ID: 1172042105

View in Genome Browser
Species Human (GRCh38)
Location 20:32052774-32052796
Sequence CCCCGCCCCCCCCCAAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 413}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172042105_1172042111 15 Left 1172042105 20:32052774-32052796 CCCCTTCTTGGGGGGGGGCGGGG 0: 1
1: 0
2: 3
3: 52
4: 413
Right 1172042111 20:32052812-32052834 TAAAAAAGAAAAAGAAGGAAGGG 0: 1
1: 4
2: 317
3: 3436
4: 19139
1172042105_1172042113 20 Left 1172042105 20:32052774-32052796 CCCCTTCTTGGGGGGGGGCGGGG 0: 1
1: 0
2: 3
3: 52
4: 413
Right 1172042113 20:32052817-32052839 AAGAAAAAGAAGGAAGGGATGGG 0: 1
1: 3
2: 52
3: 457
4: 3457
1172042105_1172042114 21 Left 1172042105 20:32052774-32052796 CCCCTTCTTGGGGGGGGGCGGGG 0: 1
1: 0
2: 3
3: 52
4: 413
Right 1172042114 20:32052818-32052840 AGAAAAAGAAGGAAGGGATGGGG 0: 1
1: 2
2: 43
3: 401
4: 2750
1172042105_1172042110 14 Left 1172042105 20:32052774-32052796 CCCCTTCTTGGGGGGGGGCGGGG 0: 1
1: 0
2: 3
3: 52
4: 413
Right 1172042110 20:32052811-32052833 TTAAAAAAGAAAAAGAAGGAAGG 0: 1
1: 7
2: 167
3: 1711
4: 11847
1172042105_1172042112 19 Left 1172042105 20:32052774-32052796 CCCCTTCTTGGGGGGGGGCGGGG 0: 1
1: 0
2: 3
3: 52
4: 413
Right 1172042112 20:32052816-32052838 AAAGAAAAAGAAGGAAGGGATGG 0: 7
1: 90
2: 653
3: 3188
4: 13822
1172042105_1172042109 10 Left 1172042105 20:32052774-32052796 CCCCTTCTTGGGGGGGGGCGGGG 0: 1
1: 0
2: 3
3: 52
4: 413
Right 1172042109 20:32052807-32052829 TAATTTAAAAAAGAAAAAGAAGG 0: 1
1: 1
2: 104
3: 903
4: 6188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172042105 Original CRISPR CCCCGCCCCCCCCCAAGAAG GGG (reversed) Intronic
900394868 1:2449141-2449163 CCCCGCCCCCCACCACCCAGAGG + Intronic
901001007 1:6148801-6148823 CCCCGCCCCACCCCAGGAACAGG - Intronic
901030554 1:6305031-6305053 CCCCGCCTCCCTCCCAGATGGGG + Intronic
901637161 1:10675795-10675817 CCCCCCCCACCCCCAACAAAGGG + Intronic
902373060 1:16017363-16017385 CCCCACCCCCACCCCAGAAAAGG - Intronic
902879212 1:19359913-19359935 CCTCGCCTCGCCCCAAGAATGGG - Intronic
903052596 1:20612669-20612691 CCCCGCCCCGCCCCACCAACAGG - Intronic
903186895 1:21634050-21634072 CCCCCCCCCCCCCCGGGAGGGGG - Intronic
903186897 1:21634051-21634073 CCCCCCCCCCCCCCCGGGAGGGG - Intronic
903232284 1:21929288-21929310 CCCCGTCCCCACCCAAGCTGGGG - Intronic
904039310 1:27575236-27575258 CTCCGCCCCCCTCCCAGATGAGG + Intronic
904256318 1:29257270-29257292 CCCCATCCCCACCCAGGAAGGGG - Intronic
904762945 1:32818175-32818197 CCCCGCCCCTCCCCCAGTAGGGG - Intronic
906797901 1:48712122-48712144 CCCCTTCTCCCCCCAGGAAGGGG + Intronic
908370323 1:63473551-63473573 CCCCTCCCCCCTCCCAGATGGGG - Intronic
908522208 1:64955335-64955357 CCCCTCCCTACCCCAACAAGCGG - Intronic
908548992 1:65190441-65190463 CCCGCCCCCCCCCCAAAAAAAGG - Intronic
908725065 1:67167100-67167122 CCCCGCACCCCCTAAAAAAGAGG - Intronic
914704100 1:150157448-150157470 TCCCGCCGCCCCCCAACAAGGGG + Exonic
914824916 1:151133264-151133286 CCCCGCCGCCCTCCAAGGACGGG - Exonic
915074188 1:153295384-153295406 CCCCACCCCTCCACCAGAAGGGG + Intergenic
915272782 1:154767010-154767032 CTCCTACCCCCTCCAAGAAGGGG - Intronic
917329633 1:173868327-173868349 CCCCACCCCCTCCCACGGAGCGG - Intronic
917375564 1:174349063-174349085 CCCCACCTCCCTCCAAGACGGGG + Intronic
917846613 1:179025783-179025805 CCCCGCCCCCGCCCAGTAGGCGG - Intronic
919194229 1:194263313-194263335 CCCCCCCCCCCCCCCAGTAGCGG + Intergenic
919900938 1:202043895-202043917 CCCCGCCCCCCCACAAAAAAAGG + Intergenic
919988276 1:202691065-202691087 CCCCTCCGCCCCCTAAGAAATGG + Intronic
920031431 1:203039560-203039582 CCCCACCCACCTCCAAGAATAGG - Intronic
920431791 1:205923487-205923509 CTCTGCACCACCCCAAGAAGAGG - Intronic
920655014 1:207868539-207868561 CTCCGCGCCCCCTGAAGAAGGGG + Intergenic
921055971 1:211542719-211542741 CCCCGCCCCCACCCACCATGGGG - Intergenic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
921642954 1:217578071-217578093 CCCGCCCCACCCCCATGAAGTGG - Intronic
921907799 1:220513633-220513655 CCCCACCCCACCCCAAAAAAAGG - Intergenic
922289864 1:224201128-224201150 CCCCACCGCCCCCCAAAAAAAGG + Intergenic
922391016 1:225141466-225141488 CCCCGCCCCCGCCCAAACAGAGG - Intronic
923267995 1:232332075-232332097 CCCCGCCTCCCTCCCAGACGAGG - Intergenic
923555653 1:234998623-234998645 CCCCGCCCGCCCTAAAGGAGTGG + Intergenic
