ID: 1172061078

View in Genome Browser
Species Human (GRCh38)
Location 20:32187968-32187990
Sequence TCTTCGTCTCCAGAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172061078 Original CRISPR TCTTCGTCTCCAGAGAGGGA GGG (reversed) Intergenic
901640141 1:10688963-10688985 TCCTCATCTTCAGAGGGGGAAGG - Intronic
901751628 1:11413652-11413674 TCCTCCTCTGCTGAGAGGGAGGG + Intergenic
903318138 1:22524955-22524977 CCATCTTCTCCAGAGAGGGTGGG + Intronic
904336977 1:29804287-29804309 TCTGGGCCTCCAGAGAGGGAGGG - Intergenic
906019108 1:42611273-42611295 ATTTCTTCTCAAGAGAGGGAAGG + Intronic
908180869 1:61604185-61604207 TGCTAGTCTCCAGAGAGCGAGGG + Intergenic
908683886 1:66692544-66692566 TCTTCCTCTCCAGAGAGGATGGG + Intronic
908862599 1:68506590-68506612 TCTTAGTCACCAGAAAGAGAAGG - Intergenic
910296878 1:85656017-85656039 TTTTTACCTCCAGAGAGGGAAGG + Intronic
911463415 1:98220000-98220022 TCTACCTATCAAGAGAGGGAGGG + Intergenic
911774312 1:101788210-101788232 TCTACGTTTGCAGAGAGAGAGGG - Intergenic
915631770 1:157158105-157158127 TCTGTGGCTGCAGAGAGGGAAGG + Intergenic
916213626 1:162377925-162377947 TCTGGGACTCCAGAGAGGCAAGG + Intronic
916943493 1:169700657-169700679 TTTTCCTCTCCAGTGACGGATGG + Intronic
920266935 1:204730976-204730998 TCTTCCTCCCCACAGAGGGGTGG - Intergenic
922996269 1:229964254-229964276 TCTTTGTCTCCAGGGTGGCAGGG + Intergenic
923278364 1:232417938-232417960 GCTTCCCCTCCAGTGAGGGAAGG - Intronic
1066242772 10:33554052-33554074 TCTCCTTCGGCAGAGAGGGAGGG - Intergenic
1071753851 10:88513261-88513283 TGTTTGTGTCCAGATAGGGAAGG - Intronic
1072238783 10:93475985-93476007 CCTTGTTCTCCAGAAAGGGATGG + Intronic
1074500804 10:114022535-114022557 TCTTCACTTCCAGGGAGGGAGGG - Intergenic
1076198261 10:128536444-128536466 GATTCATGTCCAGAGAGGGACGG + Intergenic
1076634995 10:131876049-131876071 TCTTCAGGCCCAGAGAGGGAGGG + Intergenic
1076646335 10:131957506-131957528 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646361 10:131957616-131957638 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646381 10:131957690-131957712 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646411 10:131957800-131957822 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646440 10:131957907-131957929 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646469 10:131958018-131958040 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646490 10:131958092-131958114 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646499 10:131958128-131958150 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646534 10:131958278-131958300 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646544 10:131958315-131958337 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646582 10:131958463-131958485 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646594 10:131958500-131958522 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646604 10:131958537-131958559 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646634 10:131958648-131958670 TCTTCATCTCCACAGGGGGATGG - Intronic
