ID: 1172046176

View in Genome Browser
Species Human (GRCh38)
Location 20:32081965-32081987
Sequence AATCCCACCCTGCTGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172046174_1172046176 11 Left 1172046174 20:32081931-32081953 CCGATTTAATAAAAGTTGCAGCA No data
Right 1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG 0: 1
1: 0
2: 6
3: 30
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172046176 Original CRISPR AATCCCACCCTGCTGCTTCC TGG Intronic
900009107 1:90042-90064 AGAGCCAACCTGCTGCTTCCTGG + Intergenic
900025261 1:266855-266877 AGAGCCAACCTGCTGCTTCCTGG + Intergenic
900028863 1:356237-356259 AGAGCCAACCTGCTGCTTCCTGG + Intergenic
900152719 1:1185704-1185726 CATCCCTGGCTGCTGCTTCCGGG - Intronic
900320377 1:2080617-2080639 ATTCCCTCCCTGCTCCCTCCTGG + Intronic
900455087 1:2770382-2770404 AAACCCCCCCCACTGCTTCCAGG + Intronic
901463274 1:9404390-9404412 GCTCCAACCCTGCTGCTCCCTGG - Intergenic
902777202 1:18682596-18682618 AATCCCACCCTGCCACCTTCTGG + Intronic
903167273 1:21529531-21529553 AATCCTTCCCTGCTTCCTCCTGG + Intronic
904819446 1:33232000-33232022 AATCCATCCCTCCTTCTTCCTGG + Intergenic
904830528 1:33303695-33303717 CTGCCCACCCTGCAGCTTCCTGG + Intergenic
906034508 1:42741900-42741922 AAGCCCTTCCTGCTGTTTCCTGG - Intergenic
906056801 1:42924320-42924342 AATCACACCCTGGCGGTTCCAGG - Intergenic
906644201 1:47461810-47461832 AACTCCCTCCTGCTGCTTCCAGG - Intergenic
906798283 1:48714647-48714669 AATCTGACCATGCCGCTTCCTGG + Intronic
907391552 1:54161472-54161494 CTCCCCACCCTGCTGCCTCCTGG - Intronic
907824166 1:57999488-57999510 AATCCCACCCCACTATTTCCTGG - Intronic
908129308 1:61058853-61058875 AATCCCAACCTGCAGATACCAGG + Intronic
911202633 1:95061090-95061112 AATCCCTCCTTGCTTCCTCCTGG - Intronic
911796023 1:102077074-102077096 CATCCCTCACTTCTGCTTCCTGG + Intergenic
919444343 1:197683087-197683109 AGTCCCCTCCTGCTGCTTCCTGG - Intronic
922227228 1:223655984-223656006 CAGCCCACCCTCCTGCTTCCTGG - Intronic
922568448 1:226617381-226617403 CAGCCCAGCCTGCTGCTTCCTGG - Intergenic
1063295682 10:4803261-4803283 AATCCCTCCCTTCCCCTTCCTGG - Intronic
1066745746 10:38603397-38603419 GAACCCACCCTGCTGGTACCAGG - Intergenic
1068741750 10:60481399-60481421 AATTCCATTCTGCTGCTGCCAGG - Intronic
1069694680 10:70377784-70377806 AAGCCCACCCATCTGCTTCAGGG + Intronic
1069910732 10:71757661-71757683 CATCCCACCCTGCTGTGTCAGGG - Intronic
1070509220 10:77145179-77145201 AATCCCCTGCTGCTGGTTCCAGG - Intronic
1070824750 10:79384618-79384640 AAATCCACCCTGCAGCTCCCTGG + Exonic
1071297394 10:84232263-84232285 AATAACACACTGCTCCTTCCGGG + Exonic
1071521835 10:86336378-86336400 ACTCCCAGCCTTCTGTTTCCTGG - Intronic
1072306340 10:94111242-94111264 AATCCCACCCTGCAGCTGGAAGG - Intronic
1072712252 10:97723478-97723500 CATGCCACCATGCTGCTTCAAGG + Intergenic
1074121044 10:110494821-110494843 CATGCCACCCTTCTGCTTTCTGG + Intergenic