923684541 1:236144815-236144837 CCCCACTGCCCCCCAAAAAGGGG - Intronic
923792936 1:237127421-237127443 CCCCACCTCCCTCCCAGAAGGGG + Intronic
923975305 1:239255890-239255912 CCACACCTCCCCCCAAGCAGAGG + Intergenic
924766034 1:247032461-247032483 CCCCACCTCCCTCCCAGAAGGGG - Intergenic
924920314 1:248622019-248622041 CCCCGCACCCCATCAAGAAACGG - Intergenic
1063346392 10:5315934-5315956 CCCCGCCCCCACCCCACAACAGG - Intergenic
1063566661 10:7177351-7177373 CCCCCGCCCCCCGCAAAAAGCGG + Intronic
1064083069 10:12323964-12323986 ACCCCCCCCCCCCCACAAAGGGG + Intergenic
1065342784 10:24723046-24723068 CCCCGACCCGCCTCAGGAAGGGG - Intronic
1067465163 10:46492167-46492189 CCCCACCCTACCCAAAGAAGAGG + Intergenic
1067622024 10:47892434-47892456 CCCCACCCTACCCAAAGAAGAGG - Intergenic
1067711832 10:48656261-48656283 CCCCGCCCCCCCCCCCCCAGAGG - Intronic
1067801049 10:49359967-49359989 CCCCTCCCCCTCCCAAGATCTGG - Intergenic
1067965712 10:50910419-50910441 CCCCGCCCCCACCCCAAAACAGG + Intergenic
1068555001 10:58448641-58448663 CCACACCTCCCCGCAAGAAGAGG + Intergenic
1070741079 10:78903674-78903696 CCCCGTCCCTCCCCAAGTGGTGG - Intergenic
1071507311 10:86240569-86240591 CGCCGCACCCACCCAAGAGGTGG - Intronic
1072480844 10:95809346-95809368 CGCCCCCCACCCCCAAGACGGGG + Intronic
1072630201 10:97140328-97140350 GCCGGCCCCTCCCCAACAAGGGG + Intronic
1073058335 10:100716156-100716178 CCCCGCCCCTCCCGCGGAAGAGG - Intergenic
1075050382 10:119178861-119178883 CCCCGCCCCCCCACCAGCAGAGG - Intergenic
1076152936 10:128177999-128178021 CCCCTCCCCCCACAAAGCAGCGG - Intergenic
1077047061 11:551338-551360 CCCCAGCTCCCCCCAGGAAGAGG + Intronic
1077591202 11:3492349-3492371 CTCAGCCCCCCCCCAAGTACTGG + Intergenic
1077696003 11:4393441-4393463 CCCAGCCTCCTCCCAAGCAGGGG + Intronic
1078733780 11:14001109-14001131 CTCCTCCACCCCCCAAGAAATGG + Intronic
1078751452 11:14168649-14168671 CCCCGCCCCCACCCCACAACAGG + Intronic
1078768721 11:14326649-14326671 CCCCTCCCCCTCCCAAATAGAGG - Intronic
1079560470 11:21813645-21813667 CCCCGCCCCCATCCATGATGGGG + Intergenic
1079867575 11:25756093-25756115 CCACGCCTCCCCACAAGCAGAGG - Intergenic
1080388910 11:31826346-31826368 CGCCGCCCCCTCCCAAGGCGTGG + Intronic
1081774406 11:45667436-45667458 CCCCACCCCCACCCAGGGAGTGG + Intergenic
1081878748 11:46429426-46429448 CCCCCCCACCTCCCAATAAGTGG - Intronic
1081945068 11:46985079-46985101 CCCCAACCCCACCCAAAAAGAGG - Intronic
1082035566 11:47642623-47642645 CCCCGTCCCGCCCCGAGAAACGG + Exonic
1082824292 11:57566949-57566971 CCCCCCCCCCCTCCTAGAACAGG + Intronic
1083659399 11:64245281-64245303 CCCACCCCCACCCCAGGAAGAGG - Exonic
1084128391 11:67116349-67116371 CCCGCCCCCCCCCCAAAAAAAGG - Intergenic
1084228354 11:67731940-67731962 CCGCGCCCCCCCACACGATGCGG - Intergenic
1084538418 11:69772406-69772428 CCCCGCCCCACCCCCAAAACGGG - Exonic
1084618355 11:70251605-70251627 CCCCCCCCCCCCCCACCACGTGG + Intergenic
1085322611 11:75583944-75583966 CCCTGCCCCACCCCAAGATGGGG + Intergenic
1085468779 11:76743462-76743484 CCCTGCCACTCCCCAACAAGAGG + Intergenic
1087400964 11:97667057-97667079 CCCCACCTCCCCACAAGCAGAGG - Intergenic
1088578721 11:111297332-111297354 ACCCGCCCCCTCCACAGAAGGGG - Intergenic
1089398740 11:118152556-118152578 TCCCCCCACCCCCAAAGAAGGGG - Intronic
1090189905 11:124760808-124760830 CCCCACCCCCCACAAGGAAGGGG + Intronic
1091248724 11:134123377-134123399 ACCCCCCCCCCCCCAAAAAAGGG + Intronic
1091273090 11:134331832-134331854 CCCCGCCCCCCCCCCGACAGAGG + Intergenic
1091278881 11:134370731-134370753 GCCGTCCCCTCCCCAAGAAGGGG + Intronic
1091477058 12:785402-785424 CCCCCCCCACCCCCTCGAAGTGG + Intronic
1091478822 12:805303-805325 ACCCGCCCCTCCCCAAAAAAAGG - Intronic
1091647003 12:2281109-2281131 CCCCGCCCCCACCCCACAACAGG + Intronic
1093499729 12:19798314-19798336 CACCGCGCCCGGCCAAGAAGGGG - Intergenic
1095777480 12:46025419-46025441 CCCCTCTCCCCCACAAGATGGGG - Intergenic
1096041389 12:48520484-48520506 CCCCGCCTCCCTCCCAGACGGGG + Intronic
1096073649 12:48789170-48789192 CCCCTCCCCCTCCCCAGAAGTGG + Intergenic
1096634302 12:52948926-52948948 CCCCGCTCACCCCCCAGAAACGG - Intronic
1098258916 12:68647390-68647412 CCCCCCCCCCCCCCCAAAAAAGG + Intronic
1098258918 12:68647391-68647413 CCCCCCCCCCCCCCAAAAAAGGG + Intronic
1099204308 12:79710912-79710934 CCACGCCTCCCCCCAAGCCGAGG - Intergenic
