ID: 1172056600

View in Genome Browser
Species Human (GRCh38)
Location 20:32158556-32158578
Sequence CGGGTCACTCCCACTCCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 611}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172056586_1172056600 5 Left 1172056586 20:32158528-32158550 CCTCCCCCACCCCTCCACCCATG 0: 1
1: 3
2: 25
3: 322
4: 2572
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056587_1172056600 2 Left 1172056587 20:32158531-32158553 CCCCCACCCCTCCACCCATGCTA 0: 1
1: 0
2: 6
3: 76
4: 759
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056589_1172056600 0 Left 1172056589 20:32158533-32158555 CCCACCCCTCCACCCATGCTAGC 0: 1
1: 0
2: 2
3: 42
4: 371
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056588_1172056600 1 Left 1172056588 20:32158532-32158554 CCCCACCCCTCCACCCATGCTAG 0: 1
1: 0
2: 5
3: 45
4: 456
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056592_1172056600 -4 Left 1172056592 20:32158537-32158559 CCCCTCCACCCATGCTAGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056590_1172056600 -1 Left 1172056590 20:32158534-32158556 CCACCCCTCCACCCATGCTAGCC 0: 1
1: 0
2: 2
3: 51
4: 510
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056595_1172056600 -6 Left 1172056595 20:32158539-32158561 CCTCCACCCATGCTAGCCGGGTC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056594_1172056600 -5 Left 1172056594 20:32158538-32158560 CCCTCCACCCATGCTAGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056596_1172056600 -9 Left 1172056596 20:32158542-32158564 CCACCCATGCTAGCCGGGTCACT 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172056600 Original CRISPR CGGGTCACTCCCACTCCACT CGG Intronic