1075595798 10:123728192-123728214 GTTCCCTCCCTCCTGCTTCCTGG + Intronic
1075676835 10:124301742-124301764 ACTCACTCCCTCCTGCTTCCTGG - Intergenic
1076264038 10:129094952-129094974 AATCCAATCCTGATGCTTCCTGG - Intergenic
1077223625 11:1428157-1428179 CATCCCAGCCTGCTGCGTCGTGG + Intronic
1077888434 11:6402649-6402671 ACTGCCACACTGCTGCGTCCAGG + Exonic
1078305520 11:10181641-10181663 ATTCCCACCATCCTCCTTCCTGG + Intronic
1078473886 11:11613890-11613912 AAGCCCACCATGCTGCCTTCTGG + Intronic
1078517079 11:12031923-12031945 TCTCCCTCCCTGCTGGTTCCAGG + Intergenic
1078766027 11:14299471-14299493 AATGGCTCCCTGCTGCTTACAGG + Intronic
1079081163 11:17414610-17414632 ACTCCCGCCCTGCTTTTTCCAGG - Exonic
1080409012 11:32005930-32005952 AATCACACTCTACTGCTTCCAGG - Intronic
1080920275 11:36701870-36701892 AATACCACCCTGCTGCCTCATGG + Intergenic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1081766963 11:45618073-45618095 AACCCGACCCTGCTACTTCCTGG - Intergenic
1083535155 11:63460374-63460396 AACCCCATGCTGCTGCTTCTTGG - Intergenic
1084729510 11:71064438-71064460 CATCCCAGCTTGCTGCTGCCTGG - Intronic
1085644308 11:78213265-78213287 AAGCCCATCCTCCTGCTACCAGG - Intronic
1086375272 11:86193904-86193926 AATCCCATCCTACTGCTTGGAGG + Intergenic
1090202333 11:124865698-124865720 AACCACACCCTGCTGCCTCCCGG + Exonic
1090773883 11:129946549-129946571 CACCCCACCCTACTGCTTGCTGG - Intronic
1091186470 11:133652171-133652193 AAACCCACCCTCTTTCTTCCCGG + Intergenic
1091461690 12:647897-647919 AGTCCTGCCCTGCCGCTTCCAGG + Intronic
1092124425 12:6065555-6065577 GAACCCACGCTCCTGCTTCCAGG + Intronic
1095976031 12:47941817-47941839 AACCCCACCCTGCTTTCTCCTGG - Intronic
1098305580 12:69099371-69099393 ACTCCCACACTTCTGCTTCCTGG - Intergenic
1101425606 12:104585813-104585835 AATCCCTCCTTGCCTCTTCCTGG + Intronic
1101904548 12:108814902-108814924 CATCCCACTCCGCTGCTGCCTGG - Intronic
1102152817 12:110700297-110700319 AGTCCTACCCTGCCGCTTCATGG - Intronic
1102813825 12:115846203-115846225 GTCCCCACTCTGCTGCTTCCTGG - Intergenic
1103012453 12:117467553-117467575 ATCCTGACCCTGCTGCTTCCTGG - Intronic
1103516267 12:121510211-121510233 ATCCCCACCCTGCTGCTTCCCGG + Intronic
1104652288 12:130544326-130544348 AAGCACTCTCTGCTGCTTCCTGG + Intronic
1105303471 13:19154237-19154259 AGTCCCACCCAGCTGCTGCCTGG - Intergenic
1105978559 13:25495295-25495317 GATCCAATCCTGCTGCTTCTTGG - Intronic
1106350960 13:28930342-28930364 AGTCCCACCATGCAGCTTCTGGG - Intronic
1106504563 13:30360032-30360054 GATTCCACCCTACTCCTTCCTGG - Intergenic
1107844296 13:44495258-44495280 TATGTCACCCTGCTGCTTTCTGG - Intronic
1108178967 13:47822218-47822240 AATACCACACTGCTGCTCCCAGG - Intergenic
1113673089 13:112188266-112188288 ATTTCCACCCTGTTGATTCCTGG + Intergenic
1115491780 14:33965007-33965029 AGCCCCACCCTCCAGCTTCCAGG - Intronic
1117070490 14:52051557-52051579 ACTCCCACCCCACAGCTTCCCGG + Intronic
