGGG + Intergenic
1049390101 8:142363371-142363393 CAGTGGGAACCAGGGGGAGAGGG + Intronic
1050369680 9:4908288-4908310 CATTGTGAGCAATAGAAAGAAGG + Intergenic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1051029762 9:12659147-12659169 CAGCGGGAGCCAGGGACAGGGGG - Intergenic
1055622716 9:78142994-78143016 CATTGGGACCCATGGAAACTGGG + Intergenic
1056065095 9:82925350-82925372 AAGTGAGAGCCCTGAAAAGAAGG + Intergenic
1056569316 9:87802135-87802157 CTGAGGGAGCCCTGGATAGAAGG - Intergenic
1056818757 9:89821886-89821908 CTTGGGGAGCCATGGCAAGACGG - Intergenic
1057186045 9:93058222-93058244 CAGTGAGAGACAGGGAAAGAAGG + Intergenic
1059328684 9:113520717-113520739 AAGTCCGAGCAATGGAAAGAAGG - Intronic
1059423162 9:114205386-114205408 CAGTTGGAGCCATGAATAGCTGG + Intronic
1059509520 9:114830964-114830986 TTGTGGAAGCCAAGGAAAGAGGG - Intergenic
1059725259 9:117002446-117002468 CAGAGTAAGCAATGGAAAGAGGG + Intronic
1059943201 9:119378124-119378146 CAGTGGGAGCCATGCTTGGAGGG + Intergenic
1061432031 9:130537125-130537147 CATAGGGAGCCATGGAGGGAGGG + Intergenic
1061666501 9:132163347-132163369 CCGCGGGAGCCCTGGAAAGTTGG - Intronic
1061914421 9:133741946-133741968 CGGTGGAATCCATGGAAACATGG + Intergenic
1062243142 9:135550339-135550361 CAGTGGCAGCACTGGAGAGAGGG + Intergenic
1062644435 9:137540222-137540244 GACTGGGAGCCACAGAAAGACGG + Intronic
1186144804 X:6614157-6614179 AGGTGAGAGCCATAGAAAGATGG - Intergenic
1186188838 X:7049235-7049257 CGGTGGTAGCCATGGAAATCGGG - Intronic
1188393570 X:29652383-29652405 CTGTGGTAGTCATGGAAGGATGG + Intronic
1189014280 X:37079115-37079137 GAGTGGGAAACATGGAAAGGTGG - Intergenic
1193294721 X:79820913-79820935 CAGTAGGTGGCATGGCAAGAAGG + Intergenic
1193329832 X:80223631-80223653 AAGTGGGAGGAATGGAAGGAGGG - Intergenic
1193572542 X:83161727-83161749 CAGAAGGAGAAATGGAAAGACGG + Intergenic
1196730681 X:118938350-118938372 CAATGGGAGCCATGCAATGATGG + Intergenic
1197542763 X:127786699-127786721 CATTGGGAGCCAAAAAAAGAGGG - Intergenic
1198052368 X:132961331-132961353 CATTGGAAACCATGGAAGGACGG - Exonic
1198126156 X:133645916-133645938 AAGTGGGAGTCAGGGAAATATGG + Intronic
1200706586 Y:6448032-6448054 AAGTGGGTGTCATGAAAAGATGG + Intergenic
1201027526 Y:9716676-9716698 AAGTGGGTGTCATGAAAAGATGG - Intergenic