ID: 1172056600

View in Genome Browser
Species Human (GRCh38)
Location 20:32158556-32158578
Sequence CGGGTCACTCCCACTCCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 611}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172056596_1172056600 -9 Left 1172056596 20:32158542-32158564 CCACCCATGCTAGCCGGGTCACT 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056587_1172056600 2 Left 1172056587 20:32158531-32158553 CCCCCACCCCTCCACCCATGCTA 0: 1
1: 0
2: 6
3: 76
4: 759
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056590_1172056600 -1 Left 1172056590 20:32158534-32158556 CCACCCCTCCACCCATGCTAGCC 0: 1
1: 0
2: 2
3: 51
4: 510
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056588_1172056600 1 Left 1172056588 20:32158532-32158554 CCCCACCCCTCCACCCATGCTAG 0: 1
1: 0
2: 5
3: 45
4: 456
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056589_1172056600 0 Left 1172056589 20:32158533-32158555 CCCACCCCTCCACCCATGCTAGC 0: 1
1: 0
2: 2
3: 42
4: 371
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056592_1172056600 -4 Left 1172056592 20:32158537-32158559 CCCCTCCACCCATGCTAGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056586_1172056600 5 Left 1172056586 20:32158528-32158550 CCTCCCCCACCCCTCCACCCATG 0: 1
1: 3
2: 25
3: 322
4: 2572
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056595_1172056600 -6 Left 1172056595 20:32158539-32158561 CCTCCACCCATGCTAGCCGGGTC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611
1172056594_1172056600 -5 Left 1172056594 20:32158538-32158560 CCCTCCACCCATGCTAGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 70
Right 1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG 0: 1
1: 0
2: 0
3: 29
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172056600 Original CRISPR CGGGTCACTCCCACTCCACT CGG Intronic
900815297 1:4839081-4839103 TGGGTCACTCCCACTACATGTGG + Intergenic
901154480 1:7126170-7126192 TGGGTCCCTCCCACAACACTGGG + Intronic
901440946 1:9277993-9278015 CGGGTCTCTCCCACAACACTTGG + Intergenic
901464370 1:9411895-9411917 CGGGTCTCTCCCACAACACGTGG - Intergenic
901767753 1:11514724-11514746 CGGGTCACACCCTCTACCCTGGG + Intronic
902366878 1:15981441-15981463 CGGGTCCCTCCCACAACACGTGG + Intergenic
902570732 1:17345530-17345552 TGGGTCCCTCCCACAACACTTGG - Intronic
904276591 1:29388803-29388825 CGGGTCCCTCCCACGACACATGG + Intergenic
904863285 1:33556701-33556723 CGGGTCTCTCCCACAACACGTGG - Intronic
905482987 1:38274537-38274559 CGGGTCCCTCCCACAACACATGG + Intergenic
906194282 1:43920330-43920352 GGGGTCCCTGCCACTCCCCTAGG + Intronic
906818302 1:48902118-48902140 CAGGTCCCTCCCACAACACTTGG + Intronic
906921355 1:50067985-50068007 CGGGTCTCTCCCACAACACGTGG + Intronic
907326907 1:53644197-53644219 CGGGTCACCCTCCCTCCACTTGG + Intronic
907479903 1:54738302-54738324 CGGGTCCCTCCCACAACACATGG + Intronic
907519123 1:55011840-55011862 TGGGGCACCCCCTCTCCACTGGG + Intergenic
907684997 1:56601818-56601840 CGGGTCCCTCCCACAACACATGG - Intronic
907956525 1:59233295-59233317 CGGGTCCCTCCCACAACACATGG - Intergenic
908047482 1:60185992-60186014 CAGGTCACTCCCACAACACATGG + Intergenic
908387799 1:63659062-63659084 CGGGTCCCTCCCACAACACTTGG + Intronic
908638233 1:66191955-66191977 CGGGTCCCTCCCACAACACTTGG + Intronic
909573645 1:77147271-77147293 CGGGTCCCTCCCACAACACATGG + Intronic
909953863 1:81753407-81753429 CGGGTCCCTCCCACAACACGTGG + Intronic
909956623 1:81786937-81786959 CGGGTCCCTCCCACAACACGTGG - Intronic
911331817 1:96533144-96533166 CGGGTCCCTCCCACAACACGTGG - Intergenic
911361374 1:96881406-96881428 CAGGTCCCTCCCACTACACGTGG + Intergenic
911391961 1:97256391-97256413 CGGGTCCCTCCCACAACACATGG - Intronic
911411826 1:97519428-97519450 CGGGTCCCTCCCACAACACATGG + Intronic
911515664 1:98865780-98865802 CGGGTCCCTCCCACTCACATAGG + Intergenic
912165798 1:107040678-107040700 CGGGTCCCTCCCACAACACATGG - Intergenic
912383941 1:109262045-109262067 CTGGGCATTCCCACCCCACTGGG + Intronic
915047391 1:153029826-153029848 CGGGTCCCTCCCACAACACGTGG + Intergenic
915210946 1:154308886-154308908 CAGGTCACTCCCACAACACGAGG - Intergenic
917505825 1:175625946-175625968 CGGGTCCCTCCCACAACACTTGG - Intronic
918696555 1:187552486-187552508 CGGGTCCCTCCCACAACACGTGG + Intergenic
918931559 1:190861662-190861684 CGGGTCACTCCCACAACACCTGG + Intergenic
919279039 1:195462723-195462745 CAGGTCCCTCCCACAACACTTGG + Intergenic
919460706 1:197873198-197873220 CGGGTCCCTCCCACAACACATGG + Intergenic
920784562 1:209028498-209028520 CGGGTCTCTCCCGCAACACTTGG - Intergenic
921424203 1:214983765-214983787 CGGGTCCCTCCCACAACACATGG - Intergenic
921510390 1:216021257-216021279 CGGGTCCCTCCCACAACACGTGG - Intronic
922367746 1:224881814-224881836 CAGGTCCCTCCCACAACACTGGG + Intergenic
923541046 1:234888415-234888437 TGGGTCCCTCCCACAACACTTGG - Intergenic
923687219 1:236161616-236161638 TGGGTCCCTCCCACAACACTTGG - Intronic
923919205 1:238545323-238545345 TGGGTCCCTCCCACACCACATGG + Intergenic
923949184 1:238927759-238927781 CGGGTCCCTCCCACAACACATGG + Intergenic
924430324 1:243990898-243990920 TGGGTCCCTCCCACAACACTTGG + Intergenic
1062859105 10:796099-796121 CAGGTCACTCCCACAACACGTGG - Intergenic
1064105538 10:12498103-12498125 CGGGTCCCTCCCACAACACATGG + Intronic
1064402018 10:15029393-15029415 CGGGTCCCTCCCACAACACGTGG + Intergenic
1064862929 10:19847065-19847087 CGGGTCCCTCCCACAACACTTGG + Intronic
1065265391 10:23970063-23970085 CAGGTCTCTCCCACACCACATGG + Intronic
1065602571 10:27384760-27384782 CGGGTCCCTCCCACATCACATGG - Intergenic
1065654499 10:27933968-27933990 CGGGTCTCTCCCACAACACGTGG - Intronic
1065852793 10:29804825-29804847 TGGGTCCCTCCCACAACACTTGG - Intergenic
1066281432 10:33922043-33922065 CGGGTCCCTCCCACAACACATGG - Intergenic
1067548949 10:47219774-47219796 CGGGTCCCTCCCACAACACATGG + Intergenic
1067749348 10:48959888-48959910 CTGGTCACTGGCCCTCCACTTGG - Intronic