1117317231 14:54583398-54583420 CAGGCCACCCTGCTGCTTCTCGG - Intronic
1117377930 14:55132344-55132366 AACCCCACCCTGGTGTTTCCAGG - Intronic
1118182476 14:63507251-63507273 ATTCCCTCACTGCTGCTTCTAGG - Intronic
1119322900 14:73742083-73742105 AGTCCCACCCTGCAGCTTCATGG - Intronic
1119479680 14:74951695-74951717 CATCCCACCATGCAGGTTCCGGG + Intronic
1121609722 14:95269638-95269660 AACCCCACCAGGCTCCTTCCTGG + Intronic
1121972298 14:98369403-98369425 AATACCACTCTGCTGATTTCAGG + Intergenic
1123893895 15:24809300-24809322 AAGACCACCCTGCTCCATCCAGG - Intergenic
1127455588 15:59153582-59153604 AATCTTACCCTGCAGCTCCCTGG + Exonic
1128239298 15:66090271-66090293 AAACCCTCCCTGCCACTTCCAGG + Intronic
1128463294 15:67887763-67887785 ATTCCAACCCTGCTACTCCCAGG - Intergenic
1128474962 15:67989371-67989393 ACTCCCTCACTCCTGCTTCCTGG + Intergenic
1129032839 15:72630743-72630765 AAACCCACCCTGCTGGCTCTGGG - Intergenic
1129407636 15:75329563-75329585 AAGCCCACCCTGCTGGCTCTGGG - Intergenic
1129736181 15:77966078-77966100 TCTCTCACCCTGCTGCATCCAGG + Intergenic
1130512080 15:84598307-84598329 TCTCTCACCCTGCTGCATCCAGG + Intergenic
1130515490 15:84622928-84622950 AAACCCACCCTGCTGTGTGCAGG - Exonic
1130682428 15:86008365-86008387 AATCCCACACAGCTGCATTCTGG - Intergenic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1132276385 15:100568532-100568554 AATCCCACCCTGCCCCTTTCTGG - Exonic
1132352086 15:101146092-101146114 AATCCCATCTTGCTACTTCCAGG - Intergenic
1134804291 16:17111722-17111744 AACCCAACCCTTTTGCTTCCTGG - Intronic
1136506823 16:30709792-30709814 AAACCCACCCTGTGGCTTGCAGG + Intronic
1138322305 16:56126100-56126122 AATCCAACTCTGCTATTTCCTGG - Intergenic
1138415194 16:56867616-56867638 AACCCCAGCCTCCTGCCTCCCGG - Intronic
1138565198 16:57828041-57828063 AATCCCAGCCTGCTCCTTACTGG - Intronic
1139527581 16:67526294-67526316 ACTCCCAGCCTGCAGCTCCCTGG - Intronic
1141598732 16:85112678-85112700 AATCTCTCCCTGCTACCTCCTGG - Intergenic
1142211375 16:88810240-88810262 AACCCCACCTTGCTGTTACCTGG + Intronic
1142289179 16:89184939-89184961 AAGCCCACCGTGCTGTGTCCAGG - Intronic
1142455228 16:90216919-90216941 AGAGCCAACCTGCTGCTTCCTGG - Intergenic
1143475840 17:7203593-7203615 AGGCCCACCTTGCTGCTCCCAGG - Exonic
1144624161 17:16836227-16836249 AATCCCACCCTGACACCTCCTGG - Intergenic
1144882265 17:18436492-18436514 AATCCCACCCTGACACCTCCTGG + Intergenic
1145149969 17:20507894-20507916 AATCCCACCCTGACACCTCCTGG - Intergenic
1146125954 17:30232010-30232032 AACCCCTCCCTGGTCCTTCCAGG + Intronic
1146562505 17:33883392-33883414 ATTCCCCACCTGCTTCTTCCTGG - Intronic
1147138353 17:38447829-38447851 AATGCCAGCCTGCTGTTGCCTGG + Intronic
1147358968 17:39919342-39919364 AGGCCCACCCTGTTGCCTCCAGG - Intronic
1148519748 17:48261463-48261485 AAACGCCCCCTACTGCTTCCAGG - Intronic
1151201343 17:72470039-72470061 AGTCCCACCCAGCTACTTACTGG + Intergenic