1076646681 10:131958833-131958855 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646689 10:131958870-131958892 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646707 10:131958944-131958966 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646715 10:131958981-131959003 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646723 10:131959018-131959040 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646733 10:131959055-131959077 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646741 10:131959092-131959114 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646749 10:131959129-131959151 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646777 10:131959240-131959262 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646785 10:131959277-131959299 CCTTCATCTCCACAGGGGGACGG - Intronic
1076646793 10:131959314-131959336 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646803 10:131959351-131959373 CCTTCATCTCCACAGGGGGATGG - Intronic
1076646811 10:131959388-131959410 CCTTCATCTCCACAGTGGGATGG - Intronic
1076646819 10:131959425-131959447 CCTTCATCTCCACAGGGGGATGG - Intronic
1078908777 11:15711762-15711784 TCTTCGTCTACAAAGTGGGAGGG + Intergenic
1080370389 11:31633001-31633023 TTGTAGTCTCCATAGAGGGAGGG + Intronic
1080863343 11:36170025-36170047 TCTGGGGATCCAGAGAGGGAAGG - Intronic
1080955374 11:37087876-37087898 TCTTCATCTCCAGAGAGACGGGG - Intergenic
1083592267 11:63902737-63902759 TCTTCCTCTCCAGACCGGGCAGG - Exonic
1085404742 11:76255094-76255116 TGTGCCTCTCCAGAGAGGGGAGG + Intergenic
1086380306 11:86245320-86245342 TTCTCGTCTCCAGAGAGGTCTGG - Exonic
1089252561 11:117175450-117175472 CCTGCGTCTACAGAGTGGGAGGG - Intronic
1090662282 11:128890879-128890901 TCGCCGTTTCCCGAGAGGGATGG - Intergenic
1091172763 11:133532881-133532903 TCCTAGTCTCCAGGCAGGGATGG + Intergenic
1092109688 12:5950342-5950364 TCTCGGTCCCCAGAGAGGCAGGG - Intronic
1093612070 12:21173116-21173138 TCTTCATCTTGAGAGAGGGGAGG - Intronic
1093928021 12:24927886-24927908 TGATCTTCTCCAGATAGGGATGG - Intronic
1094286558 12:28800854-28800876 TCCTTATCTCCAAAGAGGGAGGG - Intergenic
1096699197 12:53371285-53371307 TCTTGGGCTCGAGGGAGGGAGGG + Intergenic
1097208125 12:57341423-57341445 TCTTTTTCTTCTGAGAGGGAGGG - Intronic
1101740707 12:107497775-107497797 TCTTCTTCTCCTGAGATGGTGGG + Intronic
1102718923 12:114999670-114999692 TCTTCAACTCCAGAGTAGGACGG + Intergenic
1107544861 13:41426120-41426142 TCGTCGTATCCAGGGGGGGAGGG + Intergenic
1109244229 13:59933371-59933393 TCTTTGTCACCACAGGGGGAGGG - Intronic
1111533883 13:89576352-89576374 TCTTGGTTTCCAGAGAGAAATGG - Intergenic
1118829375 14:69415746-69415768 TCTTCCTCTCCAAACAAGGAGGG + Intronic
1119710760 14:76821506-76821528 TCTGTGACTCCAGAGAGTGAGGG + Intronic
1121292164 14:92784954-92784976 TTTTAGTCTCCAGAAAAGGAGGG - Intergenic
1121715404 14:96070362-96070384 TAACCGTCTCCAGAAAGGGAAGG - Intronic
1121812332 14:96902146-96902168 ACTTCCTCTCCTGAGAGGGCAGG + Intronic
1121869383 14:97393204-97393226 CCTTCTTCACCAGAGGGGGAAGG + Intergenic
1123960509 15:25394392-25394414 TCTTGGTCTCCAGATTGAGAAGG - Intronic
1126565718 15:50096827-50096849 TTTTGGTGTCCAGAGAGGAAAGG - Intronic
1129273063 15:74429444-74429466 TCTTCCTCTGCAGAGATGGAAGG - Intronic