1068243675 10:54337410-54337432 CGGGTCCCTCCCTCAACACTTGG - Intronic
1068487546 10:57678923-57678945 CGGGTCCCTCCCACAACACTTGG + Intergenic
1068598269 10:58927595-58927617 CGGGTCCCTCCCACAACACGTGG + Intergenic
1068908437 10:62352459-62352481 TGGGTCCCTCCCACAACACTTGG + Intergenic
1069068452 10:63970456-63970478 CAGGTCCCTCCCACAACACTTGG + Intergenic
1069332593 10:67310808-67310830 CGGGTCCCTCCCACCACACATGG + Intronic
1069773245 10:70912506-70912528 CGGGTCCCTCCCACCACACATGG + Intergenic
1070389731 10:75959009-75959031 CGGGTCTCTCCCACAACACATGG + Intronic
1070438126 10:76413562-76413584 CGGGTCCCTCCCACAACACATGG + Intronic
1070940771 10:80344598-80344620 TGGGTCCCTCCCACAACACTTGG - Intronic
1071723338 10:88169638-88169660 TGGGTCACTCCCACGACACATGG + Intergenic
1072550806 10:96475799-96475821 TGGGTCCCTCCCACAACACTTGG - Intronic
1073571342 10:104583311-104583333 CGGGTCCCTCCCACAACACAAGG - Intergenic
1073859627 10:107722885-107722907 CGGGTCCCTCCCACAACACATGG - Intergenic
1074337113 10:112589228-112589250 CGGGTCCCTCCCACAACACGTGG - Intronic
1074411751 10:113234661-113234683 CGGGTCACTCCCATGACACATGG - Intergenic
1074447239 10:113530584-113530606 CGGGTCACTCACACTGCTCTGGG - Intergenic
1074960028 10:118435925-118435947 TGGGTCCCTCCCACAACACTTGG - Intergenic
1075048568 10:119165465-119165487 CGGGTCAGCCCGACTCCACGCGG + Intronic
1075225606 10:120626101-120626123 CGGGTCCCTCCCACAACACGTGG + Intergenic
1075509146 10:123055400-123055422 CGGGTCCCTCCCACAACACATGG + Exonic
1076210889 10:128644059-128644081 CGGGCCGCTCCCACAACACTTGG - Intergenic
1078410754 11:11115251-11115273 CGGGTCCCTCCCACAACACATGG - Intergenic
1078452929 11:11453603-11453625 CGGGTCCCTCCCACAACACATGG - Intronic
1078601973 11:12740753-12740775 CAGGTCACTCCCACGACACATGG + Intronic
1079260430 11:18873325-18873347 GGGATCACGCCCACTCCTCTAGG - Intergenic
1079341218 11:19613162-19613184 TGGGTCTCTCCCACAACACTTGG + Intronic
1079559312 11:21803087-21803109 TGGGTCACTCCCACAACACGTGG + Intergenic
1079715628 11:23740043-23740065 TGGGTCTCTCCCACTACACGTGG - Intergenic
1080252372 11:30248107-30248129 CGGGTCCCTCCCACAACACGTGG + Intergenic
1080903846 11:36521288-36521310 CGGGTCCCTCCCACAACACATGG - Intronic
1081137077 11:39451519-39451541 CAGGTCTCTCCCACAACACTCGG + Intergenic
1083582045 11:63831282-63831304 TGGCTCACTCCAACTCCACTAGG - Intergenic
1083849108 11:65355017-65355039 CCGGTCACTCCCCCTCGACCCGG - Intronic
1084178180 11:67434124-67434146 CCGGTCACTCCCTCTGCCCTGGG - Intronic
1084221287 11:67681351-67681373 CAGGTCACTCCCACCACACATGG + Intergenic
1084519912 11:69656792-69656814 CGGGTCCCTCCCACAACACGTGG + Intronic
1084546365 11:69817067-69817089 CGGGTCTCACCCACTCCCCAGGG + Intronic
1084720811 11:70904471-70904493 CGGGTCCCTCCCACAACAGTGGG - Intronic
1084894090 11:72252652-72252674 CGGGTCTCTCCCACAACACGTGG - Intergenic
1085702330 11:78756240-78756262 TTGGTCACTCCCAGTCCACTAGG - Intronic
1086750584 11:90489128-90489150 CGGGTCCCTCCCATTATACTTGG - Intergenic
1087659140 11:100965189-100965211 TGGGTCCCTCCCACAACACTTGG + Intronic
1088531236 11:110811987-110812009 CAGGTCACTCCCACAGCACGTGG + Intergenic
1088755510 11:112882119-112882141 TGGGTCACTGCAACTCCTCTGGG - Intergenic
1089042754 11:115469034-115469056 CGGGTCCCTCCCACAACACGTGG + Intronic
1089071622 11:115704387-115704409 CGGGTCCCTCCCACAACACATGG - Intergenic
1090978943 11:131699812-131699834 CAGGTCCCTCCCACTACACCTGG + Intronic
1092230479 12:6773149-6773171 CGGCTCACGCCCCCTCCCCTTGG + Intronic
1092874165 12:12833718-12833740 CGGGTCCCTCCCACAACACGTGG - Intergenic
1092945922 12:13453921-13453943 CGGGTCCCTCCCACAACACATGG - Intergenic
1095180525 12:39142838-39142860 CGGGTCCCTCCCACCACACGTGG - Intergenic
1095600487 12:44007678-44007700 TGGGTCCCTCCCACTACACATGG - Intronic
1098578608 12:72072187-72072209 TGGGTCCCTCCCACCACACTTGG + Intronic
1099442348 12:82713672-82713694 TGGGTCCCTCCCACAACACTTGG + Intronic
1099746745 12:86714439-86714461 CGGGTCCCTCCCACAACACGTGG - Intronic
1101565571 12:105901861-105901883 CTGGTCCCTCCCACAACACTTGG - Intergenic
1101975073 12:109350330-109350352 CGGGTCCCTCCCACAACACGAGG - Intronic
1102596994 12:114000543-114000565 CGGGTCTCTCCCACAACACATGG + Intergenic
1102627891 12:114250758-114250780 CGGGTCCCTCCCACAACACGTGG - Intergenic
1102758891 12:115367833-115367855 TGGGTCCCTCCCACAACACTTGG - Intergenic
1102875323 12:116444412-116444434 TGGGTCCCTCCCACAACACTTGG - Intergenic
1103026006 12:117574620-117574642 CGGGTCCCTCCCACAACACGTGG + Intronic
1103226217 12:119290361-119290383 CGGGTCCCTCCCACAACACATGG + Intergenic
1103604113 12:122074352-122074374 CGGGTCCCTCCCACAACACATGG + Intergenic
1104068117 12:125322128-125322150 CGGGTCCCTCCCACGACACGTGG - Intronic
1104128872 12:125873619-125873641 TGGGTCCCTCCCACAACACTTGG - Intergenic
1104719463 12:131037078-131037100 CGGGTCTCACTCACTGCACTGGG + Intronic
1104719552 12:131037660-131037682 CGGGTCTCACTCACTGCACTGGG + Intronic
1104742633 12:131189591-131189613 TGGGTCCCTCCCACAACACTTGG + Intergenic
1104804521 12:131576736-131576758 TGGGTCACACTCACTGCACTGGG - Intergenic
1104804530 12:131576804-131576826 CGGGTCACACTCACTGCACTGGG - Intergenic
1104804535 12:131576838-131576860 CGGGTCACACTCACTGCACTGGG - Intergenic
1104804545 12:131576903-131576925 CGGGTCACACTCACTGCACCTGG - Intergenic
1104804555 12:131576971-131576993 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804561 12:131577005-131577027 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804567 12:131577039-131577061 CGGGTCACACTCACTGCACCTGG - Intergenic
1104804572 12:131577073-131577095 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804578 12:131577107-131577129 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804584 12:131577141-131577163 CGGGTCACACTCACTGCACCTGG - Intergenic