1151268276 17:72973367-72973389 AGGACCACCCTGCTGTTTCCAGG + Intronic
1151440583 17:74126402-74126424 AATCCCACACTGCTCAGTCCTGG + Intergenic
1151785842 17:76274597-76274619 AGTCCCTCTCTCCTGCTTCCAGG + Intronic
1152734567 17:81991130-81991152 AAGCCCACCCTGCTCCCTCACGG - Intronic
1152743358 17:82028230-82028252 ACTCCCGCTCTGCAGCTTCCTGG - Exonic
1152950895 17:83230320-83230342 AGAGCCAACCTGCTGCTTCCTGG - Intergenic
1155027868 18:21958562-21958584 AATCTCACAGAGCTGCTTCCTGG - Intergenic
1156201108 18:34833233-34833255 AATCACACACAGATGCTTCCTGG - Intronic
1156461290 18:37322669-37322691 GAGCCCACCCTGGTGCCTCCCGG - Intronic
1156892981 18:42211042-42211064 AACCCCAATCTGCCGCTTCCAGG - Intergenic
1156964854 18:43078689-43078711 AATCCCAGACTCCCGCTTCCCGG + Intronic
1160898186 19:1412597-1412619 AAGCCCACTCTGGTGCTGCCAGG + Intronic
1161468014 19:4442842-4442864 GACCCCACCCTGCTGCCTCATGG - Intronic
1162497992 19:11034234-11034256 CATCCCACTCTGCTGCCACCAGG + Intronic
1162726559 19:12693134-12693156 ATTCTCACTGTGCTGCTTCCTGG - Intronic
1162866673 19:13553183-13553205 AATCCCACCCTTCAGCCCCCAGG - Intronic
1162935509 19:13979715-13979737 AACTCAGCCCTGCTGCTTCCTGG - Intronic
1163338030 19:16686444-16686466 AATGCCACCCTGCCACCTCCAGG + Intronic
1163686350 19:18714033-18714055 CCTCCCACCCTGCTGCTTCCGGG - Intronic
1163844892 19:19633017-19633039 CCTCCCACCGTGCTGCTCCCTGG + Intronic
1163871287 19:19823380-19823402 GAGCCCAGCCTGTTGCTTCCTGG + Intergenic
1163885059 19:19958115-19958137 GAGCCCAGCCTGTTGCTTCCTGG + Intergenic
1164752935 19:30669564-30669586 AATCCCACTCTCCTGCTGCGGGG + Intronic
1165273754 19:34731892-34731914 AAACGACCCCTGCTGCTTCCTGG - Intergenic
1165935562 19:39386572-39386594 ATTCCAATCTTGCTGCTTCCAGG - Exonic
1166305744 19:41936080-41936102 ACCCCCACCCTGAGGCTTCCCGG - Intergenic
1168336139 19:55598956-55598978 AACTCCTCCCTCCTGCTTCCTGG + Intronic
1168342253 19:55631755-55631777 AGTCCCTACCTGCTTCTTCCAGG + Intergenic
1168501160 19:56894651-56894673 GAGCCCACCCTGCTGACTCCAGG - Intergenic
924992267 2:322479-322501 CTTGCCACCCGGCTGCTTCCTGG - Intergenic
925916502 2:8610721-8610743 TATCCCTCCCAGCTGCCTCCTGG + Intergenic
926136296 2:10339030-10339052 ACTCCCATCCTGCTGCTTCCTGG - Intronic
928285673 2:29988088-29988110 ACTCCCCTACTGCTGCTTCCTGG + Intergenic
929430329 2:41880868-41880890 AGTCCCACTCTGTTGCTCCCAGG + Intergenic
932094251 2:68832706-68832728 AGTCCCAACCACCTGCTTCCTGG - Intergenic
932137064 2:69240745-69240767 AATCCCACTCTGCCACTTACTGG + Intronic
932170011 2:69546041-69546063 AATCCCACCCTTCTACTTATAGG - Intronic
933811936 2:86038069-86038091 AAGCCCATCCTCCTGCTCCCCGG + Intronic
934188447 2:89765366-89765388 GAACCCACCCTGCTGGTACCAGG + Intergenic
934308148 2:91842589-91842611 GAACCCACCCTGCTGGTACCAGG - Intergenic
935250046 2:101253030-101253052 ACGCCGACCCTGCCGCTTCCCGG - Exonic
935925593 2:108065189-108065211 GTTCCCATCCAGCTGCTTCCTGG - Intergenic