1100125659 12:91421800-91421822 CACCACCCCACCCCAAAAAGGGG + Intergenic
1100628217 12:96358851-96358873 CCCCACCCCACCCCAAAAAAGGG + Intronic
1102572657 12:113836489-113836511 CCCAGCCCCTCCCCACCAAGCGG - Intronic
1104552946 12:129774171-129774193 CCCAGGCCCCCCCAAAGAAGGGG + Intronic
1106054936 13:26229108-26229130 CCCAGCCCCCCTCAAAGCAGGGG + Intergenic
1106730605 13:32538062-32538084 CGCCCCCCCCCCCCAAGACGGGG - Intronic
1107371536 13:39755426-39755448 CCCCACCCCCACCCCAGTAGAGG - Intronic
1107537347 13:41348677-41348699 TCCCGCCCCCCCAAAAAAAGAGG - Intronic
1108572818 13:51767769-51767791 CCCCCCCCCCGCCCCAGGAGAGG - Intergenic
1111023452 13:82486145-82486167 CCCCGCCCCCACCCCACAACAGG + Intergenic
1112736284 13:102423104-102423126 CCCCGTCCTCCCTCAAGTAGGGG - Intergenic
1113120056 13:106916458-106916480 CCCCGCCCCGCCCCAAAAAAAGG + Intergenic
1114450636 14:22822765-22822787 GCCCCCGCCCCCCCAACAAGGGG - Intronic
1114594240 14:23898283-23898305 CCCCCCCCACCCCCCAGACGTGG + Intergenic
1114866225 14:26598095-26598117 CGCCAGCCCCCCCCAACAAGCGG - Intergenic
1115343653 14:32318900-32318922 CCCCACCCCCACCCAAAGAGGGG - Intergenic
1117763655 14:59058889-59058911 CCCCGCCTCCCTCCCAGACGGGG + Intergenic
1117791453 14:59346129-59346151 CCCCCCCCCCCCCAAAAAAAAGG - Intronic
1118428581 14:65692612-65692634 CCCCACCCCCCTCCCAGACGGGG + Intronic
1118749377 14:68795314-68795336 CCCCACCCCCCCCAAAAAAGAGG + Intronic
1118752930 14:68819609-68819631 CCCCGCCCACTCCCAGGGAGGGG - Intergenic
1119704670 14:76776311-76776333 CCCCTCCCCCGCCCCAGCAGAGG + Intronic
1120934811 14:89884471-89884493 CCCCTCCCCCCACCAAGATGGGG + Intronic
1122787099 14:104168842-104168864 CCCCGCCTCACCCCAGGCAGGGG - Intronic
1122791025 14:104184211-104184233 CCCCGCCCTCCAGCAAGGAGCGG - Intergenic
1122866507 14:104607326-104607348 CCCCTCCCCCCACCAGTAAGAGG - Intergenic
1122901641 14:104784535-104784557 CCCCGCTCATCCCCAGGAAGGGG + Intronic
1123062335 14:105599905-105599927 CCCTGCCCGCTCCCAAGAATGGG + Intergenic
1123087077 14:105721633-105721655 CCCTGCCCGCTCCCAAGAACGGG + Intergenic
1123487753 15:20756204-20756226 CCCCGCCCCCGTCCAACAGGCGG - Intergenic
1123544252 15:21325282-21325304 CCCCGCCCCCGTCCAACAGGCGG - Intergenic
1124155921 15:27225335-27225357 CCCCGCCCCCCTCCACGTGGAGG + Intronic
1124483681 15:30098347-30098369 CCCCCCCCCCCACCAAGCATGGG - Intergenic
1124519898 15:30398879-30398901 CCCCCCCCCCCACCAAGCATGGG + Intergenic
1124655966 15:31507623-31507645 CCCCGCCCCCCAGCCAGCAGCGG - Intronic
1124975139 15:34523621-34523643 TCCCGCCCCCCACCAAGCATGGG + Intergenic
1125013352 15:34905087-34905109 CCCCACCCCCCCCAAAAAAGAGG - Intronic
1125079545 15:35656924-35656946 CCCCGCCTCCCTCCCAGATGGGG - Intergenic
1126610136 15:50520613-50520635 CCCCGCCCCCGCCAAAAAAAAGG + Intronic
1126953993 15:53912742-53912764 CCCCGCCGCCCCCCAGTAAACGG - Intergenic
1127180441 15:56410638-56410660 CCCCCACACCTCCCAAGAAGAGG + Intronic
1129210564 15:74065641-74065663 TCCCACCCCCCACCAAGAATGGG + Intergenic
1129403447 15:75299688-75299710 TCCCACCCCCCACCAAGAATGGG - Intergenic
1130287049 15:82564774-82564796 CCCTGCCCCTCCTCAAGCAGAGG - Intronic
1131105290 15:89729666-89729688 CCCCGCCCCCCCACCAGGAATGG + Exonic
1131176422 15:90212164-90212186 CCACTCCCCACCCCAGGAAGTGG - Intronic
1131366119 15:91842685-91842707 CCCCGCCCCCCGCCCAGTAAAGG + Intergenic
1131367020 15:91850248-91850270 CCCCCCCCCCCCCCACGCTGTGG - Intergenic
1131400973 15:92125497-92125519 CTCCGCCACCCCTCAGGAAGTGG - Intronic
1131486356 15:92824255-92824277 CCCCCCCCCCCCGCAAAAAAGGG - Intergenic
1131789586 15:95949430-95949452 CCCCACCCCCCCCCAAAAAATGG - Intergenic
1132484069 16:181224-181246 CGCCGCCCCTCCCCAAGGAAAGG + Intergenic
1132567476 16:630128-630150 CCCTGCCCTCCCCAACGAAGAGG + Intronic
1132575157 16:660734-660756 CCCCACCCCCAGCCAAGATGCGG + Intronic
1132642603 16:984644-984666 CCCCACCCGCCCCACAGAAGGGG + Intronic
1132680251 16:1137577-1137599 CCCCACCCCACCCCCAGAAGCGG + Intergenic
1132851131 16:2025528-2025550 CCCTGCCCCCACCCAAGCACAGG - Intronic
1132864607 16:2087251-2087273 CCCAGCCCACCTCCAGGAAGAGG - Intronic
1133222358 16:4324177-4324199 CCCCTCCCCCTCCCAAGACGGGG - Intronic
1133708912 16:8382246-8382268 CCCTTCCCCTCCCCCAGAAGCGG - Intergenic
1134248395 16:12557017-12557039 CCCCCCCCCGCCCCAAGATGAGG + Intronic