1104804589 12:131577175-131577197 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804595 12:131577209-131577231 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804601 12:131577243-131577265 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804607 12:131577277-131577299 CGGGTCACACTCACTGCACCTGG - Intergenic
1104804617 12:131577345-131577367 CGGGTCACACTCACTGCACCGGG - Intergenic
1104804623 12:131577379-131577401 CGGGTCACACTCACTGCACCTGG - Intergenic
1104804628 12:131577413-131577435 CGGGTCACACTCACTGCACCGGG - Intergenic
1105285648 13:19001291-19001313 CGGATCACTCCCACAACACATGG + Intergenic
1106107546 13:26746672-26746694 CATCTCACTCCCCCTCCACTGGG - Intergenic
1106678451 13:31985517-31985539 CAGGTCCCTCCCACAACACTTGG - Intergenic
1107988263 13:45794509-45794531 CGGGTCCCTCCCACAACACATGG - Intronic
1109136552 13:58658459-58658481 CGGGTCCCTCCCACAACACATGG - Intergenic
1109478355 13:62914998-62915020 CGGGTCCCTCCCACAACACAGGG + Intergenic
1110340653 13:74386024-74386046 CGGGTCCCTCCCACAACACATGG + Intergenic
1110924458 13:81132456-81132478 CGGGTGCCTCCCACAACACTTGG - Intergenic
1111115582 13:83772879-83772901 CGGGTCCCTCCCACAACACGTGG + Intergenic
1111527203 13:89488311-89488333 TGGGTCACTCCCACAACACATGG - Intergenic
1111911873 13:94322082-94322104 CGGGTCCCTCCCACAACACGTGG - Intronic
1112033886 13:95480216-95480238 CGGGTCCCTCCCACGACACATGG + Intronic
1112405879 13:99119832-99119854 CGGGTCCCTCCCACAGCACATGG - Intergenic
1112626602 13:101111603-101111625 CGGGTCCCTCCCACGACACATGG - Intronic
1112879502 13:104088331-104088353 CGGGTCCCTCCCACAACACGTGG + Intergenic
1112979047 13:105358664-105358686 TGGGTCCCTCCCACAACACTTGG - Intergenic
1112996055 13:105576067-105576089 CGGGTCCCTCCCACAACACATGG - Intergenic
1113572554 13:111369232-111369254 CGGGTCCCTCCCACAACACGTGG + Intergenic
1113617508 13:111691382-111691404 CGGGTCTCCCCCAGGCCACTTGG - Intergenic
1113623038 13:111776642-111776664 CGGGTCTCCCCCAGGCCACTTGG - Intergenic
1113904579 13:113813260-113813282 CCAGTCACTCCCTCTCCCCTCGG + Exonic
1115166788 14:30457501-30457523 CGGTTCCCTCCCACAACACTTGG + Intergenic
1115541839 14:34428099-34428121 TGGGTCCCTCCCACTACACGTGG - Intronic
1115609352 14:35036512-35036534 CAGGTCACTCCCACAACACGTGG + Intergenic
1115840440 14:37463311-37463333 CGGGTCCCTCCCACAACACATGG + Intronic
1115863228 14:37712774-37712796 CGGGTCCCTCCCACAACACATGG + Intronic
1116116209 14:40654282-40654304 TGGGTCCCTTCCACTACACTTGG + Intergenic
1116127189 14:40802178-40802200 CAGGTCCCTCCCACTACACGTGG + Intergenic
1116339897 14:43709104-43709126 CGGGTCCCTCCCACCACACATGG - Intergenic
1116887559 14:50235877-50235899 CGGGTCCCTCCCATGACACTTGG + Intergenic
1117083929 14:52180103-52180125 CGGGTCCCTCCCACAACACGTGG - Intergenic
1117701355 14:58416965-58416987 CAGGTCCCTCCCACAACACTTGG - Intronic
1117920431 14:60722329-60722351 GGGGGCGCTCCCACCCCACTGGG - Intronic
1118401100 14:65380327-65380349 CGGGTCCCTCCCACAACACATGG + Intergenic
1118485979 14:66214910-66214932 CGGGTCCCTCCCACAACACATGG + Intergenic
1118663495 14:68041021-68041043 CAGGTCCCTCCCACAACACTGGG - Intronic
1118964847 14:70571269-70571291 CGGGTCCTTCCCACACCACATGG - Intergenic
1119454838 14:74745962-74745984 CGGGTCTCTCCCACAACACATGG + Intergenic
1119783358 14:77294249-77294271 CGGGTCCCTCCCACAACACGTGG - Intronic
1120022436 14:79545906-79545928 CGGGTCCCTCCCACAACACATGG - Intronic
1120586708 14:86320652-86320674 CGGGTCCCTCCCACTACATGTGG + Intergenic
1120680903 14:87479496-87479518 CGGGTCCCTCCCACAACACATGG + Intergenic
1120909774 14:89655824-89655846 CGGGTCCCTCCCACAACACATGG - Intergenic
1121221230 14:92287106-92287128 CGGGTCCCTCCCACAACACGTGG - Intergenic
1121480646 14:94268832-94268854 CGGGTCCCTCCCACAACACATGG + Intronic
1121697366 14:95924746-95924768 CGGGTCCCTCCCACAACACATGG + Intergenic
1122808297 14:104272984-104273006 CGGGTCTCTCCCACAACACATGG - Intergenic
1123061743 14:105597664-105597686 CGGGCCACTCACGCTCCACCAGG - Intergenic
1123086481 14:105719395-105719417 CGGGCCACTCACGCTCCACCAGG - Intergenic
1128133214 15:65244568-65244590 CGGGTCCCTCCCACAACACATGG + Intronic
1128688988 15:69708917-69708939 CGGGTCCCTCCCACAACACTTGG + Intergenic
1128874846 15:71193605-71193627 CGGGTCCCTCCCACAGCACGTGG - Intronic
1130181766 15:81636979-81637001 CGGGTCCCTCCCACAACACGTGG - Intergenic
1130417040 15:83703459-83703481 CGGGTCCCTCCCACAACACATGG - Intronic
1130997127 15:88910148-88910170 CTGGACACTCCCAGGCCACTTGG - Intronic
1131355008 15:91737503-91737525 CGGGTCCCTCCCACAACACGTGG - Intergenic
1132020009 15:98352735-98352757 CGGGTCCCTCCCACAACACATGG + Intergenic
1133410672 16:5565899-5565921 CGGGTCCCTCCCACAACACATGG - Intergenic
1134233786 16:12449939-12449961 CGGGTCCCTCCCACAACACGTGG - Intronic
1134305513 16:13028602-13028624 CGGGTCCCTCCCACAACATTTGG + Intronic
1134332175 16:13261084-13261106 TGGGTCCCTCCCACAACACTTGG + Intergenic
1134340758 16:13343451-13343473 CAGGTGACTCCCACACCACATGG - Intergenic
1134841232 16:17403644-17403666 CGGGTCCCTCCCACAACACGTGG + Intronic
1135314575 16:21433684-21433706 CGGGTCCCTCCCACGACACATGG - Intronic
1135367498 16:21865964-21865986 CGGGTCCCTCCCACGACACATGG - Intronic
1135444316 16:22505198-22505220 CGGGTCCCTCCCACGACACATGG + Intronic
1135953480 16:26936736-26936758 CAGGTCACTCCCACAACACAGGG - Intergenic
1135979073 16:27132593-27132615 TGGGTCCCTCCCACTACACATGG - Intergenic
1136324688 16:29514162-29514184 CGGGTCCCTCCCACGACACATGG - Intergenic
1136439373 16:30254147-30254169 CGGGTCCCTCCCACGACACATGG - Intronic
1136663122 16:31783110-31783132 TGGGTCACTCCCACAACACATGG + Intronic
1137002324 16:35240110-35240132 AGGGTCGCTCCCACCACACTTGG - Intergenic
1137016235 16:35378306-35378328 CAGGTCCCTCCCACAACACTTGG - Intergenic
1137025093 16:35466067-35466089 TGGGTCCCTCCCACAACACTTGG - Intergenic
1139297581 16:65916668-65916690 CGGGTCCCTCCCACAACACATGG + Intergenic
1139299506 16:65933398-65933420 TGGGTCTCTCCCACAACACTTGG - Intergenic
1139580577 16:67871487-67871509 CAGTTCTCTCCCACTCCACAGGG + Exonic