936452788 2:112645989-112646011 AAACCCCCGCGGCTGCTTCCTGG + Exonic
936648992 2:114404710-114404732 AATCCCACTGTGCTCCTTACAGG - Intergenic
937333769 2:121048033-121048055 TCTCCCACTCTGCTGCTTCTTGG - Intergenic
938081495 2:128372731-128372753 AGCCCCAGCCTGCTGCATCCAGG - Intergenic
938292200 2:130156206-130156228 AGTCCCACCCAGCTGCCGCCTGG - Intronic
938403814 2:131016093-131016115 AACCCCACCCTCTTGCTTCTGGG + Intronic
938464351 2:131516763-131516785 AGTCCCACCCAGCTGCCGCCTGG + Intergenic
941625995 2:167830839-167830861 CACCTCACGCTGCTGCTTCCTGG - Intergenic
941866616 2:170341936-170341958 AGTCACACTCAGCTGCTTCCTGG - Intronic
941966927 2:171310073-171310095 AATCCCACCCTCCTCCTTCCTGG + Intergenic
942124334 2:172808819-172808841 TTTTCCACTCTGCTGCTTCCAGG + Intronic
942698075 2:178668704-178668726 AATCTCACTCTGCTGCACCCAGG - Intronic
944366661 2:198928947-198928969 CATCCCACCCTCCTGCCTCATGG + Intergenic
945047642 2:205796004-205796026 TATCACACAATGCTGCTTCCAGG - Exonic
947927996 2:233938214-233938236 AAGCCCACCCTGTTCCTACCCGG + Intronic
948604957 2:239129159-239129181 AATTTCACTCTGCTGCCTCCAGG + Intronic
949086709 2:242161645-242161667 AGAGCCAACCTGCTGCTTCCTGG - Intergenic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1170588740 20:17755042-17755064 AACCCCTCCCTTGTGCTTCCTGG + Intergenic
1171091179 20:22287081-22287103 CTTCCCACTATGCTGCTTCCTGG - Intergenic
1171117182 20:22534993-22535015 ACTGACACCCTGCTGCTCCCTGG - Intergenic
1171190267 20:23153980-23154002 AAACCCACCCTGCTGGCACCTGG - Intergenic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1172438600 20:34948859-34948881 TATCACTCCCTGTTGCTTCCTGG - Intronic
1173152350 20:40578379-40578401 CCTCCCCACCTGCTGCTTCCAGG - Intergenic
1173364201 20:42370233-42370255 CAGCCCACACAGCTGCTTCCTGG - Intronic
1173909674 20:46657219-46657241 CATCACACCCAGCTACTTCCTGG - Intronic
1173918911 20:46729331-46729353 ACTCCCGCCCTCCTGTTTCCAGG + Exonic
1175725211 20:61313300-61313322 GAACCCTCCCTGCTGCTTCTGGG - Intronic
1176055063 20:63140995-63141017 AGTCCCAGCCTGGTGCATCCTGG - Intergenic
1178546020 21:33493645-33493667 CATCCCCCTCTTCTGCTTCCAGG + Intergenic
1179060161 21:37972299-37972321 ACTATCACCCTGCTGCTTCCTGG - Intronic
1180003265 21:45004664-45004686 ACACCCACCATGCTGCTGCCCGG - Intergenic
1180841726 22:18962062-18962084 ACACCCACCCTGCTGCCTCCAGG - Intergenic
1181059776 22:20276799-20276821 ACACCCACCCTGCTGCCTCCAGG + Intronic
1181527546 22:23498900-23498922 AAGCACCCCCTGCTCCTTCCAGG - Intergenic
1181857541 22:25792825-25792847 ATTCCCACCCCTCTGCCTCCCGG - Intronic
1182027193 22:27129519-27129541 AATCCCTCTCTGCTATTTCCTGG - Intergenic
1182083453 22:27545041-27545063 GATCCCACTCCACTGCTTCCTGG + Intergenic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1183281608 22:36935498-36935520 AATCCCACCCAGCTCCCTCCAGG + Intronic
