ID: 1172057718

View in Genome Browser
Species Human (GRCh38)
Location 20:32165943-32165965
Sequence GACAAAGCACAGCTCCAGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 184}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172057709_1172057718 10 Left 1172057709 20:32165910-32165932 CCTCTCCCTGCCCATCCTCACCA 0: 1
1: 0
2: 11
3: 156
4: 1570
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184
1172057710_1172057718 5 Left 1172057710 20:32165915-32165937 CCCTGCCCATCCTCACCACTGAG 0: 1
1: 0
2: 4
3: 48
4: 435
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184
1172057715_1172057718 -5 Left 1172057715 20:32165925-32165947 CCTCACCACTGAGGCCACGACAA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184
1172057713_1172057718 0 Left 1172057713 20:32165920-32165942 CCCATCCTCACCACTGAGGCCAC 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184
1172057714_1172057718 -1 Left 1172057714 20:32165921-32165943 CCATCCTCACCACTGAGGCCACG 0: 1
1: 0
2: 2
3: 26
4: 221
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184
1172057708_1172057718 15 Left 1172057708 20:32165905-32165927 CCGAGCCTCTCCCTGCCCATCCT 0: 1
1: 0
2: 11
3: 127
4: 1008
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184
1172057711_1172057718 4 Left 1172057711 20:32165916-32165938 CCTGCCCATCCTCACCACTGAGG 0: 1
1: 0
2: 4
3: 27
4: 301
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184
1172057716_1172057718 -10 Left 1172057716 20:32165930-32165952 CCACTGAGGCCACGACAAAGCAC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG 0: 1
1: 1
2: 1
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172057718 Original CRISPR GACAAAGCACAGCTCCAGCT CGG Exonic
901815132 1:11789430-11789452 AACAAGTCACAGCTGCAGCTGGG - Exonic
904799771 1:33084093-33084115 GCTAAAGCCCAGCCCCAGCTGGG - Exonic
905723467 1:40227982-40228004 GACAGAGCAAGGCTCCATCTGGG + Intronic
905867478 1:41383774-41383796 GACGAAGCACATCTTCAGCACGG - Intergenic
907730795 1:57063401-57063423 CACAAAGCACAGCTTCTACTGGG + Intronic
908671797 1:66556275-66556297 AAAAAAGGAGAGCTCCAGCTAGG - Intronic
909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG + Intergenic
912495135 1:110086713-110086735 GACACTGCACAGCTCCAGGGTGG - Intergenic
914692914 1:150047050-150047072 GACAGAGCACAGCTCTGTCTTGG + Intergenic
914779010 1:150766787-150766809 GACAAAGCACGACTCCGTCTCGG - Intergenic
915075273 1:153303296-153303318 GCCACAGCACAGCCACAGCTCGG - Intronic
916990430 1:170237765-170237787 GACAATGCATCGCTCCAGCAAGG + Intergenic
919193590 1:194254857-194254879 GAGAAACCACAGCTACAGTTTGG + Intergenic
919389494 1:196964493-196964515 GAAAAAGCCCAGCACCAGCCAGG - Intergenic
919753384 1:201052176-201052198 GGCAGAGCAAAGCTCCAGATGGG - Intronic
921750152 1:218782882-218782904 GACCAAGCACAGCTCTTGTTGGG - Intergenic
922078239 1:222268877-222268899 GCTATAGCTCAGCTCCAGCTTGG - Intergenic
1067186193 10:44030001-44030023 GAAAAAACACATCTCCAGCTAGG - Intergenic
1067742406 10:48905572-48905594 GTCTCAGCACAGCTCCAGGTTGG + Intronic
1067854492 10:49780451-49780473 AACATAGCTCACCTCCAGCTGGG + Intergenic