1139804752 16:69555148-69555170 CGGGTCCCTCCCACAACACGTGG + Intergenic
1139858760 16:70003297-70003319 CGGGTCCCTCCCACGACACATGG - Intergenic
1142490797 17:278112-278134 TGGGTCCCTCCCACAACACTTGG - Intronic
1142842949 17:2648258-2648280 CGGGTCCCTCCCACCACACGTGG + Intronic
1142995078 17:3755283-3755305 TGGGTCCCTCCCACTCATCTGGG - Intronic
1143913013 17:10267472-10267494 CGGGTCCCTCCCACAACACATGG + Intergenic
1143915757 17:10291685-10291707 CGGGTCCCTCCCACAACACGTGG - Intergenic
1144624884 17:16839533-16839555 CTGGTCACTCCCATTCTCCTCGG + Intergenic
1144784773 17:17825418-17825440 CAGGTCACACCCCCTCCTCTTGG - Intronic
1144881546 17:18433188-18433210 CTGGTCACTCCCATTCTCCTCGG - Intergenic
1145150687 17:20511198-20511220 CTGGTCACTCCCATTCTCCTCGG + Intergenic
1145333378 17:21891745-21891767 CGGGTCCATTCCATTCCACTGGG - Intergenic
1145358267 17:22183311-22183333 CGGGTCCCTCCCACAACACATGG - Intergenic
1145971844 17:28960770-28960792 CCAGGCACTCCCATTCCACTAGG + Intronic
1148284132 17:46372940-46372962 GGATTCACTCCCACTCCTCTGGG - Intergenic
1148306353 17:46590861-46590883 GGATTCACTCCCACTCCTCTGGG - Intronic
1148805551 17:50262116-50262138 CGTGCTACTCCCACCCCACTGGG + Intergenic
1150191446 17:63244781-63244803 TGGGTCCCTCCCACAACACTTGG - Intronic
1150623132 17:66823190-66823212 TGGGTCACCCCCACCCCACTGGG + Intergenic
1151195029 17:72425253-72425275 CAGGTCTCTCCCACAACACTGGG - Intergenic
1151197127 17:72439583-72439605 TGGGTCCCTCCCACAACACTTGG - Intergenic
1151218796 17:72596047-72596069 TGGGTCACTCCCACAACACGTGG + Intergenic
1151291132 17:73150934-73150956 CGGGTCCCTCCCACAACACGTGG + Intergenic
1151728413 17:75897269-75897291 CGGGTCCATCCCACCCCCCTGGG + Intergenic
1151981696 17:77515002-77515024 CGGGTCCCTCCCACAACACGTGG + Intergenic
1152297235 17:79475193-79475215 CAGGTGCCTCCCTCTCCACTAGG + Intronic
1152348249 17:79768077-79768099 CGGGTCCCTCCCACGGCACGTGG + Intergenic
1152376204 17:79920100-79920122 CGGGGCACCCCCGCCCCACTCGG - Intergenic
1152417167 17:80170160-80170182 CCGGCCCCTCCCACTCCCCTGGG - Intronic
1153272196 18:3333791-3333813 CGGGTCCCTCCCACAACACATGG + Intergenic
1153288303 18:3476714-3476736 CGGGTCCCTCCCACAACACGTGG + Intergenic
1153427020 18:4976037-4976059 CGGGTCCCTCCCACAACACATGG + Intergenic
1153775036 18:8445310-8445332 CGGGTCCCTCCCACAACACGTGG + Intergenic
1154977658 18:21474965-21474987 CGGGTCCCTCCCACAACACATGG + Intronic
1155686286 18:28555869-28555891 CGGGTCCCTCCCACAACACATGG - Intergenic
1155767004 18:29648703-29648725 CAGGTCCCTCCCACTACACGTGG - Intergenic
1155780167 18:29821277-29821299 CGGGTCCCTCCCACAACACATGG + Intergenic
1155840034 18:30632444-30632466 TGGCTCACTCCCACTCCAGGTGG + Intergenic
1155842772 18:30667383-30667405 CGGGTTCCTCCCACTACACATGG + Intergenic
1156254452 18:35381781-35381803 CGGGTCCCTCCCACAACACATGG + Intergenic
1158611470 18:58944501-58944523 CTGGCCACTCCCACACCCCTGGG + Intronic
1159327949 18:66948669-66948691 CGGGTCCCTCCCACAACACATGG + Intergenic
1159381018 18:67659298-67659320 CGGGTCCCTCCCACAACACATGG - Intergenic
1159734458 18:72076595-72076617 CAGGTCCCTCCCACAACACTGGG + Intergenic
1159895295 18:73990433-73990455 CGGGTCCCTCCCACAACACGTGG + Intergenic
1160010532 18:75104295-75104317 CGGGTCCCTCCCACAACACGTGG + Intergenic
1160331255 18:77993836-77993858 CGGGTCCCTCCCACCACACGTGG + Intergenic
1160342060 18:78097781-78097803 CGGGTCCCTCCCACAACACATGG + Intergenic
1161301828 19:3546442-3546464 GGGGTCAGGCCCACACCACTGGG + Intronic
1161576826 19:5059034-5059056 CGGGTCCCTCCCACTGCAGCCGG + Intronic
1162296443 19:9817065-9817087 CGGGTCCCTCCCACAACACGTGG + Intronic
1162302519 19:9852020-9852042 GGGGGCACTCCCACTCCTCCTGG - Intergenic
1163472050 19:17503175-17503197 CGGGTCCCTCCCACAACACGTGG + Intronic
1164447268 19:28328628-28328650 CGGGTCCCTCCCACAACACCTGG - Intergenic
1164863012 19:31577993-31578015 CGGGTCCCTCCCACAACACGTGG - Intergenic
1164932316 19:32185304-32185326 TGGGTCCCTCCCACAACACTTGG + Intergenic
1165057811 19:33189639-33189661 CAGGTCCCTCCCACAACACTTGG + Intronic
1166018948 19:40007312-40007334 CCAGGCACTCCCACTCCTCTTGG - Exonic
1166032136 19:40139759-40139781 GGGCTCACTCACACTCCTCTGGG - Intergenic
1166170073 19:41022069-41022091 CGGGTCCCTCCCACAACACGTGG + Intergenic
1166643804 19:44516383-44516405 CAGGTCCCTCCCACAACACTTGG - Intronic
1166988252 19:46675158-46675180 AGGGTCACTCCTCCTCCAATAGG + Intronic
1168451765 19:56471904-56471926 CGGGTCCCTCCCACAACACGTGG - Exonic
1168495985 19:56851846-56851868 TGGGTCCCTCCCACAGCACTTGG - Intergenic
925473499 2:4188043-4188065 CGGGTCCCTCCCACAACACGTGG - Intergenic
926923704 2:17965242-17965264 TGGGTCCCTCCCACAACACTTGG - Intronic
926979203 2:18549260-18549282 CGGGTCCCTCCCACAACACATGG - Intergenic
927255807 2:21040003-21040025 CGGGTCCCTCCCACAACACGTGG - Intronic
928104155 2:28456981-28457003 CGGGTCCCTCCCACAACACGTGG - Intergenic
928282307 2:29959024-29959046 CGGGTCCCTCCCACAACACGTGG + Intergenic
928594113 2:32844304-32844326 CGGGTCCCTCCCACAACACATGG - Intergenic
929047924 2:37808478-37808500 CGGGTCCCTCCCACAACACCTGG - Intergenic
929688992 2:44059192-44059214 CGGGTCCCTCCCACGACACATGG + Intergenic
930063740 2:47311683-47311705 CGGGTCCCTCCCACAACACGTGG - Intergenic
931039692 2:58283657-58283679 TGGGTCCCTCCCACTACACATGG - Intergenic
931202834 2:60116775-60116797 CGGGTCCCTCCCACAACACATGG + Intergenic
931795796 2:65708712-65708734 TGGGTCCCTCCCACTACACCTGG + Intergenic
931861443 2:66358945-66358967 CGGGTCCCTCCCCCAACACTGGG + Intergenic
932871264 2:75400984-75401006 CGGGTCCCTCCCACAACACATGG - Intergenic
934106791 2:88702628-88702650 CAGGTCACTCCCACAACACATGG + Intronic
935126772 2:100231200-100231222 CGGGTCCCTCCCACAACACGTGG - Intergenic
935608492 2:104995462-104995484 CGGGTCCCTCCCACAACACATGG + Intergenic
936344804 2:111667290-111667312 CGGGTCCCTCCCACAACACGTGG + Intergenic