1184288844 22:43487489-43487511 CATGGCTCCCTGCTGCTTCCAGG - Intronic
1184505144 22:44895997-44896019 CAGCCCAACCTGCTGCTACCTGG + Intronic
1185009909 22:48307090-48307112 AGCCCCACTCTGCTGCCTCCTGG + Intergenic
1185379732 22:50502905-50502927 AATCCCATCCTCATGCCTCCTGG + Intergenic
949435147 3:4020998-4021020 ATTCCCTAACTGCTGCTTCCTGG - Intronic
950768022 3:15288411-15288433 CATCCCTCCCTACTGCCTCCCGG - Intronic
952191796 3:31030448-31030470 ATTCCCACTCTGCAGTTTCCTGG + Intergenic
953526346 3:43692725-43692747 AATCCAGCCCTGCTACTTGCTGG - Intronic
954418175 3:50404361-50404383 AGCCCCACCCAGCTGCTGCCAGG + Intronic
954753599 3:52827197-52827219 ACTCCCACCCTTCTGCCCCCAGG - Exonic
954856242 3:53646243-53646265 TATCCCAACCTGCAGCTTCTTGG - Intronic
956049624 3:65233770-65233792 AATCCTCCCCAGCTGGTTCCTGG - Intergenic
956890247 3:73606381-73606403 AGTCTGACCCTGCTGCTTCCTGG + Intronic
959228365 3:103615957-103615979 AATCCCACCCTCCAACATCCAGG + Intergenic
959560321 3:107772337-107772359 AATCCCTTCCTCCTTCTTCCAGG + Intronic
960123618 3:113973632-113973654 AATCTCATCCTGCTGTCTCCTGG + Intronic
962759300 3:138494012-138494034 CATTCCACCATGCTGCTTCCTGG + Intergenic
963236627 3:142963232-142963254 ACTCCCACTCTGCCGCCTCCCGG - Exonic
964868640 3:161289331-161289353 AACCACACCCAGCTGGTTCCAGG + Intergenic
966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG + Intronic
967075129 3:185994925-185994947 AAACCTACCCTGTTGCTCCCAGG - Intergenic
967129687 3:186458987-186459009 AATCCTGCTCTGCTGCTTACTGG - Intergenic
967548628 3:190763108-190763130 TTTCCCTCGCTGCTGCTTCCTGG - Intergenic
969920162 4:10530831-10530853 CACCCCAGCCTGCTCCTTCCAGG + Intronic
970226271 4:13860514-13860536 AATCACACCCTGCTGCTTACAGG + Intergenic
972032539 4:34479232-34479254 AATCACAGCCTGTTGCTTTCTGG - Intergenic
972733228 4:41815296-41815318 AGTTCCACCCTCCTGTTTCCTGG - Intergenic
976555122 4:86441825-86441847 AAGCCTCTCCTGCTGCTTCCTGG + Intronic
977167883 4:93724198-93724220 AAACCCACCATGCTATTTCCAGG + Intronic
977262913 4:94819475-94819497 ATTCCCACACAGCTCCTTCCTGG - Intronic
977952458 4:102988528-102988550 AATCCCACTCTGCCGCATCATGG - Intronic
980847419 4:138340912-138340934 GAAGCCACCCTGCTGCTACCTGG - Intergenic
982824569 4:159986203-159986225 AATCCCCCCCTGATTATTCCTGG + Intergenic
985522909 5:387254-387276 TCCCCCACCCTGCTGCCTCCTGG + Intronic
985832033 5:2240880-2240902 AATCCCCTCCTGCTTCTGCCGGG + Intergenic
985886454 5:2683905-2683927 CAGCCCTCCCTGCTGCTGCCAGG + Intergenic
988323903 5:29737562-29737584 AAAACCACCCTGCTCTTTCCAGG - Intergenic
990512520 5:56501462-56501484 TATCCCTCCATTCTGCTTCCAGG - Intergenic
990667428 5:58089152-58089174 TTTCCCAGCCTCCTGCTTCCTGG - Intergenic
992579329 5:78155286-78155308 CATGCCACACTGCTGCTGCCAGG + Intronic
994746484 5:103684958-103684980 ATTCCTACCCTACTGCTTCCAGG - Intergenic
996152601 5:120058208-120058230 ACTCTCACCCTGCTGCTTTAGGG - Intergenic
