ID: 1172044969

View in Genome Browser
Species Human (GRCh38)
Location 20:32073827-32073849
Sequence CTGTCTTAGGGGGAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172044969 Original CRISPR CTGTCTTAGGGGGAGTGGGA TGG (reversed) Intronic
900433910 1:2617683-2617705 CTTTCCTTGGGGGAGTGGCAGGG + Intronic
900958263 1:5901942-5901964 TTGTCTTTGGGGGAGGGGGCTGG - Intronic
902275680 1:15337615-15337637 CTGTCTTAGGCATTGTGGGATGG - Intronic
903158960 1:21471052-21471074 CTGACTAAGGGTGAGTGGGGTGG - Intronic
904335653 1:29795954-29795976 AAGGCTTAGGGAGAGTGGGATGG + Intergenic
904350436 1:29901851-29901873 CTGCCTTTGAGGGGGTGGGAAGG + Intergenic
905068349 1:35203837-35203859 CTGTCTTAGTGGGGGGGGGGGGG - Intergenic
905292764 1:36934089-36934111 CTGTCTGAGGGTGAGTGAGTAGG + Intronic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905348185 1:37326060-37326082 CACTCTCAGGGGGAGAGGGAAGG + Intergenic
905460283 1:38118374-38118396 CTGTCTCAGGGTGAGCAGGATGG + Intergenic
905892624 1:41526764-41526786 GTGTGTTAGGGTGAGTGTGAGGG - Intronic
906898735 1:49809298-49809320 CTGTCGTGGGGGGAGGGGGGAGG - Intronic
907012768 1:50978376-50978398 CTGTCATGGGGGGAGGGGAAGGG - Intergenic
907264417 1:53248328-53248350 CTGTCTTAGAGAGAGTGGGAGGG - Intronic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
908656979 1:66398411-66398433 CTACCTTAGGGTAAGTGGGAAGG + Intergenic
910892057 1:92028836-92028858 CTGTCTTGGGGTGAGGGGGAGGG - Intergenic
914957681 1:152178993-152179015 CTGTTTTTGGGGGGGTGGGAGGG - Intergenic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
917082099 1:171266804-171266826 CTGTCTTTTGGGGAGTAGTATGG - Intronic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
920804045 1:209216524-209216546 CTGACATGGGGGGAGTGGCAAGG - Intergenic
921985012 1:221303424-221303446 TTGTCTCAGGGTGAGTGGGGTGG + Intergenic
922290165 1:224203259-224203281 CTGTGTTCCTGGGAGTGGGACGG - Intergenic
923018200 1:230143022-230143044 CTGTTTTTAGGGGAGTGGGCTGG + Intronic
923541341 1:234890459-234890481 CGGTCTTTGGGAGACTGGGAGGG - Intergenic
1064132043 10:12718858-12718880 CTGTCTTAGGGAGAGTTAGGTGG - Intronic
1064149147 10:12848607-12848629 CTTTCTTAGGGGAAATGAGATGG + Intergenic
1065768712 10:29056457-29056479 CTGTCTTGGGGAGAGAGAGAGGG + Intergenic
1066205620 10:33186505-33186527 CTGTGTTAGGGAGAGTGGCCAGG + Intronic
1067066140 10:43105339-43105361 CTGTCCTAGGGGGAGGGGAAGGG + Intronic
1069524658 10:69158582-69158604 ATTTCTTGGGGGGAGGGGGAAGG + Intronic
1072209533 10:93233706-93233728 AAGGCTTAGGGAGAGTGGGATGG - Intergenic
1072360209 10:94652132-94652154 CAGGCTTAGGGAGATTGGGATGG + Intergenic
1073391548 10:103181393-103181415 CTTTCTTTGGGGGAGGGTGATGG - Intronic
1073940876 10:108696457-108696479 CTGTCTTAAAGGGAATGGAAAGG - Intergenic
1074453770 10:113580154-113580176 CTGTCTTCGGGGGCGGGGGGAGG + Intronic
1074678930 10:115883260-115883282 AGGTCTTAGATGGAGTGGGAAGG - Intronic
1076026789 10:127122213-127122235 CTTTCTTTGGGGGCCTGGGATGG + Intronic
1077466341 11:2735427-2735449 CTGGCCTAGGAGGGGTGGGAAGG - Intronic
1077563258 11:3279377-3279399 CTGTCAGAGGGTGAGTGGGGAGG - Intergenic
1077569151 11:3325193-3325215 CTGTCAGAGGGTGAGTGGGGAGG - Intergenic
1077590583 11:3487904-3487926 CTGTCTTAGTGGGAGTTGTCCGG - Intergenic
1077818166 11:5708416-5708438 CTGTCTTAGGGGGAATGACCAGG + Intronic
