ID: 1172046443

View in Genome Browser
Species Human (GRCh38)
Location 20:32084033-32084055
Sequence GGTGGGACTCACTCTTGTAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172046443_1172046452 4 Left 1172046443 20:32084033-32084055 CCACTACAAGAGTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1172046452 20:32084060-32084082 GGGTGACATCCCCACCACGATGG 0: 1
1: 0
2: 1
3: 6
4: 70
1172046443_1172046453 5 Left 1172046443 20:32084033-32084055 CCACTACAAGAGTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1172046453 20:32084061-32084083 GGTGACATCCCCACCACGATGGG 0: 1
1: 0
2: 0
3: 3
4: 51
1172046443_1172046458 26 Left 1172046443 20:32084033-32084055 CCACTACAAGAGTGAGTCCCACC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1172046458 20:32084082-32084104 GGCCCACAGACTCCTAGTCACGG 0: 1
1: 0
2: 2
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172046443 Original CRISPR GGTGGGACTCACTCTTGTAG TGG (reversed) Exonic
900463653 1:2813345-2813367 GGTGGGCCCCACACTTGGAGTGG + Intergenic
906888087 1:49674373-49674395 TATTTGACTCACTCTTGTAGAGG - Intronic
909151099 1:72006445-72006467 GGTGGCACTGACACTTATAGAGG - Intronic
909427111 1:75538113-75538135 GGTTGGTCTCACTCCTGTAGTGG - Intronic
909617809 1:77632176-77632198 AGTGGGACTACCTCTGGTAGGGG + Exonic
910904641 1:92162458-92162480 ACTGGGACTCAATCTTGTTGGGG - Intergenic
911928132 1:103863510-103863532 GGTTGGAGTCACTCTTTTTGTGG + Intergenic
913551895 1:119924453-119924475 GTTGGGATTCACTCTTGAAAGGG - Intronic
913800885 1:122703755-122703777 GATTGGACACACTCTTGTTGTGG + Intergenic
917077283 1:171218618-171218640 GGTGGGAAGCACTCTAGCAGGGG - Intergenic
918908820 1:190537491-190537513 GGTGGCACTAACTCCTGTATTGG + Intergenic
920491913 1:206422724-206422746 GGTTGGGCTCACTGTTGGAGGGG + Intronic
922187646 1:223289865-223289887 GGTTAGACTCAACCTTGTAGAGG + Intronic
922355408 1:224770511-224770533 CGTGTGACTCACCCTTGTAATGG + Intergenic
922380345 1:225017515-225017537 GGTGGGAAGTACTCTGGTAGGGG - Intronic
922900085 1:229129901-229129923 GGAGGGACGCACCCATGTAGGGG - Intergenic
923256406 1:232225259-232225281 GGAGGGACCCCCTCTTTTAGGGG + Intergenic
1066443349 10:35459592-35459614 GGTGGGACCCTGTCTTATAGGGG + Intronic
1073834136 10:107421291-107421313 AATGTGACTCACTCTTGGAGTGG + Intergenic
1075281182 10:121139761-121139783 GGAAGGCCTCACTCTTGAAGAGG + Intergenic
1076467862 10:130697425-130697447 GTTGGGTCTCACTCTTGGATGGG - Intergenic
1082932963 11:58628244-58628266 GGTGGGTCTGACGCTTGCAGTGG - Intergenic
1083908986 11:65694298-65694320 GGTGGGAGACAGTCTTGTAGTGG + Intergenic
1084173909 11:67413562-67413584 GGTGGGACACACTCCAGGAGAGG + Intronic
1084427736 11:69094765-69094787 GGTGGGACCCACACCTGTGGGGG + Intergenic
1084564142 11:69920085-69920107 GGCAGGACTCACTCTAGGAGGGG - Intergenic
1084932069 11:72564065-72564087 GATGGGACTCCCACTTCTAGGGG - Intergenic
1087233041 11:95687420-95687442 GGTGGGAATTACTCATTTAGGGG - Intergenic
1088178815 11:107085620-107085642 GCTTGGAATCACTCTTATAGTGG + Intergenic
1104301776 12:127570894-127570916 TGTGCGACTCACTGTTGCAGAGG + Intergenic
1108427591 13:50319425-50319447 GTTGGGGATCACTGTTGTAGAGG + Intronic