996671782 5:126126485-126126507 ATTCCCACCCTGATACTTACTGG - Intergenic
997600003 5:135132583-135132605 AATCCCAGGCTGCTGCTTTGTGG + Intronic
997661400 5:135591852-135591874 GCTCCCTCCCTCCTGCTTCCTGG + Intergenic
998298087 5:140990921-140990943 AATCCCATACTGTTGCCTCCTGG + Intronic
999147401 5:149405483-149405505 AATCCCTCTCTCCTCCTTCCAGG - Intergenic
999152663 5:149436644-149436666 AATCCCGCCCTCCTTCTGCCAGG - Intergenic
1001126488 5:169024225-169024247 AATGCCACTCTGCTTCCTCCCGG - Intronic
1002745127 5:181464134-181464156 AGAGCCAACCTGCTGCTTCCTGG - Intergenic
1002758584 6:184203-184225 AGCTCCACCCTGCAGCTTCCAGG + Intergenic
1003837491 6:10087421-10087443 AATGTCAACCTGATGCTTCCTGG - Intronic
1004108902 6:12695032-12695054 ATTCACACCCATCTGCTTCCAGG - Intergenic
1004817528 6:19328751-19328773 ATTCCTACACTGCTGCTTCAGGG - Intergenic
1005006823 6:21295681-21295703 ATTCCCACTCTGCTTCATCCCGG - Intergenic
1005271119 6:24164650-24164672 CATGCCACCCTGCTTCTTGCAGG + Intergenic
1006432807 6:34008137-34008159 AATCCCTCTGTGCTGCTTCACGG + Intergenic
1012158136 6:95846898-95846920 AATCCCACACAGCTGTTTCAGGG - Intergenic
1012253703 6:97008424-97008446 AAGACCACCCTGCTGTGTCCAGG + Intronic
1014584004 6:123176156-123176178 AATCTCACTCTGCGGCGTCCAGG + Intergenic
1017667553 6:156735968-156735990 ATTCCCACGCTGCTGATTCATGG + Intergenic
1018507904 6:164491233-164491255 TGCCCCACCCTGCTGCTGCCTGG + Intergenic
1019250036 6:170737680-170737702 AGAGCCAACCTGCTGCTTCCTGG - Intergenic
1019304849 7:328476-328498 CAACCCACCCTGCTGCCACCCGG + Intergenic
1019335397 7:480350-480372 CCTCCCACTCTGCTGCCTCCAGG - Intergenic
1019648517 7:2143742-2143764 GATCCCACCTTGCTGCCTCCAGG - Intronic
1019813121 7:3179528-3179550 AGGCCCACTCTGCTGCTTGCCGG - Intergenic
1019919774 7:4156180-4156202 ATGCCCACTCTGCTGCCTCCTGG + Intronic
1020642992 7:10779545-10779567 ATGCCCACCCCGCTCCTTCCTGG + Intergenic
1022205062 7:28155835-28155857 ATTCTAACCCTGCTTCTTCCTGG + Intronic
1022465181 7:30648890-30648912 CATGCCACCCGGTTGCTTCCAGG + Intergenic
1023891274 7:44393552-44393574 AAACCCACTCTGTTGCTTCTTGG - Intronic
1026498564 7:70923747-70923769 ATTCCCAGCCTGGTGCATCCTGG + Intergenic
1028223087 7:88219707-88219729 AAGCCCACCCTGCGGCTTCTCGG - Intronic
1029445168 7:100607915-100607937 AACCCCTCCCTCCTTCTTCCAGG + Exonic
1029488745 7:100858948-100858970 AGTCCCTGCCTGCTGCCTCCTGG + Intronic
1029549550 7:101230467-101230489 CATCACACCAGGCTGCTTCCTGG - Intergenic
1029709049 7:102289682-102289704 CATCCCACCCAGCTGCCTTCTGG - Intronic
1030130222 7:106193603-106193625 ACTCCCATCCTCCTGCTTCCTGG - Intergenic
1030303016 7:107993015-107993037 AATCCCTGCCTGCTCCTTCTTGG - Intronic
1032187471 7:129739587-129739609 CCTCCCACCCTGCTGTTTACTGG - Intronic
1033230887 7:139596670-139596692 AAACCCTCCCGGCTCCTTCCTGG + Intronic
1033535483 7:142308283-142308305 CCTCCCTCCCTGCTCCTTCCCGG - Intergenic