1077843543 11:6000462-6000484 GTGGGTTAGGGGGAGTGGGGAGG + Intergenic
1078581137 11:12540504-12540526 ATGTCTTTGGGAGAGTGGGAGGG + Intergenic
1078629654 11:12990715-12990737 CTGGCTTTGGGGGACAGGGAGGG - Intergenic
1078851506 11:15168264-15168286 CTGTCAGTGGGGTAGTGGGAGGG - Intronic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1080056203 11:27909198-27909220 ATGTCTTTGTGGGATTGGGAAGG + Intergenic
1081975990 11:47235160-47235182 CTGTCTAGAGAGGAGTGGGAGGG + Intronic
1083012384 11:59415491-59415513 AGTTCTTAGTGGGAGTGGGATGG - Intergenic
1083042599 11:59702107-59702129 CTGTCCGAGGGGGAAGGGGAGGG - Intergenic
1083780806 11:64916360-64916382 CTGCTTTTGGGAGAGTGGGATGG - Intronic
1083972364 11:66087128-66087150 CTATCGTTGGTGGAGTGGGAGGG - Intronic
1084322462 11:68381261-68381283 ATGTCTTAGGGTGTGTGGGGGGG + Intronic
1084836449 11:71804809-71804831 CTGTCTGGGGGTGAGTGGGGAGG + Intergenic
1085327615 11:75618977-75618999 CCGGCTGAGGGGGAGTGGGTGGG + Intronic
1086380529 11:86247678-86247700 CTGACTTAGGGGCAGTAGTAAGG + Intronic
1086683706 11:89705962-89705984 CTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1088091229 11:106042181-106042203 CTATCTTATGGAGAGTAGGAGGG - Intergenic
1088334852 11:108692492-108692514 CTGGCTTTGTGGGAATGGGACGG + Intronic
1089748168 11:120631546-120631568 CTGTCCTGGGGGCAGAGGGAGGG - Intronic
1091218304 11:133916921-133916943 CTGGCATAGGGTGAGTGTGAGGG - Intronic
1091835859 12:3585260-3585282 GTCTAGTAGGGGGAGTGGGAAGG + Intronic
1092402790 12:8191299-8191321 CTGTCTTGGGGTGAGTGGGGAGG - Intergenic
1092971518 12:13700101-13700123 CTGTCTGTGGGGAGGTGGGATGG + Intronic
1096148412 12:49294532-49294554 CCGTCTTCAGGGGAGGGGGAGGG + Exonic
1096365282 12:51023984-51024006 TTGTCTTGTGGGGGGTGGGAGGG + Intronic
1098219358 12:68252402-68252424 CTAGCTTAGGGGTAGGGGGAAGG + Intronic
1098377955 12:69837456-69837478 CTGTCTCCGGGGGAGTGGAGAGG + Intronic
1099946282 12:89248241-89248263 CCATTTTAGGGGGAGAGGGAGGG + Intergenic
1099978541 12:89571649-89571671 CTGACTCAGAGGGAGGGGGAGGG + Intergenic
1100145700 12:91674953-91674975 CTGTGGGAAGGGGAGTGGGAAGG - Intergenic
1101626417 12:106447248-106447270 CTCTTGTAGGGGGAGTGGGAGGG - Intronic
1101647515 12:106645034-106645056 TTGTTCTAGGGGGAGGGGGAGGG - Intronic
1102251133 12:111388267-111388289 CTGACTTAGCGGGAGGGGAAGGG - Intergenic
1102347778 12:112170499-112170521 GAGTCTTGGGGGGACTGGGAAGG - Intronic
1103700668 12:122847322-122847344 CTGCCATAGGTGGAGCGGGAGGG + Intronic
1107133376 13:36919831-36919853 CTGTCTGGGGTGGAGTGGGGTGG - Intronic
1108863993 13:54899555-54899577 CTGTTATAGTGGGACTGGGAAGG - Intergenic
1109292958 13:60498111-60498133 ATGGCTTAGGGAGATTGGGATGG + Intronic
1109989992 13:70041773-70041795 CTGATTGATGGGGAGTGGGAGGG + Intronic
1112716685 13:102194425-102194447 CTGTCAGGGGGGCAGTGGGAGGG - Intronic
1112798967 13:103089453-103089475 CTTTTTTTGGGGGAGGGGGAGGG - Intergenic
1113040608 13:106100561-106100583 CTGGCTTAGGGGGAGAAGGCAGG + Intergenic
1113090246 13:106610463-106610485 GTGTCTAAGAGAGAGTGGGAAGG - Intergenic
1113637418 13:111929238-111929260 CTGTCTCAGGGAGGGCGGGAGGG + Intergenic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1114497299 14:23141814-23141836 CTGTGCTAGGGGGGCTGGGAAGG - Intronic
1114529202 14:23384878-23384900 CTGTCTTTAGGGGAGGCGGAAGG + Intronic