1108448669 13:50536814-50536836 GGCAGGACTCACTCTAGTAGTGG + Intronic
1108845648 13:54676645-54676667 GGTGGGCCCCACACTTGGAGCGG + Intergenic
1110305624 13:73983991-73984013 CCTGGGACCCACCCTTGTAGTGG - Intronic
1112539632 13:100295682-100295704 GGTGGGCCTTACACTTTTAGGGG + Intronic
1117251457 14:53943571-53943593 AGTGGGACTCACTCTTTATGAGG - Intergenic
1202942274 14_KI270725v1_random:162317-162339 GGTGGGACTCTCTCTTGAGATGG + Intergenic
1125349436 15:38752142-38752164 GGTGGGACTCCTTCTTGCAGTGG + Intergenic
1126683689 15:51228347-51228369 TCTGTGGCTCACTCTTGTAGTGG - Intronic
1129720152 15:77873458-77873480 GCTAGGACTCACTCTTGGGGTGG - Intergenic
1132188335 15:99824967-99824989 GCAGGGACTGACTCTAGTAGTGG - Intergenic
1133211028 16:4263645-4263667 GGTGGGTCTATCTCTTGGAGTGG - Intronic
1141446610 16:84062892-84062914 GGTCTGACTCACTCTTTTACTGG - Intronic
1142251290 16:88993213-88993235 GGTGGGCCTGGCTCTTGTGGAGG - Intergenic
1144011447 17:11151952-11151974 GGTGGGACTCTTTGCTGTAGCGG + Intergenic
1144322016 17:14134629-14134651 GGTGTAACACACTCTTGGAGAGG + Intronic
1144737839 17:17564815-17564837 GGTGGGACTCAGCCTGGTAGGGG + Intronic
1145449557 17:23225991-23226013 GGTTGGAACCACTCTTGTTGTGG + Intergenic
1145461887 17:23405836-23405858 GGTTGGAAACACTCTTGTTGTGG + Intergenic
1145474192 17:23584137-23584159 GGTTGGAAACACTCTTGTTGTGG + Intergenic
1145542186 17:24573505-24573527 GGTTGGAAACACTCTTGTTGTGG + Intergenic
1145574555 17:25044361-25044383 GTTTGGACACACTCTTGTTGTGG + Intergenic
1145615961 17:25647205-25647227 GTTTGGACACACTCTTGTTGTGG + Intergenic
1145641204 17:26013616-26013638 GTTTGGACACACTCTTGTTGTGG + Intergenic
1145650153 17:26143917-26143939 GTTTGGAATCACTCTTGTTGTGG + Intergenic
1145729611 17:27165681-27165703 GGTTGGAAACACTCTTTTAGTGG + Intergenic
1145776857 17:27535082-27535104 GGTGGGACTCAGTGTTTCAGGGG + Intronic
1168470509 19:56637091-56637113 TGAAGGACTCACTCTTGCAGAGG + Intergenic
925146138 2:1584598-1584620 GGTGGGCCTCACGCTTGTCCTGG - Intergenic
926929414 2:18022542-18022564 GGTGGGAAGCACTCTAGTGGGGG + Intronic
943024395 2:182609762-182609784 GGTGGGACCCACTCTGGAATGGG - Intergenic
944847466 2:203682992-203683014 GCTGGGACAAACTCTTGGAGGGG - Intergenic
946841821 2:223827195-223827217 GGCGGGACTCTCTTATGTAGTGG + Intronic
948409653 2:237749247-237749269 GGTGGGACTTCCTCTCGGAGAGG + Exonic
1169925331 20:10777764-10777786 GGTGGGGCTCACTGTTGCTGGGG + Intergenic
1171538199 20:25917454-25917476 GGTGGGACTCTCTCCTGAGGTGG + Intergenic
1172046443 20:32084033-32084055 GGTGGGACTCACTCTTGTAGTGG - Exonic
1172842470 20:37910072-37910094 GGTAGGACCCAATCTTGTTGCGG - Intronic
1172899225 20:38321546-38321568 AGTGGGACCCACTCTTGCTGGGG - Intronic
1176580896 21:8524613-8524635 GGTGGGACTCTCTCTTGAGATGG - Intergenic
1181452013 22:23029111-23029133 GGAGTGACTCCATCTTGTAGAGG - Intergenic
949672200 3:6412167-6412189 GCTGGCAGTCACTCCTGTAGGGG + Intergenic
952058111 3:29473787-29473809 GGTGGGCCCCACACTTGGAGGGG - Intronic
952808300 3:37378318-37378340 GGTGGGACAGAGTTTTGTAGTGG - Intergenic
956771409 3:72529194-72529216 AGTGGGGCTCACTCTTGGCGTGG - Intergenic
