ID: 1172049843

View in Genome Browser
Species Human (GRCh38)
Location 20:32109162-32109184
Sequence CTGTGAAATGGGAAGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172049843_1172049854 26 Left 1172049843 20:32109162-32109184 CCAACCCCCTTCCCATTTCACAG No data
Right 1172049854 20:32109211-32109233 AAACGAACAAACAAAAAAACAGG 0: 4
1: 169
2: 588
3: 1470
4: 5175
1172049843_1172049853 -1 Left 1172049843 20:32109162-32109184 CCAACCCCCTTCCCATTTCACAG No data
Right 1172049853 20:32109184-32109206 GATGGGAATGAGGAAGAGCAAGG No data
1172049843_1172049855 27 Left 1172049843 20:32109162-32109184 CCAACCCCCTTCCCATTTCACAG No data
Right 1172049855 20:32109212-32109234 AACGAACAAACAAAAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172049843 Original CRISPR CTGTGAAATGGGAAGGGGGT TGG (reversed) Intergenic
No off target data available for this crispr