1117938256 14:60932509-60932531 CTGTCTTACGTGGAGTGTGCAGG + Intronic
1118158662 14:63266972-63266994 CTGTGTCAGGGGTAGTGTGAGGG - Intronic
1118244835 14:64099891-64099913 GTGGGTTAGGGGGAGGGGGAAGG - Intronic
1119749302 14:77066289-77066311 CTGAGTGAGGGGGAGTGAGAGGG - Intergenic
1121206125 14:92169311-92169333 CTTTTTTAGGGGGTGTGGGGGGG - Exonic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1122288032 14:100664287-100664309 CTGTCTTGAGGAGAGTGGGGGGG - Intergenic
1122838006 14:104440483-104440505 TTGGCTTAAGGGGAGTGTGATGG + Intergenic
1124917160 15:33987186-33987208 CTGTCATATGTGGAGTGGGATGG - Intronic
1127621254 15:60736916-60736938 CTGTCTTCGAGGCATTGGGAAGG - Intronic
1127873387 15:63091406-63091428 CTGTCATGGAGGGAGTAGGAAGG - Intergenic
1128227088 15:66009498-66009520 GTGTCTTAGGGTGAGTTGTAGGG + Intronic
1130271970 15:82456472-82456494 CTGTCTTGGAGGTAGTGGGCGGG - Intergenic
1130464322 15:84183861-84183883 CTGTCTTGGAGGTAGTGGGGGGG - Intergenic
1130488367 15:84410961-84410983 CTGTCTTGGAGGTAGTGGGGGGG + Intergenic
1130499946 15:84489676-84489698 CTGTCTTGGAGGTAGTGGGGGGG + Intergenic
1130645773 15:85725375-85725397 CTTTTTTGGGGGGAGGGGGAGGG + Intronic
1130660971 15:85831206-85831228 CTGCGCTAGGGGGATTGGGAAGG - Intergenic
1130686478 15:86042023-86042045 TTGTTTTAGGGGGGGTGGGGTGG + Intergenic
1130873420 15:87991102-87991124 GTGTCATGGGGGGTGTGGGATGG - Intronic
1131254695 15:90854384-90854406 CTGTGTGATGGGGAGTGGGGGGG + Intergenic
1131864739 15:96695618-96695640 CTGTGTGAGTGGGTGTGGGAGGG + Intergenic
1133011290 16:2913266-2913288 CTGAGTTGGTGGGAGTGGGAAGG + Intronic
1133355950 16:5136988-5137010 CTGTCTTAGTGGGAGTTGTCGGG - Intergenic
1134339009 16:13328084-13328106 CTGTATTTAGGGGAGTGGGAGGG - Intergenic
1137237604 16:46628224-46628246 CTGTATTAGGGACAGTGAGAGGG - Intergenic
1138879665 16:60995814-60995836 GTGACTCAGTGGGAGTGGGATGG - Intergenic
1139105451 16:63821699-63821721 CTGTCATGGGGGGAGTGGGGAGG + Intergenic
1139504715 16:67393161-67393183 CTGTCCCAGTGGGAGCGGGACGG - Intronic
1140034309 16:71360952-71360974 TTTTCTTTGGGGGAATGGGAGGG - Intronic
1142996604 17:3764234-3764256 CTCTCTTATGGGGACAGGGATGG + Intronic
1143620985 17:8080145-8080167 CCGACTTCGGGGCAGTGGGACGG - Exonic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1146068568 17:29657905-29657927 CTTTCTTTGGGAGTGTGGGAGGG + Intronic
1146906268 17:36620292-36620314 CTGCCTTTGGGTGGGTGGGAGGG + Intergenic
1147725758 17:42565302-42565324 GTGGCTGAGGGTGAGTGGGAGGG + Exonic
1147741375 17:42672596-42672618 CAGGCTTAGTGGGATTGGGAAGG - Intronic
1148135830 17:45291029-45291051 CTCTCCTAGAGGGAGTGGGCTGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1149733320 17:58968486-58968508 CTGTCTCATGGGGATTTGGAAGG - Intronic
1153051431 18:906048-906070 CTGTCTTGGGGGGCGTGCGGTGG + Intronic
1153448012 18:5195937-5195959 CATTCTGAGGGGGAGGGGGAGGG + Intronic
1153939755 18:9967910-9967932 CTGCCCTAGGGGGAGTGCGATGG - Intergenic
1154308048 18:13244685-13244707 GTGTCTTGGGGGAAGAGGGAAGG - Intronic
1155547909 18:26933865-26933887 ATGTCAGAGGGAGAGTGGGAAGG + Intronic
1157374882 18:47153368-47153390 CTGCTTTAGGGAGGGTGGGAGGG - Intronic
1157485367 18:48083459-48083481 CTGTATGAGGAGGTGTGGGATGG - Intronic
1157489929 18:48116124-48116146 CTGTCCTTGGGGGTGGGGGACGG - Intronic