936595745 2:113845834-113845856 CGGGTCCCTCCCACAACACATGG - Intergenic
938118165 2:128616089-128616111 CGGGTCCCTCCCCCAACACTGGG - Intergenic
938979021 2:136507999-136508021 CAGGTGACCACCACTCCACTTGG - Intergenic
939272743 2:139960725-139960747 CGGGTCCCTCCCACAACACATGG - Intergenic
939374647 2:141348792-141348814 CAGGTCCCTCCCACAGCACTTGG - Intronic
939688076 2:145224248-145224270 CGGGTCCCTCCCACAACACATGG - Intergenic
939760157 2:146165673-146165695 CGGGTCCCTCCCATGACACTTGG + Intergenic
939805535 2:146771748-146771770 CTGGTCCCTCCCACTACACGTGG + Intergenic
940793134 2:158049004-158049026 GGGCTCACACCCACTGCACTGGG - Intronic
941536136 2:166723998-166724020 TGGGTCCCTCCCACTACACATGG + Intergenic
942885343 2:180916686-180916708 CGGGTCCCTCCCACAACACGTGG - Intergenic
943033023 2:182708252-182708274 CGGGTCCCTCCCACAACACGTGG + Intergenic
943123952 2:183773058-183773080 CGGGTCCCTCCCACAACACGTGG - Intergenic
943251388 2:185524625-185524647 TGGGTCCCTCCCACAACACTTGG - Intergenic
943348894 2:186773910-186773932 CGGGTCCCTCCCACAACACGTGG + Intergenic
944250375 2:197575044-197575066 TGGGTCACTCCCACAACACTTGG - Intronic
945915568 2:215700641-215700663 CTGCTCACTCCCACTGCATTGGG + Intergenic
946060966 2:216941273-216941295 CAGGTCCCTCCCTCTACACTTGG + Intergenic
946476906 2:220015870-220015892 TGGGTCCCTCCCACAACACTTGG - Intergenic
946757405 2:222961774-222961796 TGGGTCACTGCCACAACACTTGG - Intergenic
947109893 2:226707537-226707559 TGGGTCCCTCCCACAACACTTGG + Intergenic
947617170 2:231565626-231565648 TGGGGCAGCCCCACTCCACTAGG - Intergenic
948017500 2:234702190-234702212 CGGGTCCCTCCCACAGCACATGG - Intergenic
948092554 2:235306745-235306767 CGGGTCCCTCCCACAACACGTGG + Intergenic
948214905 2:236221415-236221437 CGGGTCCCTCCCACAACACATGG - Intronic
948346395 2:237302482-237302504 CGGGTCCCTCCCACAACACATGG - Intergenic
1170398267 20:15951964-15951986 CGGGTCCCTCCCACTACATGTGG - Intronic
1170817724 20:19729022-19729044 CGGGTTCCTCCCACAACACTTGG - Intergenic
1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG + Intronic
1173843445 20:46173970-46173992 CGGGTCACAGCCACTTCTCTGGG + Exonic
1174703137 20:52629563-52629585 TGGGTCCCTCCCACTACACACGG - Intergenic
1174734511 20:52952838-52952860 CGGGTCCCTCCCATGACACTTGG + Intergenic
1174833223 20:53832988-53833010 CGGGTCCCTCCCACGACACATGG + Intergenic
1174960713 20:55154142-55154164 CGGGTCCTTCCCACTACACATGG - Intergenic
1175260673 20:57672379-57672401 CGGTTCACTTCCCCTCCCCTGGG - Intronic
1175337203 20:58204440-58204462 CGGGTCCCTCCCACAACACGTGG - Intergenic
1175357686 20:58381881-58381903 CGGGTCCCTCCTACGACACTTGG + Intergenic
1175546691 20:59782744-59782766 TGGGTCCCTCCCACAACACTTGG + Intronic
1176932783 21:14832887-14832909 CAGGTCCCTCCCCCACCACTGGG + Intergenic
1177039079 21:16083752-16083774 CGGGTCCCTCCCACAACACTCGG + Intergenic
1177258359 21:18694303-18694325 TGGGTCCCTCCCACTGCACGTGG + Intergenic
1177477504 21:21643669-21643691 CAGGTCGCTCCCACAACACTTGG - Intergenic
1177831505 21:26144211-26144233 CTGGTCCCTCCCACTACACATGG + Intronic
1177839124 21:26217128-26217150 CGGGTCCCTCCCACAACACGTGG - Intergenic
1178102233 21:29282052-29282074 CGGGTCCCTCCCACTACACGTGG + Intronic
1178111470 21:29374163-29374185 CGGGTCCCTCCCACAACACATGG + Intronic
1178348545 21:31852686-31852708 CGGGTCCCTCCCACAACACATGG - Intergenic
1178384711 21:32139712-32139734 CTGGTCCCTCCCACAACACTTGG - Intergenic
1182889025 22:33800982-33801004 CGGGTCCCTCCCACAACACATGG - Intronic
1182951709 22:34382083-34382105 CGGGTCCCTCCCACAACACGTGG - Intergenic
1183151432 22:36040847-36040869 CAGGTCCCTCCCACAACACTTGG + Intergenic
1184591517 22:45486980-45487002 CGGGTCCCTCCCACAACACATGG + Intergenic
1185124454 22:48999592-48999614 AGGGTCCCTCCCACAACACTTGG + Intergenic
1185155055 22:49188482-49188504 CGGGCCACTCCCACAACACGTGG + Intergenic
949148363 3:732339-732361 CCGGGTACTCCCACTACACTTGG + Intergenic
949994993 3:9609500-9609522 CGGGTCCCTCCCACAACACGTGG + Intergenic
950152057 3:10695399-10695421 CGGGTCCCTCCCACAACACATGG + Intronic
950480212 3:13239218-13239240 CGGCTCAGTCCCAGTCCACTGGG + Intergenic
953503889 3:43463885-43463907 CGGGTCCCTCCCACAACACATGG - Intronic
953786765 3:45916980-45917002 CGGGTCAGTCCCAGTGCCCTGGG - Intergenic
953898143 3:46819950-46819972 CGGGTCTCTCCCACAACACGTGG - Intergenic
954480655 3:50797002-50797024 CAGGTCACTTACACTCCAATTGG + Intronic
954738995 3:52731842-52731864 CGGGTCCCTCCCACGACACGTGG - Intronic
955039038 3:55297032-55297054 CGGGTCCCTCCCACAACACATGG + Intergenic
956096793 3:65724907-65724929 TGGGTCCCTCCCACAACACTCGG + Intronic
956379118 3:68647317-68647339 CGGGTCCCTCCCACCACACTTGG - Intergenic
956558689 3:70550304-70550326 CGGGTCCCTCCCACAACACGTGG + Intergenic
956560601 3:70570164-70570186 CGGGTCCCTCCCACAACACGTGG + Intergenic
957114062 3:76002371-76002393 CGGGTCCCTCCCACAACACACGG - Intronic
957476996 3:80738657-80738679 CGGGTCCCTCCCACCACACACGG + Intergenic
957870196 3:86082399-86082421 CGGGTCCCTCCCACAACACGTGG + Intergenic
957961357 3:87257566-87257588 CTGGTCCCTCCCACTACACGTGG + Intergenic
958910992 3:99994898-99994920 CGGGTCCCTCCCACAACACATGG + Intronic
959174041 3:102882635-102882657 CGGGTCCCTCCCACAACACATGG - Intergenic
960217354 3:115058121-115058143 CGGGTCCCTCCCACAACACGGGG + Intronic
960496582 3:118382971-118382993 CGGGTCCCTCCCACAACACGTGG - Intergenic
962509616 3:136085168-136085190 CTGGTCCCTCCCATTTCACTTGG - Intronic
962991695 3:140583155-140583177 TGGGTCAGTCCCACTAAACTAGG + Intergenic
963022642 3:140886809-140886831 CGGGTCCCTCCCACAACACGTGG - Intergenic
963311483 3:143714876-143714898 CGGGTCCCTCCCACAACACATGG - Intronic
963477450 3:145824854-145824876 CGGGTCCCTCCCACAACACATGG - Intergenic
963816522 3:149837696-149837718 CGGGTCCCTCCCACAACACATGG + Intronic
964095515 3:152926938-152926960 CGGGTCCCTCCCACAACACGTGG - Intergenic
964107742 3:153056922-153056944 CGGGTCCCTCCCACCACACATGG + Intergenic