1134257869 16:12626498-12626520 CCCCACCCCCCCCCAAAAAGGGG + Intergenic
1135770333 16:25213296-25213318 CCCCCCCACCCCCCAAAAAATGG - Intergenic
1135897246 16:26418850-26418872 TCCCACCCCCCCGCAAAAAGGGG + Intergenic
1136064517 16:27749770-27749792 ACTTGCCCCCCTCCAAGAAGGGG + Exonic
1136523690 16:30814339-30814361 CCCCGGCCCCGCCCAGGGAGAGG - Intergenic
1137922550 16:52505120-52505142 CACCGCACCCGGCCAAGAAGAGG + Intronic
1138037813 16:53625549-53625571 GCCCCCCCACCCCCAAGACGGGG - Intronic
1139475070 16:67199047-67199069 CCCCGCCCCACACCAAGGTGCGG - Intergenic
1139543528 16:67636783-67636805 CCCCACCACCCGCCAAGAAGCGG + Exonic
1140384183 16:74519713-74519735 CCCCACCCACTCCCCAGAAGCGG + Intronic
1140847864 16:78907221-78907243 CCCTGCCCCCCACCCAGAAGCGG - Intronic
1140870739 16:79104029-79104051 GCCCCCCCCCCCCCAAAAAAGGG - Intronic
1140994253 16:80243711-80243733 CCCCACCTCCCTCCAAGATGGGG - Intergenic
1141025399 16:80541571-80541593 CCCCTCCCCCCCAGAAAAAGAGG + Intronic
1141102197 16:81206048-81206070 CCCCCCCCCCCCCAAAAAAAAGG + Intergenic
1142141756 16:88475758-88475780 CCCAGCCCCTCCCTAAGCAGAGG - Intronic
1142198195 16:88748489-88748511 CCCCCCCCCCCCCGCACAAGTGG + Intronic
1142522478 17:514833-514855 CTCTGCCCACCCCCGAGAAGGGG - Exonic
1142740751 17:1930611-1930633 CCCCTCACCACCACAAGAAGTGG - Intergenic
1142840658 17:2626556-2626578 CCCCCCCCCCCCCCCCGAGGCGG + Intronic
1142949256 17:3464870-3464892 CCCCACCCCCCTCCCAGACGGGG - Intronic
1143099543 17:4497948-4497970 CCCCGCCCCGTCCCACCAAGGGG + Intergenic
1143791016 17:9295739-9295761 CCCCCCTCCCCCCCAAAAAAAGG + Intronic
1143811802 17:9477846-9477868 CCCCTTCCCCACCCAAGAATGGG - Intronic
1144042793 17:11427837-11427859 CCTCGCCTCCACCCAAGAACAGG - Intronic
1144543393 17:16168487-16168509 CACCGCGCCCAGCCAAGAAGTGG + Intronic
1144778525 17:17796637-17796659 CGCCGGTCCCCACCAAGAAGCGG + Exonic
1145235971 17:21208680-21208702 CCGGGCCCCACTCCAAGAAGGGG - Intronic
1146155324 17:30518947-30518969 CCCCAACCCCCCCCAAAAAAAGG + Intronic
1146884992 17:36464657-36464679 CCCCTCCCCACCCCGAAAAGTGG + Intergenic
1147657004 17:42096776-42096798 CCCCGCCCCCGCCCAAGGCAGGG - Intergenic
1148166766 17:45489614-45489636 CCCCGGCCCCACCCAAGAGTTGG + Intronic
1148560202 17:48601792-48601814 CCCCACCCCCACCCAGGAACGGG + Intronic
1148665331 17:49370605-49370627 CCCCACCCCCCCCAAAAAAAAGG + Intergenic
1149633088 17:58142736-58142758 CCCCACCTCCCCCCAGGATGGGG - Intergenic
1149746730 17:59106389-59106411 CCCCGCCCCCACCCGATGAGCGG - Intronic
1150397942 17:64836017-64836039 CCCCGGCCCCACCCAAGAGTTGG + Intergenic
1150455628 17:65304582-65304604 CCCCCCCCCCCCCCCAGAGAAGG + Intergenic
1150527439 17:65937774-65937796 CCCCACCCCCCTCCCAGACGGGG - Intronic
1151175301 17:72283464-72283486 CGCCCCACCCCCCCAGGAAGAGG + Intergenic
1151557218 17:74852605-74852627 CCCCGCCCGCCCCCAGGAGCCGG - Exonic
1151756871 17:76080199-76080221 CCCCGGCCCCGTCCAAGAAGGGG + Intronic
1151794473 17:76334173-76334195 CCCACCCCCACCCCAAGACGGGG - Intronic
1152263648 17:79280834-79280856 CCCCTCCCCCCCCCCACAATGGG - Intronic
1152320979 17:79608806-79608828 CCCCGCCCCTCCCCCAGGACTGG - Intergenic
1152333172 17:79685188-79685210 CCCTGCCCCTCCCCAAGGTGTGG + Intergenic
1152535131 17:80946216-80946238 CACTGCCCTCCCCCATGAAGTGG - Intronic
1152618123 17:81346994-81347016 CCCCGCGCCCTCCCCAGAGGGGG + Intergenic
1152759752 17:82101651-82101673 CCCCACCCCGCCCCACTAAGGGG - Exonic
1153743283 18:8151480-8151502 CCCCGCCCCCCACCAAGCTGGGG + Intronic
1154238196 18:12626038-12626060 CCCCGCCCCCCCCCAAAAAAAGG + Intronic
1155229177 18:23756955-23756977 CCCCGCCCCGCCCCAGTAACTGG + Intronic
1155621265 18:27783455-27783477 CCCCGCCCCCCACCAAAAAAAGG + Intergenic
1156254042 18:35378018-35378040 CCCCTCAGCCTCCCAAGAAGCGG - Intergenic
1156683528 18:39618431-39618453 CCACACCTCCCCCCAAGCAGAGG - Intergenic
1158694403 18:59690785-59690807 CCCCGCCTTCCCACAAGAACAGG - Intronic
1159558137 18:69966436-69966458 CCCCTCCCCCCCCCCACAACAGG - Intergenic
1160871835 19:1281293-1281315 CCCCACCCCCCCCCACCCAGAGG - Intergenic
1160879038 19:1311234-1311256 CCCCCCCCCCCCCCCACCAGGGG + Intergenic
1160970962 19:1767590-1767612 CCCCGCCCCAACCCAGGAAAGGG - Intronic
1160974683 19:1787020-1787042 CCTCTCCCCGCCCCAAGGAGCGG + Intronic