1130989477 15:88867535-88867557 TCTTTCTCTCGGGAGAGGGATGG - Intronic
1131873910 15:96784849-96784871 TCTTCGTATACACAGAGGAAAGG - Intronic
1132255577 15:100373498-100373520 GCGGCGTCTCCAGCGAGGGAAGG + Intergenic
1132684013 16:1154710-1154732 TCTTCCTCTCCAGCCAGGGAAGG - Intronic
1134506365 16:14810787-14810809 TCTGCTTCTCCAGAGAGCGGAGG - Intronic
1134574187 16:15317976-15317998 TCTGCTTCTCCAGAGAGCGGAGG + Intergenic
1134728233 16:16438321-16438343 TCTGCTTCTCCAGAGAGCGGAGG - Intergenic
1134808438 16:17145770-17145792 TCTTAGGCTCCAGACAGGGCAGG + Intronic
1134939206 16:18273505-18273527 TCTGCTTCTCCAGAGAGTGGAGG + Intergenic
1137500050 16:49003970-49003992 TCTGGATCTCCAGAAAGGGAAGG - Intergenic
1137574666 16:49590866-49590888 ACTCTGTCTCCAGAGAAGGAGGG + Intronic
1139214523 16:65114321-65114343 TGTCCTTCTCCAGAGAGTGAAGG + Intronic
1139669057 16:68479335-68479357 TCTTGGTCCCCTGAGAGGAAGGG - Intergenic
1140254090 16:73320007-73320029 TCTTTATCTCCAGAGAGAGCTGG + Intergenic
1141626997 16:85266649-85266671 CCTACCTCTCCAGGGAGGGAAGG + Intergenic
1142187680 16:88702153-88702175 TGTGCGTCTGCAGAGCGGGAGGG - Intronic
1142385962 16:89764926-89764948 TCTGTGTGTCCAGAGAGAGAGGG + Exonic
1144046190 17:11456705-11456727 TCTTCGTGTGCAGAGGGGGGCGG - Intronic
1145276399 17:21433923-21433945 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1145314234 17:21719816-21719838 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1145712687 17:26991795-26991817 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1146268190 17:31467018-31467040 TTTTCTTCTCCAGACAGGGAAGG - Intronic
1150690021 17:67357527-67357549 TCTGCTTTTCCAGAGAGAGAAGG + Exonic
1152712404 17:81879504-81879526 TCCCAGTCTCCAGTGAGGGAGGG + Intergenic
1153756899 18:8293378-8293400 TCTGTGTGTCCAGAGAGGGCAGG + Intronic
1157587716 18:48815735-48815757 TCAGCATCTCCAGAGATGGAAGG - Intronic
1160503427 18:79413725-79413747 TCTTCGTCTCCTGGGCGGCAAGG + Intronic
1161766382 19:6211197-6211219 TCTTAGTTTCCAGAGAAGAAAGG + Intergenic
1163753363 19:19091956-19091978 TCTTCCTCTTGAGACAGGGAGGG + Intronic
1167300385 19:48674287-48674309 GCTCAGTGTCCAGAGAGGGAGGG + Intergenic
926914731 2:17880196-17880218 TCTTCGGCTCCAGATATGCAGGG - Intronic
929268907 2:39950970-39950992 ACTCCATCTCCAGGGAGGGAGGG + Intergenic
929468987 2:42171710-42171732 CCTGCATCTGCAGAGAGGGAAGG + Intronic
930124019 2:47782812-47782834 GCTTCCGCTCCAGAGAGGCAGGG + Intronic
930743124 2:54853839-54853861 TCCTTGTCTCAAGAGAGGTAAGG + Exonic
931753464 2:65350901-65350923 TCTTCAGCTCCTGAGAGGGCTGG - Intronic
932502489 2:72195600-72195622 TCATTTTGTCCAGAGAGGGAGGG - Intronic
934074541 2:88416574-88416596 CCTTCGCCTGCAGAGAGAGAGGG - Intergenic
934975293 2:98797961-98797983 TCACTGTCTCCAGAAAGGGAAGG - Intronic
944685971 2:202118145-202118167 TCTTCCTATCCAGAGATGGATGG - Intronic
946300727 2:218822577-218822599 TCTTAGTCTCCAGGGATGGATGG - Exonic
946841104 2:223821096-223821118 GCTTCTGCTCCAGGGAGGGAAGG - Intronic
1169244305 20:4014084-4014106 TCCTCATCTCCAGAGAGAGAAGG - Intronic
1171364703 20:24615839-24615861 CCTTCCTCTACAGAGAGGGGCGG - Intronic
1172061078 20:32187968-32187990 TCTTCGTCTCCAGAGAGGGAGGG - Intergenic