964427530 3:156569070-156569092 CGGGTCCCTCCCACAACACATGG - Intergenic
964588247 3:158331108-158331130 TGGGTCCCTCCCACAACACTTGG + Intronic
965434183 3:168626915-168626937 CGGGTCCCTCCCACAACACCTGG - Intergenic
965915822 3:173844184-173844206 GGGGTCCCTCCCACACCACATGG + Intronic
965969043 3:174530754-174530776 CGGGTCCCTCCCACAACACGTGG + Intronic
966720903 3:183061909-183061931 CGGGTCCCTCCCACCACACATGG - Intronic
967137973 3:186528589-186528611 CGGGTCCCTCCCACAACACATGG + Intergenic
968937414 4:3618907-3618929 CAGGTCCCTCCCACACTACTTGG + Intergenic
969075411 4:4574311-4574333 TGGGTCCCTCCCACGACACTGGG - Intergenic
969079015 4:4603785-4603807 CGGGTCCCTCCCACAACACGTGG + Intergenic
969963883 4:10974718-10974740 CGGGTCCCTCCCACGACACCTGG + Intergenic
970370055 4:15397162-15397184 CGGGTCCCTCCCACAACACATGG + Intronic
971299323 4:25428826-25428848 CGGGTCCCTCCCACAACACATGG + Intergenic
971453651 4:26823287-26823309 CGGGTCCCTCCCACAACACGTGG + Intergenic
972056082 4:34805382-34805404 CGGGTCTCTCCCACAACACATGG + Intergenic
973038686 4:45443067-45443089 CGGGTCCCTCCCACAACACCAGG - Intergenic
973851298 4:54963964-54963986 CGGGTCCCTCCCACAACACATGG - Intergenic
974205289 4:58695030-58695052 CGGGTCCCTCCCACAACACGTGG - Intergenic
974733472 4:65899063-65899085 CGGGTCCCTCCCACAACACATGG - Intergenic
975203895 4:71622986-71623008 CGGGTCCCTCCCACAACAATAGG + Intergenic
975665215 4:76728266-76728288 CGGGTCCCTCCCACAACACGTGG - Intronic
976311844 4:83620873-83620895 CGGGTCCCTCCCACCACACATGG - Intergenic
976727181 4:88226011-88226033 CGGGTCCCTCCCACAACACATGG + Intronic
979304680 4:119129076-119129098 CGGGTCCCTCCCACAACACATGG - Intergenic
980310854 4:131127238-131127260 TGGGTCCCTCCCACAACACTTGG + Intergenic
980532721 4:134074886-134074908 TGGGTCCCTCCCACTCTACATGG + Intergenic
980553048 4:134365595-134365617 TGGGTCTCTCCCACAACACTTGG - Intergenic
980824493 4:138057292-138057314 CGGGTCCCTCCCACAACACGTGG - Intergenic
981861340 4:149360539-149360561 TGGGTCCCTCCCACAACACTTGG - Intergenic
981997816 4:150993807-150993829 CGGGTCCCTCCCACAACACATGG + Intronic
982886314 4:160787576-160787598 TGGGTCCCTCCCACAGCACTTGG - Intergenic
982923539 4:161305571-161305593 CGGGTCCCTCCCACAACACATGG - Intergenic
983273583 4:165591393-165591415 CAGGTCCCTCCCACACCACATGG + Intergenic
983765394 4:171475131-171475153 TGGGTCCCTCCCACAACACTTGG - Intergenic
983880108 4:172923415-172923437 TGGGTCCCTACCACTACACTTGG + Intronic
984140872 4:176002340-176002362 CTGGTCACTCGCTCTCCTCTGGG - Intronic
984720563 4:182969291-182969313 CGGGTCCCTCCCACGACACAGGG + Intergenic
986105666 5:4657070-4657092 CGGGTCCCTCCCACACCACATGG + Intergenic
986892643 5:12327949-12327971 CGGGTCCCTCCCACAACACATGG - Intergenic
986895120 5:12356288-12356310 TGGGTCCCTCCCACAACACTTGG + Intergenic
987152467 5:15056618-15056640 CAGGTCAGTCCCACCCCTCTGGG - Intergenic
987435108 5:17884580-17884602 CGGGTCCCTCCCACAACACATGG - Intergenic
987680892 5:21134292-21134314 CAGGTCTCTCCCACAACACTTGG - Intergenic
987877155 5:23692641-23692663 CGGGTCTCTCCCACAACACGTGG - Intergenic
988037308 5:25843924-25843946 TGGGTCCCTCCCACTACACGAGG + Intergenic
988427540 5:31080714-31080736 CGGGTCCCTCCCACAACACGTGG + Intergenic
988507870 5:31839739-31839761 CAGGTCCCTCCCACTCCGCATGG - Intronic
989354856 5:40532129-40532151 CGGGTCCCTCCCACAACACATGG + Intergenic
989805757 5:45601918-45601940 CTGGTCTCTCCCACAACACTGGG - Intronic
990264720 5:54062408-54062430 CGGGTCTCTCCCACAACACATGG - Intronic
990287423 5:54313523-54313545 CGGGTCCCTCCCACAACACGTGG - Intergenic
990294753 5:54389619-54389641 TGGGTCACTCCCACTACATGTGG + Intergenic
990787425 5:59438091-59438113 CGGGTCCCTCCCACAACACATGG + Intronic
991039312 5:62159551-62159573 CGGTTCGCTCCCACAACACTTGG - Intergenic
994000534 5:94773836-94773858 CGGGTCCCTCCCACAACACATGG + Intronic
994386812 5:99142687-99142709 TGGGTCCCTCCCACAGCACTTGG - Intergenic
994590632 5:101768223-101768245 CGGGTCCCTCCCACAACACATGG + Intergenic
995761004 5:115561827-115561849 CGGGTCCCTCCCACAACACATGG + Intergenic
996073865 5:119165839-119165861 TGGGTCCCTCCCACAGCACTTGG + Intronic
996246455 5:121270666-121270688 TGGGTCACTCCCACAACACATGG + Intergenic
996396337 5:123017631-123017653 CGGGTCCCTCCCACAACACGAGG - Intronic
997593356 5:135089564-135089586 CAGGTCCCTCCCACTACACATGG - Intronic
998576515 5:143323482-143323504 CGGGTCCCTCCCACAACACATGG + Intronic
999061676 5:148642243-148642265 CCAGTGACTCCCCCTCCACTGGG - Intronic
999669245 5:153944443-153944465 CGGGTCCCTCCCACAACACATGG + Intergenic
1000357714 5:160416882-160416904 CCGGTCTCTCCCACAACACTTGG - Intronic
1000522694 5:162317835-162317857 CGGGTCCCTCCCACAACACATGG - Intergenic
1000728654 5:164803064-164803086 CAGGTCTCTCCCACAACACTTGG + Intergenic
1001922765 5:175613422-175613444 CAGGTCCCTCCCACACCACATGG + Intergenic
1002292574 5:178209860-178209882 CTGATCACTCCCACTCTCCTTGG - Intronic
1004592927 6:17070779-17070801 TGGGTCCCTCCCACAACACTTGG - Intergenic
1005704571 6:28438747-28438769 CGGGTCCCTCCCACGACACATGG + Intronic
1007630098 6:43268654-43268676 TGGGACACTTCCACTTCACTCGG + Intronic
1008681332 6:53876307-53876329 CGGGTCCCTCCCACAACACATGG + Intronic
1008768600 6:54951036-54951058 CGGGTCCCTCCCACAACACATGG - Intergenic
1009532976 6:64843892-64843914 CGGGTCCCTCCCACAACACGTGG - Intronic
1009604980 6:65856574-65856596 CGGGTCACTCCCATGACACATGG + Intergenic
1009626873 6:66146067-66146089 CGGGTCTCACCCACCCCACATGG + Intergenic
1010374308 6:75148862-75148884 TGGGTCCCTCCCACAACACTTGG - Intronic
1010408652 6:75535536-75535558 CGGGTCCCTCCCACAACACGTGG + Intergenic
1010712955 6:79196380-79196402 CTGGTCCCTCCCACGACACTTGG + Intergenic
1010947065 6:81987370-81987392 CGGGTCCCTCCCACAACACATGG - Intergenic
1011228853 6:85137493-85137515 CGGGTCACTCACTCTTCCCTAGG + Intergenic
1011462107 6:87615281-87615303 CAGGTCCCTCCCACAGCACTTGG + Intronic