1068180719 10:53514839-53514861 GACAGAGCAAAACTCCATCTTGG + Intergenic
1068784919 10:60961358-60961380 GAGAAAGCAGAGCTTCAGCAAGG - Intronic
1069593272 10:69654953-69654975 GAGAAAGCAGAGGTCCAGATGGG + Intergenic
1071371606 10:84957232-84957254 GACAGAGCTCAGCTCCTGTTTGG + Intergenic
1073218367 10:101849541-101849563 GCCCTTGCACAGCTCCAGCTGGG - Intronic
1076535677 10:131175177-131175199 GACAGAGGCCAGCTCCAGGTTGG + Intronic
1080152968 11:29075883-29075905 GACAACCCACAGCACCAGCCCGG - Intergenic
1081906218 11:46672141-46672163 GACGAAGCTCAGCCCTAGCTGGG - Intronic
1082830834 11:57616079-57616101 GACAAAGCAAGACTCCATCTCGG - Intergenic
1083129705 11:60613581-60613603 CACAAAGAACAGCTCTAGATAGG + Intergenic
1083615652 11:64024816-64024838 GTCAAGGCCCAGCCCCAGCTGGG + Intronic
1084768673 11:71328594-71328616 GAGAAAGAACATGTCCAGCTGGG - Intergenic
1086490941 11:87357193-87357215 TCCAGAGCACTGCTCCAGCTAGG - Intergenic
1088253675 11:107883342-107883364 GACAGAGCAAAACTCCATCTCGG + Intronic
1088858967 11:113781979-113782001 GACAAAGCACAGCACCAGCTTGG - Intergenic
1091102294 11:132886480-132886502 GAGAAGGACCAGCTCCAGCTGGG + Intronic
1091311413 11:134577681-134577703 GACAAAGAACAGCCCCTACTGGG + Intergenic
1092135406 12:6143542-6143564 GACAGAGCAAGACTCCAGCTGGG - Intergenic
1093629147 12:21387478-21387500 GCCAAGGTACAGCTCAAGCTTGG + Intronic
1095118172 12:38381456-38381478 GACAAACCCCAGTACCAGCTCGG - Intergenic
1096074568 12:48794786-48794808 GACAAAGCAAGGCTCCATCTCGG + Intergenic
1097303689 12:58045730-58045752 CACAAAGGAGAGCTCCTGCTTGG + Intergenic
1097855687 12:64459422-64459444 TACAAAGCACAGCTGTAGTTGGG - Intronic
1098290078 12:68949940-68949962 GTCAAATCAAAGCTTCAGCTAGG + Intronic
1102100789 12:110277217-110277239 GACAAAGCAAGACTCCATCTAGG - Intergenic
1102365164 12:112327296-112327318 GACAGAGCAAAACTCCATCTCGG + Intronic
1104021747 12:124996775-124996797 GACAAAGCAATACTCCATCTCGG - Intronic
1105828800 13:24145846-24145868 GACAGAGCACAGCTGGGGCTTGG + Intronic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1107732791 13:43365478-43365500 GATAAAACACAGGTCCAGGTGGG + Intronic
1109312916 13:60716540-60716562 GATAAAGCAGAGCTACAGCAAGG - Intergenic
1110293313 13:73833468-73833490 GACATACCACAGCAACAGCTTGG + Intronic
1111060909 13:83017453-83017475 GACTCACCACAGCACCAGCTCGG - Intergenic
1112466781 13:99651911-99651933 GACAAAGCAAGACTCCATCTTGG + Intronic
1113723670 13:112581129-112581151 CACCAAGCTCACCTCCAGCTCGG + Intronic
1113778848 13:112964124-112964146 GGCTATGCACAGCCCCAGCTGGG - Intronic
1114389263 14:22288938-22288960 GACAAAGCACAGTTCCACGAAGG - Intergenic
1114422427 14:22596106-22596128 GACAAAGCAAGACTCCATCTTGG - Intergenic
1114449904 14:22818619-22818641 GACAAAGCAAAACTCCATCTCGG - Intronic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1118255053 14:64198582-64198604 GACAAAGCACTCATCCAGCCAGG - Intronic
1118276635 14:64391459-64391481 GAAAAAGCAAAGCGCCAGCGGGG - Intronic
1118359698 14:65045432-65045454 GACAGAGCACGACTCCATCTCGG - Intronic