1161197497 19:2995053-2995075 CCTTCCCCCCCCCCAACAAGGGG + Exonic
1161861056 19:6798661-6798683 CCCCCCCCACCCAAAAGAAGGGG + Intronic
1162301552 19:9847819-9847841 CCTCACCCACACCCAAGAAGAGG - Intronic
1162799729 19:13103814-13103836 CCCCCCCCCCGCCCAGGAATGGG + Intergenic
1162948439 19:14057237-14057259 GCCCGCTCCCCCCCAAAAATTGG + Intronic
1163326474 19:16606611-16606633 CCCCGCTCCCCTCCAAAAAATGG - Intronic
1163445819 19:17345928-17345950 CCCAACCCCCCCCCAAAAAAAGG - Intergenic
1163558463 19:18005725-18005747 CCCCGCCTCCCTCCCAGACGGGG + Intronic
1164408874 19:27979946-27979968 CCCCCCCCCCCGCCAAAAAAAGG + Intergenic
1164562214 19:29300109-29300131 CCCCAGCCCCCGCCAAGGAGTGG - Intergenic
1164637556 19:29802533-29802555 CACCGCCCCCCCCAAAAAAAAGG + Intergenic
1164696231 19:30246574-30246596 CCCCGTCCCCACCCCACAAGAGG + Intronic
1164834660 19:31349611-31349633 CCCCGCCCCGTCCCCAGACGAGG + Intergenic
1165220327 19:34310998-34311020 CCCCGCCCCCCCGCAAGACAGGG + Intronic
1165585868 19:36915587-36915609 CCCCACCCCCCCAAAAAAAGAGG - Intronic
1166379664 19:42349389-42349411 CCCCACCCCCTCCTAAGAAGAGG - Intronic
1166792955 19:45408705-45408727 TCCCGTCCACCACCAAGAAGAGG + Exonic
1166888087 19:45973538-45973560 CCCCGCCCCCCCCCACCATGAGG - Exonic
1167353446 19:48989990-48990012 CCCCCCCCCCCCCCAGCAAAAGG - Intronic
1167368301 19:49065921-49065943 CCCCCCACCCCCCCGAGAAGGGG + Intergenic
1167375517 19:49108857-49108879 CCCAGCCCCCCACCAAGACAGGG - Intergenic
1167413882 19:49360638-49360660 CCCTGTCCCACCCCAAGAACAGG + Intronic
1167505222 19:49867584-49867606 CCCCGCCCCCCACCCACGAGGGG - Intronic
1168088309 19:54064469-54064491 CCCCCCCGCCCCCCAAAAAAAGG - Intergenic
1168635628 19:57994259-57994281 CCCCAACCCCCACCAAGAAAAGG + Intronic
925172649 2:1759696-1759718 CCACACCCCCCCACAAGCAGAGG + Intergenic
926836100 2:17022861-17022883 CCCCGCCCCCACCCCACAACAGG + Intergenic
927052967 2:19348303-19348325 CCCCGCCCCGCCCCGCGAATCGG - Intergenic
927675627 2:25103823-25103845 CCCTGCCACCCCCCAGGATGCGG - Intronic
928434899 2:31248621-31248643 CCCAGCCCCAGCCCCAGAAGTGG - Intronic
929461326 2:42103688-42103710 CCCCGCCCCCCCCCCACAATAGG - Intergenic
930075389 2:47401965-47401987 CCCTACCCCCCCTCAAGACGGGG + Intergenic
930396331 2:50828328-50828350 CCCCGCCTCCCTCCCAGATGGGG + Intronic
933522668 2:83392801-83392823 CCCCGCCCCCCTCCAAAAAAGGG - Intergenic
933743473 2:85553119-85553141 CCCCATCCCCTACCAAGAAGGGG + Intronic
933898649 2:86833660-86833682 CCCCACTGCCCCCCAAGAAAAGG - Intronic
934025978 2:88001926-88001948 CCCGCCCCCCCCCCAAGAAAAGG + Intergenic
934998491 2:98988858-98988880 CCCCACCTCCCTCCCAGAAGGGG + Intergenic
935059117 2:99592930-99592952 CCTCCCCCCCCCCCAAAAAAAGG + Intronic
935704195 2:105841613-105841635 ACCCTCCACCCTCCAAGAAGGGG - Intronic
936146911 2:109986519-109986541 CCCCACCCCAACCCCAGAAGAGG + Intergenic
936197781 2:110384964-110384986 CCCCACCCCAACCCCAGAAGAGG - Intergenic
937346655 2:121130282-121130304 CCCCAACCTCCCCCAACAAGTGG - Intergenic
938413397 2:131084194-131084216 CCCCACCCCACCCCAAGACAGGG + Intronic
940854960 2:158722709-158722731 CCCCACCCCAGCCCCAGAAGGGG + Intergenic
942426528 2:175866270-175866292 CTCCGCCCCACCCCCAAAAGAGG + Intergenic
946468911 2:219938332-219938354 CCCTCCCCCCCCCCAAAAAAAGG - Intergenic
946929439 2:224657319-224657341 CCCCCCCCCGCCCCAAGACAGGG - Intergenic
947402394 2:229743042-229743064 CCCCGCCTCCCTCCCAGACGGGG - Intergenic
948418046 2:237831234-237831256 CCCCCCCCCCCCCAAAAAAAAGG - Intronic
948496919 2:238356594-238356616 CGCTGCCCCCTCCCAAGACGGGG - Intronic
948684294 2:239660323-239660345 CCCCGCCCGCCCCCCAGACTAGG + Intergenic
948949046 2:241236969-241236991 CCCCCCCCCCCCCCAAGGTCTGG - Intronic
1169100425 20:2943209-2943231 CCCCACCCCCCCCCCAGATAAGG + Intronic
1170202578 20:13760692-13760714 CCCCGCCTCCCTCCCAGACGGGG - Intronic
1171398116 20:24852651-24852673 CCATGCCCCCCCCAAAGAGGTGG - Intergenic
1172005377 20:31815879-31815901 CCCTGCCCACCCTCAAGAAGGGG - Intergenic
1172042105 20:32052774-32052796 CCCCGCCCCCCCCCAAGAAGGGG - Intronic
1172275537 20:33677045-33677067 GCCTGCCCACCCCCCAGAAGAGG + Intronic
1172279087 20:33698131-33698153 CCCCGCCCCCTGCAAAGAAAAGG - Intergenic
1172952111 20:38728861-38728883 CCCCGCCTCCCCCCAAAACCAGG - Exonic
1175542553 20:59756818-59756840 CCCCTCCCCCCACCAAGCAATGG + Intronic