1172801198 20:37577456-37577478 TCTTAGTGCCCAGAGAGGGAAGG - Intergenic
1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG + Intergenic
1179827487 21:43974805-43974827 TCTTTGTCTACAGTGAGGGGAGG - Intronic
1180898184 22:19352483-19352505 TCGTGGTCTGCAGGGAGGGAGGG + Intronic
1183031031 22:35104686-35104708 TCTTCAGCCCCAGAGTGGGAAGG - Intergenic
1184159963 22:42692272-42692294 TCTTCCTCTCCAGAGATGCCAGG - Exonic
1184298188 22:43539550-43539572 TTTTTGTCTGCAGAAAGGGATGG - Intronic
1184798828 22:46747980-46748002 TCTTCTTCCACAGAGAGGAAGGG + Intergenic
1184968894 22:48001292-48001314 TCATCAGGTCCAGAGAGGGAAGG + Intergenic
949931230 3:9079957-9079979 TCTTCATCACCAGAGCTGGAGGG - Intronic
950116017 3:10450718-10450740 TCCTGGGCTCCAGAGAGGGACGG - Intronic
952479766 3:33749116-33749138 TTTTCCTCTCCAGAAAGGGATGG + Intergenic
954453738 3:50585797-50585819 TCTTTTTTCCCAGAGAGGGATGG + Intergenic
954689030 3:52386087-52386109 TCTTAGTCTCCCCAGATGGAAGG - Intronic
954761524 3:52878125-52878147 TCTTCTTCTCAAGATAGGGGAGG - Intronic
954916210 3:54150428-54150450 TGCCCTTCTCCAGAGAGGGAAGG - Intronic
955396566 3:58561947-58561969 TCTTCATCTGCAGAGTGGGGAGG + Intergenic
960136212 3:114108255-114108277 TCTCCCTCTCCAGAGAGAGATGG + Intergenic
962503333 3:136018476-136018498 TCTTCGTTTTCAAAGGGGGAAGG + Intronic
964192296 3:154017076-154017098 TCTTCATCTCTAGAGAGGAAAGG + Intergenic
966822113 3:183933298-183933320 TCTTCGTCCCCTGTGAGTGATGG - Intronic
966911951 3:184564703-184564725 CCTGCAGCTCCAGAGAGGGAAGG + Intronic
967855632 3:194115342-194115364 GTTTCTCCTCCAGAGAGGGATGG - Intergenic
970164163 4:13218688-13218710 TCTTTGTCTGCTGTGAGGGATGG + Intergenic
970188402 4:13485916-13485938 TCTTCATCTGCAGAGAGGGCTGG + Intergenic
971581841 4:28351661-28351683 ACTTCCTCTCCAGGGAGGCATGG + Intergenic
972424036 4:38915950-38915972 TCTGGGCCTCCAGAGAGGGAGGG + Intronic
974429057 4:61772676-61772698 TCTTTATCTCCAAAGATGGAGGG - Intronic
981825596 4:148937202-148937224 GCTTCTTCTCCACAGAGGTATGG - Intergenic
982395089 4:154907565-154907587 GCTTCGGCTCCTGAAAGGGAAGG - Intergenic
986154265 5:5158206-5158228 TCTTTGTCTATTGAGAGGGAGGG - Intronic
986939629 5:12935360-12935382 TCTTTGCCTCCAGAGTTGGATGG + Intergenic
987627622 5:20422991-20423013 TCTTTCTCTCCAGAGAGGGGAGG - Intronic
988533345 5:32043988-32044010 TCTTCCTCTCTTGAGATGGAAGG - Intronic
989535386 5:42557678-42557700 TCTTCATTTACAGAGAGGGTGGG - Intronic
993379510 5:87190381-87190403 TCCTGGCTTCCAGAGAGGGAAGG - Intergenic
993538518 5:89118994-89119016 TGTACATCTCCAGAGAAGGAAGG + Intergenic
993655730 5:90575931-90575953 TCTTCTGCTCCAGTGAGGGGAGG - Intronic
997487139 5:134240715-134240737 TCTTTTACTGCAGAGAGGGAAGG - Intergenic
997685434 5:135785310-135785332 TCGTAATCTCCAGGGAGGGAGGG + Intergenic
998526813 5:142850041-142850063 TCTCTGTCTCCACAGAGGAAGGG - Intronic
1001483344 5:172103255-172103277 TTTTCCTCTCCAGTGAGAGAGGG - Intronic
1005894311 6:30164495-30164517 TCTTCTTCTTGAGAAAGGGAGGG + Intronic
1006321027 6:33319564-33319586 TGTCCGTCTCCACAGAGGAAGGG + Exonic
1011781100 6:90790246-90790268 TCTTCTTTGTCAGAGAGGGAAGG + Intergenic