1157498510 18:48172896-48172918 CTGTCTAGGGGGTGGTGGGAGGG + Intronic
1157816343 18:50731920-50731942 CTGTATTTGGGGGTGGGGGAAGG + Intergenic
1158260117 18:55597389-55597411 TTTTCTTTGGGGGAGAGGGAAGG - Intronic
1158474328 18:57766635-57766657 CTGACTCAGGGGGACTGGGCTGG + Intronic
1161218359 19:3105980-3106002 TTGTCTCAGGAGGAGTGGGCTGG + Intronic
1162234420 19:9296095-9296117 GTGTATTAAGGGAAGTGGGAAGG + Exonic
1162944021 19:14031662-14031684 CTGCTTGAGGGGGAGTGGGGAGG - Intergenic
1163952442 19:20602416-20602438 TTTTCTTGGGGGGAGGGGGATGG + Intronic
1164433506 19:28208349-28208371 CTGTCCCAGGGGGAGAGGGGTGG + Intergenic
1164640752 19:29823783-29823805 CTGTCTTTGGTGGAGAAGGATGG - Exonic
1164664726 19:30020444-30020466 CTGTCTTAGGATGAGGGTGAAGG - Intergenic
1164681439 19:30136263-30136285 CTCTGTTTGGGGGAGTTGGAAGG + Intergenic
1164756643 19:30694851-30694873 CTTTCTGTGGGGGACTGGGATGG - Intronic
1164832471 19:31333229-31333251 CTCCCTTGGTGGGAGTGGGAGGG - Intronic
1165807158 19:38587487-38587509 CTGCCTTAGGGGGAGGGGCTTGG - Intronic
1166144782 19:40826400-40826422 GGGGCTGAGGGGGAGTGGGAAGG + Intronic
1166182960 19:41121807-41121829 GGGGCTGAGGGGGAGTGGGAAGG - Intronic
1166202706 19:41248855-41248877 CTGTCTCAGGGGCATAGGGAAGG - Intronic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167455050 19:49593473-49593495 CTGCCTCGGGGGGAGGGGGAGGG - Intronic
1168060506 19:53889599-53889621 CTGGCTTAGGGGGCGTTGGGAGG - Intronic
1168168574 19:54571979-54572001 CTGAGTTTGGGGGAGTGGGGAGG - Intergenic
925692072 2:6535652-6535674 CTGCCTGTGGGGCAGTGGGAGGG - Intergenic
928082999 2:28326604-28326626 CAGTCTGAGAGGGAGGGGGATGG + Intronic
929243590 2:39677644-39677666 CTGTGTTTGGAGGAGTGGGATGG + Intronic
929907682 2:46060678-46060700 ATTTCTTTGGGTGAGTGGGATGG - Intronic
930354856 2:50305081-50305103 CTGTCTTGTAGGGGGTGGGATGG + Intronic
930850343 2:55953137-55953159 TTGTCTGAGGGAGAGAGGGAGGG - Intergenic
931021961 2:58056085-58056107 CTCTTTTAGGGGGTGGGGGAGGG - Intronic
931032339 2:58192345-58192367 GTGTTTTATGGGCAGTGGGATGG - Intronic
931691242 2:64836588-64836610 CTGTCCTGGGAGGAGTGGGAGGG + Intergenic
931717657 2:65041920-65041942 CTCTCTTCAGTGGAGTGGGATGG - Intergenic
932428473 2:71658915-71658937 CTGTCTTGGGGGCATGGGGATGG - Exonic
932436372 2:71704633-71704655 CAGTCTTGAGGTGAGTGGGAGGG - Intergenic
934565421 2:95337620-95337642 ATGTCTCAGAGTGAGTGGGAAGG - Intronic
935577652 2:104727577-104727599 CTGTTTTATGGAGAGTAGGAGGG + Intergenic
935671564 2:105561072-105561094 CTTTTCTATGGGGAGTGGGAGGG - Intergenic
936795972 2:116204406-116204428 CTGTATTAGGGGGAGGGTGCAGG + Intergenic
938135529 2:128753515-128753537 CCGTCTTGGAAGGAGTGGGAAGG + Intergenic
940241094 2:151563905-151563927 CTGTATAAAGGGGCGTGGGAGGG - Exonic
940991557 2:160102564-160102586 TTGCCTTGGGGGCAGTGGGAAGG + Intronic
941225187 2:162839046-162839068 GTGTGTTAGGGGGAGAGGGCGGG - Intergenic
943798559 2:192029153-192029175 CTTTCTTAGGGGTTGGGGGAAGG + Intronic
944537483 2:200725458-200725480 CTGTCAAAGGGTGAGGGGGAGGG - Intergenic
944890130 2:204108919-204108941 CTGACCTAGTGGAAGTGGGAGGG + Intergenic
945226030 2:207531264-207531286 ATATGGTAGGGGGAGTGGGACGG - Intronic
946157453 2:217816445-217816467 CTGTCTCCGGGCGAGTGTGAGGG + Intronic
946395068 2:219439586-219439608 CTGGGTTTGGGGGAGTGGCAGGG + Intronic