1175843620 20:62047519-62047541 CCCCACCCCCGCACAAGAAAGGG + Intronic
1177051252 21:16237750-16237772 CCCTTCCCACCCCCAAGTAGGGG - Intergenic
1177342099 21:19816541-19816563 CCTCTCCCCACCCCATGAAGAGG - Intergenic
1178488448 21:33033187-33033209 CCCCGCCCGCCGCCCAGATGGGG - Intergenic
1178690248 21:34744339-34744361 CTCCGCCCCTCCCCAAGCACAGG - Intergenic
1180110128 21:45643603-45643625 CCCCGCCCCCGCCCAAGGGCAGG - Intergenic
1182186788 22:28412343-28412365 CCCCGCCCCCCGCCACATAGTGG - Intronic
1184750052 22:46480289-46480311 CCCCCTCACCTCCCAAGAAGAGG + Intronic
1185167324 22:49269698-49269720 CCCCGCTCCCCCCCAACATCAGG + Intergenic
1185246506 22:49775926-49775948 CCCCGCCCCCCCGCCAGCTGTGG + Intronic
950248991 3:11448325-11448347 CCCTTCCCCGCCCCAAGAGGTGG - Intronic
951402117 3:22245736-22245758 CCCCACCACCCCCCAAAAAAAGG - Intronic
953328895 3:42035481-42035503 CCCTGCCACCCCCAAAGAAAAGG + Intronic
953562072 3:43999259-43999281 CCCCGCCCCCCGCGAGTAAGGGG + Intergenic
954401298 3:50321224-50321246 CCCCGCCCCCGCCCCACACGTGG + Exonic
954717198 3:52532853-52532875 AGCCGGCCCCCTCCAAGAAGGGG + Intronic
955574679 3:60347666-60347688 CCCCCCCCCCCCCAAACCAGTGG - Intronic
960853453 3:122079270-122079292 CCTCACCCCCACCCAGGAAGAGG - Intronic
961476109 3:127147366-127147388 CCCCCACACCCACCAAGAAGAGG - Intergenic
961814384 3:129541688-129541710 CCCTGCCCCCCCCAAAAAAAAGG - Intergenic
962257512 3:133882670-133882692 CCCAGCCCTCCCCCAGGCAGAGG + Intronic
962714623 3:138115644-138115666 CCCCGCCCCACCTCAAGAAGAGG + Intronic
963602998 3:147393375-147393397 CCCCGCCCCCCGCCAACACCCGG + Intronic
964569140 3:158094175-158094197 CCCCGAACCATCCCAAGAAGGGG - Intergenic
964750248 3:160047738-160047760 CCCCCCCCCCCCCCAAAAAAAGG - Intergenic
965843849 3:172938829-172938851 CCCCACCCCCCCGCAACAAATGG + Intronic
966038163 3:175446237-175446259 CCCCCGCCCCCCCCAAAAAAAGG - Intronic
967930710 3:194688165-194688187 CCTTGCCCGCCCCCAGGAAGGGG + Exonic
969723254 4:8904965-8904987 CCCTGTGCACCCCCAAGAAGGGG + Intergenic
970124341 4:12792481-12792503 CCCCGACTCCACCCAACAAGAGG - Intergenic
971256051 4:25014472-25014494 CCCCGCCCCCGCCAAAAAAAAGG + Intronic
973325636 4:48858154-48858176 CCCCTCCCCCCGCCAAAAAAAGG + Intronic
973672929 4:53238011-53238033 CCCCACCTCCCTCCAAGATGGGG + Intronic
976765497 4:88593208-88593230 CCCCGGCCCCGCCCAGGAGGCGG - Intronic
978156677 4:105497162-105497184 CACCCCCCCCCCCCAACAATGGG - Intergenic
978947565 4:114516761-114516783 CCCCACCTCCCTCCCAGAAGGGG - Intergenic
980480806 4:133385209-133385231 CCCCGCCCCCTTCCAAGGAGGGG + Intergenic
980739222 4:136928982-136929004 CCCCACCTCCCCCCAAGATGAGG - Intergenic
982773661 4:159420876-159420898 CCACGCCTCCCCACAAGCAGAGG - Intergenic
983168358 4:164506815-164506837 CCCCCCCCCCCCCCCATTAGAGG - Intergenic
983190303 4:164747387-164747409 CCCCACCTCCCTCCAAGACGGGG + Intergenic
983771508 4:171555386-171555408 CCCAGCCCCTACCCAAGATGGGG + Intergenic
984180805 4:176480240-176480262 CCCCACCCACCCCCAGCAAGTGG - Intergenic
984438469 4:179734644-179734666 CCCCACCCCCCCCAAAAAAAAGG - Intergenic
984824774 4:183914684-183914706 ACCTGCTCCCCTCCAAGAAGGGG - Intronic
985380797 4:189392640-189392662 CCCCACCCCCACCCAACAACAGG + Intergenic
985561310 5:587565-587587 CCCCACCCCACCCTGAGAAGCGG - Intergenic
988796576 5:34657227-34657249 CCCCACCCCCCACCAGGCAGGGG - Intronic
991422654 5:66456785-66456807 CCCCGCCCCCACCCCACAACAGG + Intergenic
992167691 5:74071198-74071220 CCCCCCGCCCCCCCAAGACAGGG + Intergenic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
993422863 5:87723019-87723041 CCCCGCCCCACCCCAAGGAATGG - Intergenic
993890548 5:93466896-93466918 CCCCCCCCCCCCCCAAAAAAGGG - Intergenic
993921071 5:93803452-93803474 CCGCCCCCCCACCCAAAAAGAGG + Intronic
994286853 5:97979694-97979716 CCCCTGCCCCCTCCAAGAAATGG - Intergenic
995705886 5:114989381-114989403 CACCACCCCCCCCCAAAAATAGG + Intergenic
995758865 5:115543813-115543835 CCCCCCCACCCCCAAAGAAAAGG + Intronic
996101433 5:119449575-119449597 TCCTGCCCCCACCCATGAAGGGG - Intergenic
997001544 5:129767769-129767791 CCCCCGCCCCCGCCAAGAAAAGG + Intergenic
997233382 5:132258937-132258959 GCCCACCCCCTCCCAAGAACTGG - Intronic
997259913 5:132457716-132457738 GCCCAGCCCCCCCCAGGAAGTGG - Intronic
997521610 5:134527159-134527181 CCCCGCCCCGCCCCCGGCAGTGG + Intronic