1120537530 14:85715362-85715384 GACAATGCCCAGTACCAGCTAGG - Intergenic
1121115313 14:91338988-91339010 GTCCACGCTCAGCTCCAGCTTGG - Intronic
1121153351 14:91658775-91658797 GACAAAGCACATCCCAAGATAGG + Intronic
1121601337 14:95206152-95206174 GACAAAGCACACTTCAAGATGGG + Intronic
1122388431 14:101364373-101364395 CAGAAAGCCCTGCTCCAGCTCGG - Intergenic
1125230471 15:37449579-37449601 GACAGAGCAAAACTCCATCTTGG - Intergenic
1125465549 15:39948127-39948149 AAGAAAGCACAGCTCTTGCTGGG - Intronic
1127394385 15:58532210-58532232 GACAAAGCTCAGCAACAGCTAGG + Intronic
1128875867 15:71200869-71200891 GACATGGCACAGCTCCATTTTGG - Intronic
1130576453 15:85097210-85097232 GACAAAACCCAGCTCCATCCTGG + Intronic
1131222534 15:90597084-90597106 ACCAAGGCACAGCTGCAGCTGGG + Intronic
1131476299 15:92743083-92743105 AACCAAGCAAAGCTCCAGATGGG - Intronic
1134000851 16:10781639-10781661 GAAAAAGCACAGCTCTACCCGGG + Intronic
1134613483 16:15630224-15630246 TACAAAGAACAGCCCCATCTGGG + Intronic
1136410642 16:30075224-30075246 TACAAAGCCTAGCCCCAGCTCGG + Intergenic
1138694164 16:58796023-58796045 GACAAAGCAAGACTCCATCTTGG + Intergenic
1142940935 17:3379447-3379469 CACAAAGAACAGCTCCACATGGG + Intergenic
1144379982 17:14685128-14685150 AACAAAGGAAAGCTCCAGGTAGG - Intergenic
1146141493 17:30371907-30371929 GACACAGCAAAACTCCATCTCGG + Intergenic
1146373116 17:32277474-32277496 GGCAAATCCCAGCTCCAGCGGGG + Intronic
1146407338 17:32550380-32550402 AACAAAGCATAGCTCAGGCTGGG - Intronic
1147034897 17:37672554-37672576 TAACAAGTACAGCTCCAGCTAGG - Intergenic
1147185309 17:38710231-38710253 GAGAAAGCAGAGCCCGAGCTGGG + Intronic
1148931468 17:51130682-51130704 GACAGAGCAAGGCTCCATCTCGG - Intergenic
1149642275 17:58210913-58210935 GACTATTCACAGCTCCATCTAGG + Intronic
1152368423 17:79870537-79870559 CACAAAGTTCAGCTCCAGCCAGG + Intergenic
1152696620 17:81800818-81800840 GACCAAGCACACCTCCAGGAGGG + Intergenic
1153923142 18:9808845-9808867 CAACAAGCACAGCTCCAGCTGGG - Intronic
1155472711 18:26207632-26207654 CACAAAGGACATCCCCAGCTGGG - Intergenic
1160317209 18:77859148-77859170 GAGAAAGCACTGCTCCTGCGGGG - Intergenic
1160458612 18:79020466-79020488 AATAAAGCCCAGCTCCTGCTAGG - Intergenic
1160690745 19:459949-459971 GACACAGCACGCCTCCACCTAGG - Intronic
1161166140 19:2788777-2788799 GACAAAGCAAGACTCCATCTTGG - Intronic
1161743006 19:6035956-6035978 AACAAACCACAGCTCCAGGGTGG + Intronic
1163796726 19:19342238-19342260 GACCAAGTGCAGCTCCAGCAGGG + Intronic
1164415576 19:28044418-28044440 GGAAAAGCCCAACTCCAGCTAGG + Intergenic
1165008361 19:32824487-32824509 CACAGAGCACAGCTACAGCTAGG - Intronic
927217224 2:20674680-20674702 GACTGAGCACAGCTCAAGCCTGG - Intergenic
928256313 2:29726001-29726023 GACCAAGCACACCTGCAGCAGGG - Intronic
929777930 2:44939915-44939937 GCCTAAGCAGGGCTCCAGCTCGG + Intergenic
930253365 2:49060825-49060847 GGCAAAGCACAGCTCTAGTTTGG - Intronic
930861371 2:56077660-56077682 GACAAAGTACAGCTTCTGATAGG + Intergenic
936041917 2:109156321-109156343 GAGAAAGCACAGTCCCAGCAGGG - Intronic
938900990 2:135798313-135798335 GAGCAAGCACAGACCCAGCTGGG - Intronic