946409215 2:219508126-219508148 CTCTCTTCATGGGAGTGGGAGGG + Intergenic
1168832009 20:851136-851158 CTGTGCTAGGCAGAGTGGGAAGG + Intronic
1169891658 20:10459788-10459810 CTGTGTGAGGGATAGTGGGAAGG + Intronic
1170815246 20:19708499-19708521 CTGTCCCTGGGGGCGTGGGAAGG - Intronic
1171381424 20:24737137-24737159 CTGGGGTATGGGGAGTGGGAAGG - Intergenic
1171953395 20:31440999-31441021 GTGTGTGAGGAGGAGTGGGAGGG + Intronic
1172044969 20:32073827-32073849 CTGTCTTAGGGGGAGTGGGATGG - Intronic
1172526622 20:35603719-35603741 CAGTCCCAGGGGGTGTGGGAAGG - Intergenic
1172946106 20:38690682-38690704 GTGTGTTGGGGGGAGGGGGAAGG + Intergenic
1173853029 20:46230940-46230962 CTGCCTTAGAGGGAGGAGGAGGG + Intronic
1174083710 20:47989715-47989737 CTGTCTGAGGGGTAGTGAGCAGG - Intergenic
1174216274 20:48918972-48918994 GTGTGTTGGGGGGAGTGGGGTGG + Intergenic
1176343360 21:5718406-5718428 CTGACTTAGGGGGAAGGGCATGG - Intergenic
1176501467 21:7606050-7606072 CTGACTTAGGGGGAAGGGCATGG + Intergenic
1176537681 21:8116475-8116497 CTGACTTAGGGGGAAGGGCATGG - Intergenic
1177553039 21:22650811-22650833 ATGTCTTTGGGGGAAGGGGAAGG + Intergenic
1177908889 21:27005967-27005989 CTCACTGAGGAGGAGTGGGAGGG - Intergenic
1179452714 21:41476480-41476502 GTGTCTCTGGGGGCGTGGGAGGG - Intronic
1179557991 21:42192958-42192980 CTGTCTAATGGGGGGTGGGGTGG - Intergenic
1182287653 22:29257877-29257899 ATGCCTTAGGGAGCGTGGGAGGG - Intronic
1183464811 22:37974154-37974176 CTGTCTTCGGGGTGGTTGGAGGG + Exonic
1184482096 22:44753678-44753700 CTGCCTTGGGAGGAGTGTGAAGG + Intronic
1184786075 22:46672586-46672608 GGGTCTTAGTGGGAGTGGGTGGG + Intronic
1185274187 22:49943301-49943323 CTGTCTCAGGTGGGGTGGGGTGG + Intergenic
1203242627 22_KI270733v1_random:32830-32852 CTGACTTAGGGGGAAGGGCATGG - Intergenic
949228693 3:1724954-1724976 CTGTCTTATGGGGTGTAGGAAGG - Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
952928188 3:38337443-38337465 TTGGCTTAGGGACAGTGGGAGGG + Intergenic
952981673 3:38741123-38741145 CAGACTTAGGTGGAGGGGGAAGG - Intronic
953783750 3:45895004-45895026 CCTTTTTAGGGGGTGTGGGAAGG + Intronic
956064968 3:65388417-65388439 CTGTCTTGGGGGGAGGGGGCAGG + Intronic
956244320 3:67164461-67164483 CTGTCATGGGGGCAGTGGGAGGG + Intergenic
956902094 3:73727643-73727665 ATGCCTTTGGGGGAGGGGGAAGG - Intergenic
957126324 3:76165940-76165962 CTGTCTTATAGGGAGTGGTTTGG + Intronic
958940089 3:100302168-100302190 CTGTTTTATGGGCAGTGGCAGGG + Exonic
960348511 3:116564958-116564980 CTGGGTCAGGGGGAGTGGCAAGG - Intronic
961721006 3:128895963-128895985 CTGTCTTTGTGGCACTGGGAGGG + Intronic
961937398 3:130599873-130599895 CTGACTTTGGGGGAGTGGGTGGG + Intronic
962298989 3:134220409-134220431 CTGACGTATGGGGAGGGGGAGGG + Intronic
962848638 3:139291228-139291250 CTGGCTTAGGGAGTGAGGGAGGG - Intronic
963393607 3:144702823-144702845 CTGTAGTAGGGGGAGTCAGATGG - Intergenic
966574458 3:181483961-181483983 CTGTTCTTGGGGGACTGGGAAGG - Intergenic
968082535 3:195856735-195856757 CTGTGTTTGGGGGAGTGGTTCGG - Intergenic
968560710 4:1279971-1279993 CTGTCGTGGGGTGAGGGGGATGG + Intergenic
969004512 4:4008488-4008510 CTGTCTTAGTGGGAGTTGTCGGG - Intergenic
969191708 4:5526598-5526620 GTGGCTTAGGGGGGATGGGAAGG - Intronic
969223934 4:5781988-5782010 CTGTCTGAGGCTGAGAGGGAGGG + Intronic
969748354 4:9091659-9091681 CTGTCTTAGTGGGAGTTGTCCGG + Intergenic