1011509304 6:88082420-88082442 CGGGTCCCTCCCACAACACATGG - Intergenic
1011702866 6:89971854-89971876 CGGGTCCCTCCCACAACACATGG + Intronic
1011738407 6:90335087-90335109 CTGGTCTCTCCCACTACACATGG + Intergenic
1011754605 6:90486001-90486023 CAGGTCCCTCCCACAACACTTGG - Intergenic
1011842080 6:91513989-91514011 CGGGTCCCTCCCACGTCACGTGG + Intergenic
1011947763 6:92928175-92928197 TGGGTCCCTCCCACAGCACTTGG - Intergenic
1012230487 6:96755417-96755439 TGGGTCCCTCCCACAACACTTGG + Intergenic
1013186607 6:107764753-107764775 CGGGTCCCTCCCACAACACGTGG - Intronic
1013214437 6:108014840-108014862 CGGGTCCCTCCCACAACACATGG + Intergenic
1013242658 6:108260692-108260714 CTGGTCACCCCCACTCGACCCGG - Intronic
1013386326 6:109635459-109635481 AGAGCCACTCCTACTCCACTTGG + Intronic
1014101499 6:117516900-117516922 CGGGTCCCTCCCACAACACGTGG + Intronic
1014234136 6:118936238-118936260 CGGGTCCCTCCCACAACACCTGG + Intergenic
1014249129 6:119098073-119098095 CGGGTCCCTCCCACAACACATGG - Intronic
1014283474 6:119467313-119467335 CAGGTCCCTCCCACTACACTTGG + Intergenic
1014471339 6:121818906-121818928 CGGGTCCCTCCCACAACACATGG - Intergenic
1014636075 6:123848381-123848403 CGGGTCCCTCCCACGACACATGG - Intronic
1014709401 6:124788699-124788721 CGGGTCCCTCCCACAACACATGG + Intronic
1015129034 6:129789223-129789245 CGGGTCCCTCCCACAACACATGG - Intergenic
1016020535 6:139232339-139232361 CGGGTCCCTCCCTCAACACTGGG + Intergenic
1016246813 6:141992886-141992908 CGGGTCCCTCCCACAACACATGG - Intergenic
1016503084 6:144744869-144744891 CGGGACATTTCCACTCCACTGGG - Intronic
1016649478 6:146447727-146447749 CGGGTCCCTCCCACAGCACATGG + Intergenic
1017225980 6:152021732-152021754 CGGGTCCCTCCCACAACACGTGG - Intronic
1017292973 6:152762738-152762760 CGGGTCCCTCCCACAACACGCGG + Intergenic
1017357764 6:153529943-153529965 CGGGTCCCTCCCACAACACATGG - Intergenic
1017424595 6:154307192-154307214 CGGGTCCCTCCCACAACACATGG - Intronic
1017547415 6:155467498-155467520 TGGGTCCCTCCCACAACACTTGG + Intergenic
1017791057 6:157799812-157799834 TGGGTCCCTCCCACAACACTGGG + Intronic
1017806013 6:157946154-157946176 TGGGTCTCTCGCACTCCACCTGG + Intergenic
1017885570 6:158596891-158596913 CGGGTCCCTCCCACAACACATGG + Intronic
1018509725 6:164512285-164512307 TGGGTCCCTCCCACAACACTTGG - Intergenic
1018527327 6:164727766-164727788 CAGGTCTCTCCCACGACACTTGG - Intergenic
1018909367 6:168093168-168093190 CGGGTCCCTCCCACCACACATGG + Intergenic
1019050911 6:169182878-169182900 TGGGTCCCTCCCACAACACTTGG + Intergenic
1019661203 7:2224937-2224959 CCTGTCACTCCTACACCACTTGG + Intronic
1019887167 7:3915374-3915396 CGGGTCCCTCCCACAACACGTGG - Intronic
1019947225 7:4339389-4339411 CAGGTCCCTCCCACAACACTTGG - Intergenic
1020389836 7:7646349-7646371 CGGGTCCCTCCCACAACACATGG - Intronic
1020455836 7:8373125-8373147 CGGGTCCCTCCCACAACACGTGG - Intergenic
1020456128 7:8375073-8375095 CGGGTCCCTCCCACAACACGTGG - Intergenic
1020872696 7:13651894-13651916 CGGGTCCCTCCCACAACACATGG + Intergenic
1020932574 7:14416530-14416552 TGGGTCCCTCCCACACCACGTGG - Intronic
1021340099 7:19454587-19454609 TGGGTCCCTCCCACTACACATGG + Intergenic
1022968649 7:35497374-35497396 CGGGTCCCTCCCACGACACATGG + Intergenic
1023826538 7:44013823-44013845 CAGGTCCCTCCCACAACACTGGG + Intergenic
1026065134 7:67064704-67064726 CGGGTCTCTCCCACAACACGTGG + Intronic
1026090116 7:67292693-67292715 CAGGTCCCTCCCACAACACTGGG + Intergenic
1026345451 7:69469951-69469973 TGGGTCACTCCCACAACACGTGG - Intergenic
1026597425 7:71745751-71745773 CGGGTCCCTCCCACAACACGTGG - Intergenic
1026631775 7:72044063-72044085 CGGGTCCCTCCCACAACACGCGG + Intronic
1027119707 7:75508011-75508033 CAGGTCCCTCCCACAACACTGGG + Intergenic
1027272118 7:76527600-76527622 CAGGTCCCTCCCACAACACTGGG - Intergenic
1027626124 7:80546408-80546430 TGGGTCCCTCCCACAACACTTGG - Intronic
1027680992 7:81221920-81221942 CGGGTCCCTCCCACAACACATGG - Intergenic
1027972212 7:85099222-85099244 CGGGTCCCTCCCACAACATTTGG - Intronic
1028133792 7:87206184-87206206 CGGGTCCCTCCCACAACACGTGG + Intronic
1028134045 7:87208015-87208037 CGGGTCCCTCCCACAACACATGG + Intronic
1028795395 7:94896177-94896199 CGGGTCCCTCCCACAACACATGG + Intergenic
1029717790 7:102342016-102342038 CAGGTCCCTCCCACAACACTGGG - Intergenic
1029754825 7:102567227-102567249 CAGGTCCCTCCCACAACACTGGG + Intronic
1029772775 7:102666307-102666329 CAGGTCCCTCCCACAACACTGGG + Intronic
1030826948 7:114169765-114169787 CGGGTCCCTCCCACAACACGTGG - Intronic
1031849683 7:126849105-126849127 CAGGTCACTCCCACAACACATGG + Intronic
1032362925 7:131272852-131272874 CGGGTCCCTCCCACAACACATGG + Intronic
1032440457 7:131938860-131938882 CAGGTCCCTCCCACAACACTTGG - Intergenic
1033549684 7:142435663-142435685 CGGGTCCCTCCCACAACACGTGG - Intergenic
1033923066 7:146419316-146419338 CAGGTCCCTCCCACAACACTTGG + Intronic
1034077219 7:148243689-148243711 CAGGTCTCTCCCACAACACTTGG + Intronic
1034321779 7:150191003-150191025 CAGGTCCCTCCCACCACACTTGG + Intergenic
1034679939 7:152920922-152920944 CAGGTCCCTCCCACACCACAGGG + Intergenic
1035011029 7:155714956-155714978 CGGGTCACCACCAGGCCACTGGG + Intronic
1035072081 7:156153040-156153062 CGGGTCCCTCCCACAACACGTGG - Intergenic
1035543646 8:461548-461570 CGGGTCCCTCCCACGGCACATGG + Intronic
1036566315 8:9941257-9941279 CGGGTCCCTCCCACAACACTTGG - Intergenic
1037660144 8:20919385-20919407 CTGGTCCCTCCCACAACACTTGG + Intergenic
1037733734 8:21550248-21550270 CGGGTCCCTCCCACGACACATGG - Intergenic
1037747320 8:21656837-21656859 CGGGTCCCTCCCACAACACGTGG - Intergenic
1037984707 8:23282581-23282603 CGGGTCCCTCCCATGACACTTGG - Intronic
1038090200 8:24244530-24244552 CAGGTCACTCCCACAACACATGG - Intergenic
1038214664 8:25550536-25550558 CGGGTCCTTCCCACAACACTTGG - Intergenic
1038374961 8:27030749-27030771 CGGGTCCCTCCCACAACACATGG - Intergenic
1039121793 8:34156347-34156369 CGGGTCCCTCCCACAACACCTGG - Intergenic
1039438861 8:37580699-37580721 CGGGTCCCTCCCACGACACATGG - Intergenic