1014906639 6:127038045-127038067 ACTTCGTCTCCAGGGAAGTATGG + Intergenic
1015101118 6:129481892-129481914 TCTTTGTGTCCAGAGAGGATGGG - Intronic
1015590793 6:134821120-134821142 TCTTCTTCTCAAGATTGGGAGGG + Intergenic
1017118587 6:151002599-151002621 TTTTCTTCTCCAGAGAGTGCTGG + Intronic
1017587287 6:155940966-155940988 TCTCCGTCTCCAGCCAGGGTAGG + Intergenic
1018309490 6:162493192-162493214 TCTTCCTCTACATAAAGGGATGG - Intronic
1018481310 6:164193804-164193826 TGTCCGTCTCTAGAGAGGGAAGG + Intergenic
1019811413 7:3167869-3167891 ACTTGCTCCCCAGAGAGGGAGGG + Intronic
1022815635 7:33911697-33911719 TCTTCATCTGGAGAGTGGGATGG + Intronic
1022986124 7:35655748-35655770 TCTTTATCTACAAAGAGGGATGG - Intronic
1030891298 7:115002613-115002635 TCTTCTTCCCCTGAGGGGGAGGG - Intronic
1032474789 7:132204308-132204330 TCTCAGTCTCCAGAGAAAGAGGG + Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035381743 7:158445141-158445163 GCTTTGTCTCCAGAGGGGGCAGG + Intronic
1036273838 8:7333151-7333173 TCTTTGTCTCCAGAGGGCGCCGG + Intergenic
1036274419 8:7337879-7337901 TCTTTGTCTCCAGAGGGCGCCGG + Intergenic
1036346929 8:7972467-7972489 TCTTTGTCTCCAGAGGGCGCCGG - Intergenic
1036347508 8:7977199-7977221 TCTTTGTCTCCAGAGGGCGCCGG - Intergenic
1036842815 8:12137974-12137996 TCTTTGTCTCCAGAGGGCGCCGG - Exonic
1036864093 8:12379478-12379500 TCTTTGTCTCCAGAGGGCGCCGG - Intergenic
1040632530 8:49232279-49232301 GTTTCGTCTCAAGAGTGGGAGGG + Intergenic
1041601284 8:59719667-59719689 TCTTCCATTCCAGAGTGGGAAGG - Intergenic
1045548092 8:103146271-103146293 TGTTCCTCTCCAGGGTGGGAGGG - Intronic
1049012529 8:139896934-139896956 TCTCTGTCTCCTGAGAGGCAGGG - Intronic
1049194709 8:141308686-141308708 CCTGCGGCTGCAGAGAGGGATGG - Intergenic
1053628471 9:39902676-39902698 TGTTAGTCTGCTGAGAGGGATGG + Intergenic
1053777594 9:41563666-41563688 TGTTAGTCTGCTGAGAGGGATGG - Intergenic
1054215416 9:62348025-62348047 TGTTAGTCTGCTGAGAGGGATGG - Intergenic
1054672065 9:67807322-67807344 TGTTAGTCTGCTGAGAGGGATGG + Intergenic
1055573807 9:77643210-77643232 TTTTCTTCTTCAGAGTGGGAAGG + Intronic
1056560456 9:87725499-87725521 GCTGCGTCTCCAGAGAGCGCGGG - Exonic
1058718419 9:107742125-107742147 TCTCCCTTTCCAGAGAGGCAGGG + Intergenic
1059346357 9:113631640-113631662 TCTGCCTCCCCAGAGAGGGCTGG + Intergenic
1060512315 9:124242991-124243013 TCTTCCTCTCCGGTGAGGGCTGG + Intergenic
1061885033 9:133587155-133587177 GCTTGGACTCCAGACAGGGATGG - Intergenic
1188938529 X:36208037-36208059 TCTTCTTCTCCCAAGAGAGAAGG - Intergenic
1189017923 X:37303459-37303481 TCCGCGTCTCCAGACAGGAAGGG + Intergenic
1190874946 X:54453131-54453153 TCATCATCTGCAGAGAGGAAAGG - Intronic
1191105400 X:56769139-56769161 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1191106393 X:56774541-56774563 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1191107386 X:56779943-56779965 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1194756039 X:97741200-97741222 GCCCCTTCTCCAGAGAGGGAGGG - Intergenic
1198081767 X:133246835-133246857 TCTTCATTTCCAGGGAGAGAGGG + Intergenic
1199675904 X:150189221-150189243 TCTACCTCCCCAGAGAGGCAGGG + Intergenic
1199758284 X:150885143-150885165 TCTACCTCTACAGGGAGGGAGGG + Intronic