998972773 5:147611025-147611047 CCCCTCCCCCCACCAAGATCGGG + Intronic
999065585 5:148682527-148682549 CCCAACCCCCCCACAAGATGAGG + Intergenic
999333625 5:150695981-150696003 CCCCTCCCGCCCCCCAGAAAGGG + Intronic
1000103373 5:158037091-158037113 CCCCACCTCCCTCCCAGAAGGGG + Intergenic
1000296302 5:159916306-159916328 CCCCGCCCCGCCCCCCGCAGAGG + Intergenic
1000563264 5:162816614-162816636 CCCCGCCCCCACCCCACAACAGG - Intergenic
1001062922 5:168509441-168509463 CCCCCCCCCCCACCAAAAAAAGG + Intronic
1001281478 5:170389315-170389337 CCCCGCCCCCACCCCAAAAGAGG + Exonic
1001396304 5:171421316-171421338 CCCCGACCCCCACCATGCAGAGG - Intronic
1001474271 5:172038854-172038876 CCCCTCCCCACCCCAAAAAAAGG - Intergenic
1001647846 5:173295432-173295454 CCCCCCCCACCCACAAGGAGGGG - Intergenic
1003099058 6:3163179-3163201 CCCCGCCCCGCCCCAAGACCCGG + Intergenic
1003290977 6:4777218-4777240 CCCCGCCACCCCCCGACCAGGGG - Intronic
1003997991 6:11563304-11563326 CCCCCCTCCCCGCCAAGAAAAGG + Intronic
1004109454 6:12701220-12701242 CCCCCCCCATCCCCTAGAAGAGG + Intergenic
1005441270 6:25871482-25871504 CCCCGCCCCCACCCCACAACAGG - Intronic
1005935505 6:30517944-30517966 CCACACCTCCCCCCAAGCAGAGG - Intergenic
1005958829 6:30682607-30682629 CCCCACCCCCACCCAAGCAGCGG + Intronic
1006320584 6:33317351-33317373 CCCTGCCCCCTCCCAAAAAGTGG - Intronic
1006376176 6:33672879-33672901 CCCAGCCACACCCCAGGAAGGGG + Intronic
1006379328 6:33688532-33688554 CCCCGCCTCACCCCAAGGAAGGG + Intronic
1006386660 6:33734790-33734812 TCCCGCCCTCACCCAGGAAGAGG - Intronic
1006498260 6:34439853-34439875 CCCCCCCCCCCGCCCAGCAGCGG + Intergenic
1007147024 6:39645963-39645985 CCCTGCCCCCACCCAACAACAGG - Intronic
1007327211 6:41072168-41072190 CCACGCACCCCCCAAAAAAGTGG - Intronic
1007396143 6:41578859-41578881 CCCCACCCCTCCCCCAGCAGAGG + Intronic
1007553252 6:42746210-42746232 CCCCGCCCCCTCCGACGCAGAGG - Intergenic
1007558052 6:42782964-42782986 CCCCTCCCCCTCCCCAGACGCGG - Intronic
1007631485 6:43275593-43275615 CCCCACCCCGCCCCAATAATTGG + Intronic
1007759903 6:44127625-44127647 CCCCGCCCCGCCCCAACCCGGGG + Intronic
1009485535 6:64217527-64217549 CCCCTGCCACCCCCAAGAAAAGG + Intronic
1009709615 6:67300469-67300491 CCCCTCCCCCCACCAAGCGGGGG + Intergenic
1010030251 6:71266046-71266068 CCCCGCCCCCCTCCTGGACGCGG + Intergenic
1013745034 6:113335203-113335225 CCCCACCCCCCCCCAAAAAAAGG - Intergenic
1015535198 6:134260369-134260391 CCCCCACCCCCCCCAAAAAAAGG + Intronic
1015535200 6:134260370-134260392 CCCCACCCCCCCCAAAAAAAGGG + Intronic
1015939384 6:138432745-138432767 CCCAGCCCACCCCCAAGATGTGG - Exonic
1017031720 6:150229870-150229892 CCCTGCCCCCCAAAAAGAAGGGG + Intronic
1017660668 6:156670376-156670398 CCCCACCTCCCTCCCAGAAGGGG - Intergenic
1018583673 6:165332937-165332959 CCCCCACCCCCCCCAAAAAAAGG + Exonic
1019302216 7:311597-311619 CCCCGCCCCCCTCCTGGAGGAGG + Intergenic
1020217786 7:6207941-6207963 CCCCCCACCCCCCCAAGACAGGG - Intronic
1020265803 7:6559239-6559261 CCCCACCCCCCGCCAAAAAAAGG + Intergenic
1020272973 7:6607859-6607881 CCCCGCACCCCGCCCAGGAGAGG - Intronic
1021065801 7:16170956-16170978 CCACACCTCCCCACAAGAAGAGG + Intronic
1022108450 7:27213397-27213419 GCCCGACCCTGCCCAAGAAGGGG - Intergenic
1022771966 7:33483091-33483113 CCCCCCGCCCCCCAAAGAAAAGG - Intronic
1023831936 7:44044618-44044640 CCCCGCCCCACGGCAGGAAGCGG - Intronic
1023970588 7:44987861-44987883 CCCCACCCACCCCCAGGCAGAGG + Intergenic
1026974774 7:74490550-74490572 CCCCGCCCGCCTTCCAGAAGGGG + Intronic
1027174907 7:75897139-75897161 CCCCTCCACCCCCCCAGGAGAGG + Intergenic
1027233909 7:76286830-76286852 CCCCAGCCCCACCCAAGAGGAGG + Exonic
1027264784 7:76488360-76488382 CCCCGCCCCCACCAGAGATGGGG - Intronic
1027316155 7:76986462-76986484 CCCCGCCCCCACCAGAGATGGGG - Intergenic
1028793036 7:94875352-94875374 CCCCTCCCCACCCCAAGGATGGG + Intergenic
1029171059 7:98629201-98629223 CCCCGCCTTCCCCAAAGCAGAGG + Exonic
1030498013 7:110324098-110324120 AACCTCCCCCCCCCAAGAAAAGG - Intergenic
1030682598 7:112449817-112449839 CCCCCCCCCCCCCAAAAAAAGGG - Intronic
1030682600 7:112449818-112449840 CCCCCCCCCCCCCCAAAAAAAGG - Intronic
1030975317 7:116114895-116114917 CCCCGCCACCCCCCAGTAATGGG + Intronic
1031966422 7:128031185-128031207 CCCCCCCTCCGCCCAAGGAGCGG + Intronic