969777856 4:9372331-9372353 CTGTCTGGGGGTGAGTGGGGAGG + Intergenic
969809386 4:9636219-9636241 CTGTCTTAGTGGGAGTTGTCGGG + Intergenic
970559403 4:17268151-17268173 CAGTCTTAGGGGTAATGGCAAGG - Intergenic
972253392 4:37329105-37329127 CTATCTTGGGAGGTGTGGGAGGG - Intronic
974088902 4:57289885-57289907 ATCTCTATGGGGGAGTGGGAGGG + Intergenic
974665591 4:64957120-64957142 GTGTCTTGTGGGGAGTGGGGAGG - Intergenic
975036174 4:69685931-69685953 GTGGGGTAGGGGGAGTGGGAAGG - Intergenic
975512740 4:75211526-75211548 CAGCCTAAGTGGGAGTGGGAGGG + Intergenic
975698742 4:77041447-77041469 CTATCTTAGGGGAATTGAGATGG - Intergenic
975732367 4:77350144-77350166 CTGTAGCAGGGGGAGTGGCATGG + Intronic
976290223 4:83410243-83410265 TTTTTTTAGGGGGAGTGGGGAGG - Intronic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
978765716 4:112403041-112403063 CTTTTTTAGGGGGTGGGGGAGGG + Intronic
983184800 4:164689566-164689588 AAGGCTTAGGGGGATTGGGATGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984676658 4:182556647-182556669 CTGGCTACAGGGGAGTGGGAAGG - Intronic
985843391 5:2326303-2326325 CTGGCCTTGGGGGAGCGGGATGG + Intergenic
986044969 5:4028061-4028083 CTGTCTTCCAGTGAGTGGGAAGG + Intergenic
987545802 5:19309274-19309296 AAGTCTTTGGGGGATTGGGAAGG - Intergenic
988616607 5:32781115-32781137 TTTTCTGAGGGGGAGTGGGAGGG + Intronic
988867853 5:35354923-35354945 CTGTCTTAGGGGAAGGGTGGAGG + Intergenic
989045578 5:37270276-37270298 ATGGCTTAGGGAGATTGGGATGG - Intergenic
989690607 5:44138625-44138647 GTGTGTTGGGGGGAGGGGGAGGG + Intergenic
990888502 5:60621533-60621555 CTGGGGTAGGGGGAGTGGGGAGG + Intronic
991955719 5:71994476-71994498 ATGGCTAATGGGGAGTGGGAAGG - Intergenic
994515844 5:100772085-100772107 CTCTCTTAGGGGCTGTGGAAGGG + Intergenic
995598194 5:113768992-113769014 CTGCTTTAGGGGAAGAGGGAAGG + Intergenic
995746970 5:115414432-115414454 CTTTATGAGTGGGAGTGGGAAGG - Intergenic
996943061 5:129033310-129033332 CTTTCTTAGGAAGAGTGAGAGGG + Exonic
997693242 5:135842288-135842310 CTGGGGTAGGGGGAGTGGGTGGG - Intronic
998003685 5:138643374-138643396 CTGGCTTAGGGGGATGGGGTGGG + Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
999125337 5:149242068-149242090 CTGTCTTTGAGGGAGGGGGAGGG + Intronic
999698585 5:154207636-154207658 GTCTTTTACGGGGAGTGGGATGG + Intronic
1001167835 5:169386987-169387009 CTGTCGTAGGGTGGGGGGGATGG + Intergenic
1002136589 5:177111646-177111668 CTGGCTGATGGGGGGTGGGAGGG + Intergenic
1002576523 5:180177145-180177167 CTGGATGAGGGGCAGTGGGATGG + Intronic
1003350484 6:5313094-5313116 CTGTGTTAGGGGGTGTTGGTTGG - Intronic
1003692228 6:8366141-8366163 ATGCATTAGGGGGAGTGGAAGGG - Intergenic
1004350398 6:14885785-14885807 CTGGGTTAGGGTGAGTGGGTGGG - Intergenic
1004706170 6:18125730-18125752 CTGTCTTAGGGGTACAGGCAGGG - Intergenic
1005380226 6:25225964-25225986 TTGTCTCAGGGGGCGGGGGAAGG + Intergenic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1008561925 6:52732444-52732466 CTGACTGAGGGGGACGGGGATGG + Intergenic
1009185867 6:60573540-60573562 CTGTTTTTGTGGGAGTGGGGTGG + Intergenic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1009798564 6:68503199-68503221 CTGTTTTAGTGGAAGTGGCAGGG - Intergenic
1010026268 6:71221367-71221389 CTGTCTCAGGGGTGGTGGGGGGG - Intergenic
1011002479 6:82606620-82606642 TTGTTTGAGGGGAAGTGGGATGG + Intergenic