939533042 2:143389638-143389660 GACAAAGCCAAACACCAGCTAGG + Intronic
941859547 2:170264461-170264483 GACAAATCACAGGGCCAGCCCGG + Intronic
941903444 2:170698964-170698986 GGCAAAGCAGAACTCCAGCAGGG - Intergenic
942377943 2:175356129-175356151 GGTCCAGCACAGCTCCAGCTGGG - Intergenic
948708602 2:239811187-239811209 ATGAAAGCACAGTTCCAGCTTGG + Intergenic
1169347889 20:4843527-4843549 GACAGAGCAAAACTCCATCTCGG + Intergenic
1170267158 20:14479307-14479329 GACACAGGACAGCACCAGCACGG - Intronic
1172057718 20:32165943-32165965 GACAAAGCACAGCTCCAGCTCGG + Exonic
1173293473 20:41734677-41734699 GCCCAGGCACAGCTCCTGCTTGG - Intergenic
1173443051 20:43095153-43095175 GACAAAGCCCATTTCCATCTGGG + Intronic
1173516858 20:43670595-43670617 TACAAAGGTCAGCTCCACCTTGG - Intronic
1173752317 20:45487212-45487234 GATGAAGCACAACTCCAGCCTGG - Intergenic
1174728236 20:52888006-52888028 GACAAAACACAACTTCAGCCAGG + Intergenic
1175832586 20:61974374-61974396 GACAGGTCACAGCTCCTGCTGGG - Intronic
1179953347 21:44723997-44724019 GACAGAGCACAGACCCCGCTGGG + Intergenic
1180091363 21:45535211-45535233 CACACAGCACAGTTCCAGCGGGG + Intronic
1180667159 22:17522984-17523006 GACAAAGCAAGACTCCATCTCGG + Intronic
1181265356 22:21628015-21628037 GACAAAGAGCAGCTCCCTCTTGG - Intergenic
1184780257 22:46645239-46645261 GACAAGGCACAGGTTCTGCTGGG - Intronic
1185024109 22:48397697-48397719 GTCACAGCACAGCTCCTGTTGGG + Intergenic
950241626 3:11375576-11375598 GACAGAGCAAGGCTCCATCTTGG - Intronic
955247862 3:57245097-57245119 GAGTAAACACATCTCCAGCTGGG - Intronic
955629397 3:60956461-60956483 GAAAAAGCACAGCTAAAGGTAGG - Intronic
961488007 3:127230775-127230797 GACAATGCACACCTCCTGGTAGG + Intergenic
963074489 3:141333520-141333542 GACCAGGCACAGCCCCTGCTGGG + Intronic
966176128 3:177139514-177139536 GACAAAGCAAGACTCCATCTCGG + Intronic
967665531 3:192167497-192167519 GGAAAAGCACAGTACCAGCTAGG + Intronic
967853539 3:194099847-194099869 GAGGGAGCACAGCTCCAGTTTGG - Intergenic
968678730 4:1901184-1901206 GACAAGGCCCTGCTCCAGCAAGG - Exonic
968803310 4:2756597-2756619 GAATAAGCCCAGCACCAGCTGGG - Intergenic
969263499 4:6048868-6048890 GGGCAAGCACAGTTCCAGCTTGG + Exonic
969611013 4:8227862-8227884 GACACAGCTCAGCACCAGGTGGG - Exonic
969808278 4:9627652-9627674 GACCATGCACAGGTCCAGTTAGG + Intergenic
970615833 4:17767312-17767334 GACAAAGCCCCGAGCCAGCTAGG + Intronic
970817474 4:20174806-20174828 GACCAAGCACAGCTACTGCTTGG - Intergenic
971413314 4:26398420-26398442 TACAAACCACATCTCCCGCTAGG - Intronic
973268285 4:48233081-48233103 GACTAAGTGCAGCTGCAGCTGGG + Intronic
975795077 4:77998423-77998445 ACAAAAGCAAAGCTCCAGCTTGG - Intergenic
977245602 4:94627178-94627200 GACAATGGACAGCTCCAGTCAGG - Intronic
977678374 4:99772492-99772514 AACAAAGTACAGCATCAGCTGGG + Intergenic
977859468 4:101938966-101938988 GATAAATCACAGCTACTGCTTGG - Intronic
978439943 4:108722796-108722818 AACAAAACAAAGCTCAAGCTAGG + Intergenic
986158027 5:5196372-5196394 GACAAAGCACAGCCACAAATGGG - Intronic
993063759 5:83073823-83073845 GATGAAGCACAGCTCCAGCTTGG - Intronic