1032078962 7:128849222-128849244 CCCTGGCCCACACCAAGAAGAGG - Intronic
1033306545 7:140230135-140230157 CCCCGCCTCCAGCCTAGAAGAGG - Intergenic
1034113039 7:148557180-148557202 CCCTACCCCCGCCCATGAAGGGG - Intergenic
1035683611 8:1507510-1507532 CCACGCCTCCCCGCAAGCAGAGG + Intronic
1035747537 8:1973463-1973485 CCCCGCCTCCTCGCAGGAAGCGG + Intergenic
1035751906 8:2002272-2002294 CCACGCCGCCCGCCACGAAGAGG - Exonic
1036271833 8:7312082-7312104 CCCCCCCCCCACCCAAGTAAAGG - Intergenic
1036349512 8:7998263-7998285 CCCCCCCCCCCCCCAAGTAAAGG + Intergenic
1036667604 8:10757643-10757665 CCCCCCCCCGCCCCAACACGTGG - Intronic
1038776970 8:30540092-30540114 CCCCTCCCTGCCCCCAGAAGAGG + Intronic
1039924187 8:41914542-41914564 CCCCTCAGCCCCCCAAGTAGCGG + Intergenic
1040834623 8:51718972-51718994 CCCCGCCTCCCTCCCAGATGGGG - Intronic
1041355395 8:56993949-56993971 CCCCGCCCCGCCCCAAGGGGAGG - Intergenic
1043332086 8:79130144-79130166 CCCCCCCCCCCCCCAAAAAAAGG + Intergenic
1043332088 8:79130145-79130167 CCCCCCCCCCCCCAAAAAAAGGG + Intergenic
1044449146 8:92313749-92313771 CCCTGCCCTGCCCCAAGAGGTGG + Intergenic
1045304816 8:100950637-100950659 CCGCGCCCCCGCCCAAGCCGTGG + Intronic
1046040194 8:108894285-108894307 CCCCACCCCCCACCCAGAGGTGG + Intergenic
1047266846 8:123315410-123315432 CCCCACCTCCCTCCAAGACGGGG - Intergenic
1047951629 8:129939952-129939974 CCCCGCCCCTCCCGAAGGGGCGG + Intronic
1048214185 8:132480666-132480688 CCCCACCCCCCCCCAAAAGCAGG + Exonic
1048847494 8:138614715-138614737 CCCCAACCCCACCCAAAAAGGGG - Intronic
1049405287 8:142449617-142449639 CCCCCCCCCTCGCCAGGAAGGGG + Exonic
1050939491 9:11440793-11440815 CCCCACCCCCCATCAAGAACTGG - Intergenic
1051942783 9:22529158-22529180 CCCCACCCACCCCCACAAAGTGG + Intergenic
1053458243 9:38248110-38248132 CCACGCCCCACACCACGAAGGGG - Intergenic
1058721691 9:107770040-107770062 CACCGCCCACCCCCAAGATCAGG - Intergenic
1060406575 9:123375890-123375912 CCCCACCCCGCCCCAGGAAGGGG - Intronic
1060528298 9:124332895-124332917 CTCCGTCCCCCACCAAGAGGAGG + Intronic
1060620698 9:125063096-125063118 CCCCCCACCCCCCCCAGAAAAGG + Intronic
1061016053 9:127981188-127981210 CCCCGCCCCGCCCTAGGAGGCGG - Intergenic
1061131600 9:128711596-128711618 CCCCACCCCCCCCAAAAAAAAGG - Intronic
1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG + Intronic
1061628642 9:131857258-131857280 CCCCTGCCCCCCCCAAAAAAGGG - Intergenic
1062053934 9:134461115-134461137 CCCCGCCTCCCCACAGGCAGAGG - Intergenic
1062105514 9:134752827-134752849 CCCCACCCCCCACCAACAAGGGG - Intronic
1062242377 9:135547351-135547373 CCCTGCCCACCTCCAAGGAGGGG + Intronic
1062325646 9:136011220-136011242 CTCCCACCCTCCCCAAGAAGGGG + Exonic
1062526053 9:136978521-136978543 CCCCGCCCCGCCCCGGGAGGTGG - Intronic
1062596271 9:137301316-137301338 CCCCGCCCCCACCCGCGAGGCGG + Exonic
1185690022 X:2146962-2146984 CCGCCCCCCCCCCCAAAAAAAGG - Intergenic
1185863788 X:3604525-3604547 CCCCGACCCCCCATGAGAAGGGG + Exonic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1186469234 X:9808191-9808213 CCCCGACCACCCCCAAGTAAAGG - Intronic
1187068309 X:15863023-15863045 CCCCACCCCCCCCAAAAAAAAGG + Intergenic
1187452821 X:19413669-19413691 CCACCCCCCCCCCCAAGAGATGG - Intronic
1187453779 X:19423021-19423043 CCCCGCCCCCACCCCATAACAGG - Intronic
1188008443 X:25034486-25034508 CCCACCCGCCCCCCAAGATGTGG - Intergenic
1188194021 X:27208436-27208458 CCCCTCCCCCCCCCCACAACAGG - Intergenic
1189210407 X:39278145-39278167 CCCCGCCTCCCTCCCAGACGGGG - Intergenic
1189332948 X:40154255-40154277 CCCCTCCCCTCCCCAGGAACCGG + Intronic
1189617324 X:42797043-42797065 CTCCACACCCCCTCAAGAAGTGG + Intergenic
1190442455 X:50488770-50488792 CCCCACCCCCACCCAACAACAGG + Intergenic
1191741024 X:64434981-64435003 CCCCACCCCCCTCCCAGAAAGGG - Intergenic
1192252218 X:69422340-69422362 CCCCACCTCCCTCCCAGAAGGGG - Intergenic
1192304499 X:69944575-69944597 CCTCGCCTCTCCTCAAGAAGAGG + Intronic
1192494791 X:71608557-71608579 CACCGCACCCAGCCAAGAAGAGG + Intronic
1193362332 X:80591504-80591526 CCCCACCTCCCTCCCAGAAGGGG - Intergenic
1195340551 X:103902699-103902721 CCCTGCCCCCCCCCCAGAGGTGG + Intergenic
1195626274 X:107008082-107008104 CCCTCTCCCCACCCAAGAAGAGG + Intergenic
1198516894 X:137417773-137417795 CCCCTCCCCCCACCCAGTAGCGG - Intergenic
1199826420 X:151504839-151504861 CCACCCCCCCCCCAAAAAAGAGG - Intergenic