1040560355 8:48518195-48518217 CGGGTCCCTCCCACAACACTTGG + Intergenic
1041334740 8:56768985-56769007 TGGGTCACTCCCACAACACAAGG + Intergenic
1041882956 8:62773569-62773591 CAGGTCCCTCCCACTGCACTTGG - Intronic
1041902363 8:62996395-62996417 CGGGTCCCTCCCTCGACACTTGG + Intronic
1041968757 8:63712412-63712434 CCGGTCTCTCCCACAACACTTGG - Intergenic
1042147454 8:65744986-65745008 CGGGTCCCTCCCACAACACATGG - Intronic
1042432674 8:68726856-68726878 CGGGTCCCTCCCACAACACACGG + Intronic
1042719881 8:71815940-71815962 CAGGTCACTCACAAGCCACTGGG + Intergenic
1042827023 8:72990042-72990064 CAGGTCCCTCCCACTACACATGG - Intergenic
1043032624 8:75156425-75156447 CGGGTCCCTCCCACTACAAGTGG - Intergenic
1043510802 8:80948552-80948574 CGGGTCCCTCCCACAACACATGG - Intergenic
1044029323 8:87214877-87214899 CTGGTCCCTCCCACAACACTTGG + Intronic
1044565804 8:93660268-93660290 CAGGTCCCTCCCACTACACATGG - Intergenic
1045817313 8:106291948-106291970 CGGGTCCCTCCCACAACACGTGG + Intronic
1046613603 8:116451843-116451865 CGGGTCTCTCCCACAACACGTGG + Intergenic
1046805999 8:118479546-118479568 CGGGTCCCTCCCACAACACTTGG + Intronic
1047822349 8:128535261-128535283 TGGGTCCCTCCCACAACACTTGG + Intergenic
1048707637 8:137171435-137171457 CGGGTCCCTCCCACAACACGTGG - Intergenic
1049247623 8:141571236-141571258 AGGGGCACCCCCACCCCACTGGG - Intergenic
1049539967 8:143203986-143204008 CGGGTCCCTCCCACGACACATGG - Intergenic
1049585848 8:143432080-143432102 CTGGGCCCTCCCACTCCTCTGGG + Intergenic
1050656129 9:7830789-7830811 CAGGTCCCTCCCACAACACTTGG + Intronic
1050679861 9:8098284-8098306 TGGGTCCCTCCCACAACACTTGG + Intergenic
1051707911 9:19899896-19899918 CAGGTCACTCCCACAACACATGG + Intergenic
1052093595 9:24358293-24358315 CGGGTCCCTCCCACAACACATGG + Intergenic
1052271702 9:26634389-26634411 CGGGTCCCTCCCACAACATTTGG + Intergenic
1053372426 9:37574226-37574248 CTACTCACTCCCACTCCTCTTGG + Intronic
1055931165 9:81561080-81561102 CGGGTCCCTCCCACAACACGTGG - Intergenic
1056007436 9:82286946-82286968 CGGGTCCCTCCCACAACACATGG - Intergenic
1056086600 9:83155552-83155574 CGGGTCCCTCCCACAACACATGG + Intergenic
1057239697 9:93398117-93398139 CGGGTCCCTCCCACTACATGTGG - Intergenic
1057316624 9:93973152-93973174 CGGGTCCCTCCCACAACACATGG + Intergenic
1057839067 9:98470514-98470536 CGGGTCCCTCCCACAACACATGG + Intronic
1060239707 9:121892548-121892570 CGGGTCTCTCCCACAACACGTGG + Intronic
1060391267 9:123279157-123279179 CGGGTCCCTCCCACAACACATGG - Intergenic
1060621464 9:125070908-125070930 CGGGTCCCTCCCACAACACATGG - Intronic
1060622836 9:125083063-125083085 CGGGTCCCTCCCACAACACATGG - Intronic
1061189831 9:129075959-129075981 CGGGTCCCTCCCACAACACGTGG + Intergenic
1061914577 9:133742765-133742787 TGGGTCACTCCTACTCCAGCTGG + Intergenic
1062087471 9:134656204-134656226 CTGGTCACTGCCGCTGCACTGGG - Intronic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062214418 9:135381340-135381362 CGGGTCCCTCCCACAACACGTGG - Intergenic
1062257887 9:135638270-135638292 CGGGTCCCTCCCACAACACGTGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1185740280 X:2526478-2526500 CTGGTCCCTCCCACACCACGTGG - Intergenic
1185886066 X:3784318-3784340 TGGGTCACTCCCACAACACATGG + Intergenic
1186049176 X:5571653-5571675 CGGGTCCCTCCCACAACACATGG - Intergenic
1186135202 X:6512238-6512260 CGGGTCCCTCCCACCACACGTGG + Intergenic
1186216130 X:7303086-7303108 CGGGTCCCTCCCACAACACGTGG - Intronic
1187368360 X:18683124-18683146 CGGGTCCCTCCCACGACACGTGG + Intronic
1187448687 X:19378596-19378618 CGGGTCCCTCCCACAACACGTGG + Intronic
1188069362 X:25700254-25700276 CGGGTCCCTCCCACAACACATGG + Intergenic
1188520524 X:31033219-31033241 CGGGTCCCTCCCACCACACGTGG + Intergenic
1188976068 X:36676968-36676990 TGGGTCCCTCCCACAACACTTGG + Intergenic
1189382319 X:40510794-40510816 CGGGTCCCTCCCACAACACATGG - Intergenic
1189845781 X:45135408-45135430 CAGGTCCCTCCCACAACACTTGG - Intergenic
1189952288 X:46245130-46245152 CGGGTCCCTCCCACGACACGTGG - Intergenic
1190163698 X:48053837-48053859 CAGGTCCCTCCCACTACACATGG + Intronic
1193199699 X:78673917-78673939 CTGGTCATCCCCACTCCCCTGGG - Intergenic
1193278138 X:79615470-79615492 CAGGTCCCTCCCACAACACTTGG - Intergenic
1193807793 X:86015154-86015176 CGGGTCCCTCCCACAACACATGG - Intronic
1194145779 X:90260516-90260538 CAGGTCACTCCCACAACACATGG + Intergenic
1194302846 X:92209058-92209080 CAGGTCCCTCCCACAACACTGGG + Intronic
1194625863 X:96226626-96226648 CGGGTCCCTCCCACAACACGTGG + Intergenic
1195178955 X:102338602-102338624 CGGGTCCCTCCCACAACACATGG - Intergenic
1195548898 X:106144287-106144309 TGGGTCCCTCCCACAACACTTGG - Intergenic
1195560576 X:106277702-106277724 CGGGTCCCTCCCACAACACGTGG + Intergenic
1195561386 X:106288637-106288659 CGGGTCCCTCCCACAACACGTGG - Intergenic
1195789531 X:108567840-108567862 CGGGTCCCTCCCACAACACGTGG + Intronic
1195863849 X:109408588-109408610 CGGGTCCCTCCCACTACACGTGG - Intronic
1196278671 X:113797528-113797550 TGGGTCACTCCCACAACACGTGG - Intergenic
1197246295 X:124170642-124170664 CGGGTCCCTCCCACAACACATGG + Intronic
1197341157 X:125267309-125267331 CGGGTCCCTCCCACAACACTTGG - Intergenic
1197705783 X:129633615-129633637 AGGGTTACTCCCAATCCACCAGG - Intergenic
1198220722 X:134599295-134599317 CAGGTCCCTCCCACGACACTTGG - Intronic
1198662945 X:138990711-138990733 CGGGTTCCTCCCACAACACTTGG + Intronic
1199191539 X:144977466-144977488 CAGGTCCCTCCCACAACACTTGG - Intergenic
1199309443 X:146306294-146306316 CGGGTCCCTCCCACAACACATGG - Intergenic
1199389531 X:147263002-147263024 CGGGTCCCTCCCACAACACATGG - Intergenic
1199620144 X:149692754-149692776 CGGGTCCCTCCCACAACACGTGG - Intronic
1199868933 X:151878884-151878906 CCGGTCCCTCCCACACCACGGGG + Intergenic
1201196528 Y:11499784-11499806 CGAGTCAATTCCACTCCAGTCGG - Intergenic
1201489373 Y:14524476-14524498 CCGTTCCCTCCCACTCCCCTAGG + Intronic
1201940196 Y:19450821-19450843 CAGGTCATCCCCTCTCCACTGGG + Intergenic