993895067 5:93523591-93523613 CATAAAGAAGAGCTCCAGCTGGG + Intergenic
995285611 5:110385115-110385137 GTCAAATCACAGCTCTAGCAAGG + Intronic
996355262 5:122588717-122588739 GGCAAAGCAGGCCTCCAGCTGGG + Intergenic
996582173 5:125043736-125043758 GACCAAAAAGAGCTCCAGCTTGG + Intergenic
1001058152 5:168466044-168466066 TCCAAAGCACAGCAGCAGCTTGG + Intronic
1001530642 5:172459123-172459145 GACAAGGCACAGTGGCAGCTGGG - Intergenic
1002719060 5:181246923-181246945 GACAGGGCACAGCCACAGCTGGG - Intronic
1003254305 6:4460789-4460811 AACAAAGTACAGCTCCAGTGAGG + Intergenic
1004255634 6:14061081-14061103 TACAAAGCAGAGACCCAGCTTGG + Intergenic
1006378810 6:33686009-33686031 GGCACAGCACAGCTACAGCACGG - Intronic
1006772026 6:36561612-36561634 GACAAAGCAAGACTCCATCTTGG + Intergenic
1011550734 6:88529071-88529093 GACAAAGGACATCTCTAGCTCGG + Intergenic
1014359478 6:120459064-120459086 GACAGAGCAAAACTCCATCTTGG - Intergenic
1019034501 6:169043058-169043080 AACAAAGCAGAGCTGCAGCTGGG - Intergenic
1020701447 7:11488980-11489002 GGCAGAGCACAACTCCATCTGGG - Intronic
1023631259 7:42166545-42166567 GTGAAAGCATAGCTCCAGTTGGG + Intronic
1024936736 7:54718854-54718876 GCAAAAGTCCAGCTCCAGCTGGG + Intergenic
1026057556 7:66997645-66997667 GACAGAGCAAGGCTCCATCTCGG - Intronic
1026795886 7:73365849-73365871 GACAGAGCAAAACTCCATCTTGG + Intergenic
1027455518 7:78386648-78386670 TACAAATCACAGCTCCACTTGGG - Intronic
1027857487 7:83531363-83531385 GACAGAGCAAAACTCCATCTCGG - Intronic
1031033008 7:116755087-116755109 GACAAAGAGCAGATGCAGCTTGG - Intronic
1034172037 7:149070190-149070212 GACAGAGCAAAACTCCATCTTGG + Exonic
1038331327 8:26611810-26611832 GACAAAGCACAGCTTCTCCCTGG + Intronic
1038333382 8:26627416-26627438 GACTGAGCAGAGCTCCAGCAAGG - Intronic
1040061515 8:43107391-43107413 GACAGAGCAAGGCTCCATCTCGG - Intronic
1040571234 8:48613074-48613096 GACAGAGCAAGGCTCCATCTTGG + Intergenic
1042240417 8:66658313-66658335 GACAGAGCAAGGCTCCATCTTGG + Intronic
1048419325 8:134261558-134261580 GTCAATGTACAGCTCCAGCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055599565 9:77901539-77901561 GAGAAAGAGTAGCTCCAGCTCGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058769352 9:108215244-108215266 GACAGAGCACAGCCACAGCCTGG - Intergenic
1059769668 9:117414217-117414239 GATCAAGCAGAGCTCCAGGTCGG + Intronic
1061404898 9:130388220-130388242 TACAAAGCAAAGCTCCAGCGGGG - Intronic
1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG + Intergenic
1187681482 X:21771393-21771415 GACAATGCCCAGTACCAGCTTGG + Intergenic
1188815656 X:34710790-34710812 AAGAAAGTACAGCTCCAACTTGG - Intergenic
1190747346 X:53332423-53332445 GACAAAAGCCAGCTCCAGATGGG - Intergenic
1192555842 X:72088534-72088556 GACAAAGCACAACTCCCACATGG + Intergenic
1195244382 X:102982456-102982478 GAAGAAGCACAGCTCTAGCGGGG + Intergenic
1195277215 X:103293283-103293305 GACACAGCACATCGCAAGCTTGG - Intergenic
1198306853 X:135391937-135391959 GGCAAAGGCCAGCTCCAGCCTGG + Intergenic
1200910398 Y:8526817-8526839 GTGAGAGCACAGCTCCACCTTGG + Intergenic
1200920603 Y:8609677-8609699 GTGAAAACACAGCTCCACCTTGG + Intergenic