1011883057 6:92056318-92056340 TTGTGTTAGTGAGAGTGGGATGG + Intergenic
1012089720 6:94875814-94875836 CTGTTGTCGGGGGAGTGGGGAGG - Intergenic
1012583673 6:100897930-100897952 GTGTCTCAGGGGGAGTTGCATGG - Intergenic
1012629765 6:101450708-101450730 CTTTCTTTGGGGGATTGGAAGGG - Intronic
1013000079 6:106013231-106013253 CTGTTTTAGAGGGATTGGGAAGG - Intergenic
1013276333 6:108588597-108588619 CTGCCTTTTGGGGAGTGAGAAGG - Intronic
1013619663 6:111875118-111875140 CTGATTTAGGGGGTTTGGGATGG + Intergenic
1013668387 6:112371733-112371755 CTTTCATAAGGAGAGTGGGAAGG - Intergenic
1014148138 6:118021905-118021927 CTGTCTTTAGGGGAGTGAGGTGG + Intronic
1014826785 6:126056087-126056109 CTGTCCTGGGAGGACTGGGAAGG - Intergenic
1014834451 6:126145296-126145318 CTGTCCTAGGGAGTGAGGGATGG - Intergenic
1015734032 6:136378209-136378231 CTGTCTGATGGGCATTGGGATGG + Intronic
1015816662 6:137218593-137218615 CTTTCTTAGCGGGGGTGGGGGGG - Intronic
1017443320 6:154484760-154484782 TTTTCTTTGGGGGAGGGGGAAGG - Intronic
1018432082 6:163730492-163730514 CTATCTGGGGGGGAGTGGTAAGG - Intergenic
1019760916 7:2811999-2812021 CTTTCCCAGGGGCAGTGGGAAGG + Intronic
1020035111 7:4959534-4959556 TGGTAGTAGGGGGAGTGGGAAGG + Intergenic
1020211140 7:6158972-6158994 CTGTCATCGGTGCAGTGGGACGG - Intronic
1021838895 7:24706468-24706490 CTTTCCTCGGGGGAGTGGGAAGG - Intronic
1021862577 7:24921683-24921705 ATGTCTCAGTGGGAGTAGGATGG - Intronic
1021982224 7:26065960-26065982 CTTTCTTGGGAGAAGTGGGATGG - Intergenic
1023124880 7:36945685-36945707 CTGACTTAAGGGGAATGTGAGGG - Intronic
1023421894 7:39989348-39989370 CTTTTTAATGGGGAGTGGGAGGG - Intronic
1023622510 7:42087464-42087486 CTGTCTTAGAGGTGGTGGCATGG - Intronic
1023926754 7:44675076-44675098 GTGTCCTGGGGGGAGGGGGAGGG + Intronic
1024697718 7:51873380-51873402 ATGTAATAGGGGGAGAGGGAAGG + Intergenic
1024958522 7:54951121-54951143 CAGGCTTAGGGAGATTGGGATGG - Intergenic
1026534715 7:71230155-71230177 CTGTCTCATGGGGAGTTGGGAGG - Intronic
1027581000 7:79995662-79995684 GTGTGGTAGGGGGAGAGGGAAGG - Intergenic
1027708101 7:81560156-81560178 CTGTCTGAGGGGGTCAGGGATGG + Intergenic
1027989986 7:85345874-85345896 GTGTGTTTGGGGGAGTGGGGTGG + Intergenic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029436783 7:100568169-100568191 CTGGTTGATGGGGAGTGGGAAGG + Exonic
1029437664 7:100572123-100572145 CTGTGTTAGGCGGAGGGCGAGGG - Intergenic
1030139868 7:106293442-106293464 CTGTCTTAGAGACAGTGAGAAGG - Intergenic
1030713903 7:112787374-112787396 CTTTTTTGGGGGGAGGGGGAAGG + Intronic
1033870197 7:145744786-145744808 CTGTTCTAGGGGGAGTGCTATGG + Intergenic
1034211627 7:149368683-149368705 CTGTTGTAGGGGGAGGGGGAGGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034493684 7:151407943-151407965 CTGTCTTGGGGGTAGAGGGGTGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1036013226 8:4751384-4751406 CTGTCTCAGGGGGGGTGGCGGGG + Intronic
1036275311 8:7346290-7346312 CTGTCTGTGGGTGAGTGGGGAGG + Intergenic
1036570280 8:9974273-9974295 CTTTTTTTGGGGGAATGGGAGGG + Intergenic
1036841370 8:12124814-12124836 CTGTCTGTGGGTGAGTGGGGAGG - Intergenic
1038367621 8:26952737-26952759 CTTTCTTAGGGAGATGGGGAGGG + Intergenic
1038788628 8:30646509-30646531 CTGACTTAGGGGTAGTGTGGTGG - Intronic
1039415321 8:37388876-37388898 CTGTCTTGGGTGGTATGGGAAGG + Intergenic
