ID: 1172060108

View in Genome Browser
Species Human (GRCh38)
Location 20:32181650-32181672
Sequence CTCCATTTTAAGAGGAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172060102_1172060108 13 Left 1172060102 20:32181614-32181636 CCAGGAAAATCTACAGTGGCTTC No data
Right 1172060108 20:32181650-32181672 CTCCATTTTAAGAGGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172060108 Original CRISPR CTCCATTTTAAGAGGAGCCA TGG Intergenic
No off target data available for this crispr