957919679 3:86731724-86731746 GGTGGGCCCCACACTTGGAGCGG - Intergenic
959501477 3:107110837-107110859 GTTGGGACTGTCTCTTGAAGTGG - Intergenic
961553343 3:127681154-127681176 GGTGGGCCTCATTCTAGGAGAGG + Intergenic
962082496 3:132155604-132155626 GGTGTGGCTCACTGTTGCAGAGG - Intronic
962849204 3:139295271-139295293 GCTGGGCCTCACTCTGGAAGAGG + Intronic
963368681 3:144369599-144369621 GCTGGGAGGCACTCTGGTAGGGG - Intergenic
963672338 3:148267806-148267828 GGTGGGATTCCTTCTTGTTGGGG - Intergenic
967231607 3:187342532-187342554 GGTGGGTCTCAGTCCTGTAGAGG + Intergenic
972745163 4:41925058-41925080 GGTGGGAGGCACTGTTGTGGAGG + Intergenic
973045368 4:45530531-45530553 GGTGGGCCCCACACTTGGAGTGG + Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
974839360 4:67283105-67283127 GGTGGGCCCCACACTTGGAGCGG - Intergenic
975482330 4:74894659-74894681 TGAAGGACTCACTCTTGTAATGG - Intergenic
976511225 4:85911243-85911265 GGTGGGGCTCCCACTTGTACCGG + Intronic
982985495 4:162200984-162201006 GGTGGGACTCTCTCTGGGAAGGG + Intergenic
986964874 5:13258100-13258122 TGTGGCACTCTGTCTTGTAGAGG - Intergenic
987098637 5:14572953-14572975 AGTGGGACTCAGTCTTTAAGAGG - Intergenic
991389322 5:66125485-66125507 TGTGGGACTCACTTCTGTACAGG - Intergenic
994768655 5:103954095-103954117 GGTGGGACCCACACTCTTAGCGG - Intergenic
995892587 5:116971973-116971995 GGAGAGACTCACGCTTGCAGAGG - Intergenic
996298576 5:121954236-121954258 GGCGGGCCTCACACTTGGAGCGG - Intergenic
1003348653 6:5294893-5294915 GGTGGGACTCTCTCATGGAAGGG + Intronic
1003534654 6:6966130-6966152 GGTTGGACCCACTCTTGTTTGGG + Intergenic
1005365107 6:25068877-25068899 GCTGGGACTCACTGTTGCAATGG + Intergenic
1006408010 6:33856351-33856373 GGTGGGAGTCACTCTTGGAGAGG - Intergenic
1008657303 6:53629053-53629075 GTTGGGAGTCACTGTTGTTGAGG + Intergenic
1010802934 6:80199157-80199179 TGTGGAACTCACTTCTGTAGTGG + Intronic
1018867225 6:167755668-167755690 GGTGGGACTCGTCCTGGTAGTGG + Intergenic
1029514251 7:101016041-101016063 GGTGAGACTGACTCTTGAATAGG + Intronic
1035274825 7:157741514-157741536 GGAGGGACTGATTCTTGAAGTGG - Intronic
1035353018 7:158259582-158259604 AGTGGGACTCACTCTTCCCGGGG + Intronic
1035895527 8:3396182-3396204 GGTGCAACTCACTCTCATAGTGG + Exonic
1036200506 8:6767357-6767379 GGAGGGTCAGACTCTTGTAGGGG - Intergenic
1040131057 8:43797253-43797275 GGTTGGAAACACTCTTTTAGTGG + Intergenic
1040343765 8:46464634-46464656 GGTTGGAAACACTCTTTTAGTGG - Intergenic
1040789242 8:51205788-51205810 GGAGGGACACACTCTGGTGGGGG + Intergenic
1044017778 8:87066395-87066417 GGCAGCACTCACTCATGTAGAGG - Intronic
1046199271 8:110900754-110900776 TATTGGACTGACTCTTGTAGAGG + Intergenic
1046474446 8:114723232-114723254 GGAGGGACAGACTCTTGGAGGGG - Intergenic
1047686051 8:127305501-127305523 GGTGGGAATCTCTTTTGGAGAGG + Intergenic
1050683924 9:8146107-8146129 TGTGTGACACACTCTTGTAGAGG - Intergenic
1053297598 9:36925888-36925910 GGTGGGACTCACACTTCCTGGGG - Intronic
1056010944 9:82329458-82329480 GGTGGAACCCACTCTGTTAGAGG + Intergenic
1060890872 9:127187381-127187403 GGTGTGCCGCACTCTTGTGGTGG - Intronic
1195725061 X:107906422-107906444 GGTGAGAGTCACTGTTGGAGGGG - Intronic