1040547392 8:48409279-48409301 CTGTGTTATGGTAAGTGGGAAGG - Intergenic
1042498355 8:69481612-69481634 CTGTCATAGGGTGAGTGGTTGGG - Intronic
1042837006 8:73088018-73088040 CTTTCTTAGAGGAGGTGGGAAGG + Intronic
1046515656 8:115256348-115256370 CTATCTTTGGGGGATAGGGAAGG + Intergenic
1047362534 8:124182330-124182352 CTGACTTGGGGGGAGAGGGTGGG + Intergenic
1047800577 8:128305553-128305575 CTGTCATAGAGAGAGTAGGAAGG + Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1049141977 8:140963115-140963137 CTGTATTAGAGGGAGAGGCAAGG - Intronic
1049170480 8:141157618-141157640 CTGCATTGGGAGGAGTGGGAAGG + Intronic
1050285634 9:4099023-4099045 TTGTCTTGAGGGCAGTGGGAAGG - Intronic
1050430739 9:5559102-5559124 CTGTCTTTGGGAGAATGGAATGG + Intronic
1052427826 9:28327517-28327539 CTCCCTTAGGGGGAGTGTGGAGG + Intronic
1053411300 9:37917679-37917701 TTTCCTTTGGGGGAGTGGGAAGG - Intronic
1055475399 9:76658352-76658374 CTTTTTGGGGGGGAGTGGGACGG - Intronic
1055845259 9:80554971-80554993 CTGTTTTAGTGTGTGTGGGAGGG + Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058512190 9:105731453-105731475 CTGTCGTGGGGTGAGAGGGAGGG - Intronic
1058554647 9:106153865-106153887 CTGTCTTGGGGTGAGGGGAAGGG + Intergenic
1059678843 9:116566860-116566882 CTGTGTGAAGGAGAGTGGGAAGG - Intronic
1060301166 9:122375375-122375397 CTGTCTGAGGTGGAGCCGGAAGG - Intronic
1060814216 9:126626318-126626340 CTGTTTTATGGGGAGGGAGAAGG + Intronic
1061380974 9:130257419-130257441 CTGTCTTCGAGGGAGTAGAAGGG - Intergenic
1061397553 9:130351644-130351666 CTGCCTTAGAGGGAGAGTGAGGG + Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1062035643 9:134381428-134381450 CTGTCTGAGCGGGAGAGGGAAGG + Intronic
1062085257 9:134644977-134644999 CTCTTTTATGGGGAGAGGGAGGG - Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062708807 9:137960394-137960416 CTGACTGGGGGGGAGGGGGAGGG + Intronic
1203458953 Un_GL000220v1:15913-15935 CTGACTTAGGGGGAAGGGCATGG - Intergenic
1185433015 X:20102-20124 GTGTCTTAGGGAGAGAGGGAGGG - Intergenic
1186473976 X:9842861-9842883 CTGTCTTAGGGAGAGAAGGAGGG + Intronic
1187341621 X:18425933-18425955 CTGTCTTTTGGGGTGTGGGGAGG + Intronic
1188260908 X:28022665-28022687 CTGTCTTAGAAGGTGTGAGATGG + Intergenic
1189192908 X:39126311-39126333 CAGTGTTGGGGAGAGTGGGAGGG + Intergenic
1189999494 X:46671896-46671918 CAGTCAAAGAGGGAGTGGGAGGG + Intronic
1191953185 X:66616621-66616643 CTGTCTTAGGCAGAATGGGAGGG + Intronic
1192366213 X:70475736-70475758 GTATCTTCTGGGGAGTGGGATGG + Intronic
1192929765 X:75793594-75793616 CTGTCATGGGGGGAGGGGGGAGG - Intergenic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196668198 X:118338406-118338428 CTGTCGTGGGGTGAGGGGGAGGG - Intergenic
1196741094 X:119026704-119026726 CTGTCAGAGGGGTGGTGGGAGGG + Intergenic
1197963406 X:132030408-132030430 TTGTTTTTTGGGGAGTGGGAGGG - Intergenic
1197990605 X:132312864-132312886 CTGTTTTATGGGGGGAGGGATGG - Intergenic
1198724991 X:139667609-139667631 CTGTCTCAGGGGGTGTGGGCAGG + Intronic
1198891557 X:141402906-141402928 CTGGTATAGGGGGAGTAGGAGGG + Intergenic
1202119088 Y:21506227-21506249 CTTTCTTGGGGGGTGTGGGGTGG + Intergenic
1202121540 Y:21529767-21529789 CTTTCTTGGGGGGTGTGGGGTGG + Intronic
1202157465 Y:21899615-21899637 CTTTCTTGGGGGGTGTGGGGTGG - Intronic
1202159912 Y:21923156-21923178 CTTTCTTGGGGGGTGTGGGGTGG - Intergenic