1034178080 7:149116072-149116094 TGTCCCACCCTGCTGGCTCCTGG + Intronic
1035359605 7:158302170-158302192 ACAGCCACACTGCTGCTTCCTGG + Intronic
1035498000 8:69624-69646 AGAGCCAACCTGCTGCTTCCTGG + Intergenic
1035654213 8:1293300-1293322 GAGCCCAGCCTGCTGCTGCCTGG - Intergenic
1035654240 8:1293399-1293421 GAGCCCAGCCTGCTGCTGCCAGG - Intergenic
1035924321 8:3710930-3710952 GATCTCACCCTCCTCCTTCCAGG - Intronic
1041512424 8:58666608-58666630 ATTCCCAACCTGCTTCTGCCTGG - Intergenic
1042554384 8:70021890-70021912 ACACACACCCTGCTGATTCCCGG + Intergenic
1043823390 8:84895985-84896007 AATCTCTCCCAGCTGCTTCTGGG + Intronic
1044086855 8:87953086-87953108 CACCCCAACCTGCTGCTTTCAGG + Intergenic
1044630964 8:94278325-94278347 ACACCCACCCTGGTGCTTCAGGG - Intergenic
1047779501 8:128099961-128099983 AAACCCACCCTGCGGCTGGCTGG - Intergenic
1048888052 8:138924485-138924507 AAGCCTACGGTGCTGCTTCCTGG - Intergenic
1049427777 8:142544936-142544958 GATTCCCCCCTGCTTCTTCCTGG - Exonic
1049931130 9:457962-457984 AATCCCGCTTTGCTGCTTACTGG - Intronic
1051797909 9:20895344-20895366 AATCTCACCAAGTTGCTTCCTGG - Intronic
1052470299 9:28885331-28885353 TATATCTCCCTGCTGCTTCCAGG - Intergenic
1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG + Intronic
1053008252 9:34618620-34618642 CATCCCACCCCTCAGCTTCCTGG - Intronic
1056765342 9:89441595-89441617 CCTCCCTGCCTGCTGCTTCCAGG - Intronic
1056889930 9:90482431-90482453 AATCCCATGCTGCTGGTGCCTGG - Intergenic
1057308774 9:93928285-93928307 AAACCAACCCTGCTGATACCTGG - Intergenic
1058528025 9:105879386-105879408 ACTCCCCTCCTGCTGTTTCCTGG + Intergenic
1059864701 9:118501450-118501472 AATCCTCCCCTTGTGCTTCCCGG + Intergenic
1060256585 9:122036060-122036082 GCTCTCACCCTGCTGCTCCCTGG + Intronic
1060794837 9:126506583-126506605 AATCCCAGCCTGCAGGTTCTTGG + Exonic
1060980163 9:127786840-127786862 TTTTCCACCCTGCTGCTTCTGGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061938934 9:133873840-133873862 AAGCCCACCCAGCAACTTCCAGG + Intronic
1203579597 Un_KI270745v1:30265-30287 AGAGCCAACCTGCTGCTTCCTGG - Intergenic
1187061294 X:15789728-15789750 ATTCCCACCCTTCTCCTTCTGGG + Intergenic
1187830963 X:23380607-23380629 ACTCCCATACTGGTGCTTCCTGG - Intronic
1190089030 X:47421469-47421491 AATGCCCCCCAGCTGCATCCAGG - Intergenic
1190498724 X:51054076-51054098 AACACCACGCTGCTGCTTCTAGG + Intergenic
1190685236 X:52867669-52867691 ATGCCCACCCTGCTCCTTCCCGG + Intronic
1191000678 X:55657553-55657575 ATGCCCACCCCGCTCCTTCCTGG + Intergenic
1194665003 X:96667712-96667734 AAACCAACCCTGCTGATGCCTGG - Intergenic
1197481040 X:126986162-126986184 AATCCCACCCAGCAGCTGCCGGG - Intergenic
1199901579 X:152177950-152177972 CATTCCCTCCTGCTGCTTCCAGG - Intronic
1201853019 Y:18509040-18509062 AATCCAACACTGCAGCTTTCCGG + Intergenic
1201880302 Y:18811344-18811366 AATCCAACACTGCAGCTTTCCGG - Intronic