ID: 1172061360

View in Genome Browser
Species Human (GRCh38)
Location 20:32189459-32189481
Sequence GAGTCGCAATAGACACCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172061358_1172061360 -6 Left 1172061358 20:32189442-32189464 CCAGTGCCATCGGATGCGAGTCG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1172061346_1172061360 30 Left 1172061346 20:32189406-32189428 CCGGTTCCTGTGTACGAGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1172061357_1172061360 -5 Left 1172061357 20:32189441-32189463 CCCAGTGCCATCGGATGCGAGTC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1172061351_1172061360 24 Left 1172061351 20:32189412-32189434 CCTGTGTACGAGGGCCGGGGGTT 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1172061353_1172061360 10 Left 1172061353 20:32189426-32189448 CCGGGGGTTCCTGGCCCCAGTGC 0: 1
1: 1
2: 1
3: 43
4: 473
Right 1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1172061356_1172061360 -4 Left 1172061356 20:32189440-32189462 CCCCAGTGCCATCGGATGCGAGT 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 43
1172061355_1172061360 1 Left 1172061355 20:32189435-32189457 CCTGGCCCCAGTGCCATCGGATG 0: 1
1: 0
2: 0
3: 16
4: 157
Right 1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172061360 Original CRISPR GAGTCGCAATAGACACCACT CGG Intergenic
908157670 1:61371776-61371798 GTGTCTCAATAGACAAAACTAGG - Intronic
911264033 1:95722347-95722369 GAGTGGTAATATATACCACTGGG + Intergenic
915242455 1:154533037-154533059 GGGTGTCAATAGAAACCACTTGG - Intronic
916973021 1:170044440-170044462 GAGTCACAGTAGTCATCACTGGG - Intronic
1064590586 10:16886568-16886590 GACTGACAATAGACACCACTTGG - Intronic
1066647373 10:37623548-37623570 GACTAGCATTAGACACCACAAGG - Intergenic
1068523593 10:58104374-58104396 GAGTGGCCAGAGACACCATTTGG - Intergenic
1068665008 10:59664473-59664495 TAGCCCCAATAGACACCATTGGG + Intronic
1070448793 10:76536279-76536301 GAGTTACAAGAGACACCATTGGG - Intronic
1075419344 10:122289109-122289131 GAGTGACAATAGCCACCACAGGG + Intronic
1086986833 11:93260370-93260392 GAGTGGAAATATACATCACTTGG + Intergenic
1092928559 12:13294207-13294229 GAGTTGGAATAGACAACACTGGG - Intergenic
1092992028 12:13912244-13912266 GAGTGGCAAGAGACCCCAGTTGG - Intronic
1097477858 12:60081281-60081303 GAGTCTCAGTAGACAGCACATGG + Intergenic
1103165647 12:118768175-118768197 TAGTTGCAATAGACACCGCGTGG - Intergenic
1104392097 12:128399953-128399975 GAGTTGCAATGGAGACCATTTGG + Intronic
1107302074 13:38976443-38976465 GACTCTCAATAGGCACCACCAGG + Intronic
1113664677 13:112132999-112133021 GGGTTAGAATAGACACCACTGGG - Intergenic
1119009557 14:70970715-70970737 GAGTAGCAAGAGAGACCACATGG - Intronic
1122071253 14:99206885-99206907 TAGTTGCAAGAGAGACCACTTGG + Intronic
1126525964 15:49654541-49654563 GAGTCCCTAGAGACACCACATGG + Exonic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1152557056 17:81058683-81058705 GAGTCGCTGGAGAAACCACTTGG + Intronic
1164761878 19:30734348-30734370 GATTTGCATTAGATACCACTCGG + Intergenic
930680789 2:54255173-54255195 GAGTGGAAAAAGACACCACTTGG + Exonic
940830228 2:158457625-158457647 AAGTCGCCCTCGACACCACTGGG + Intronic
942733670 2:179086126-179086148 GAGTAGGAATAAATACCACTTGG + Intergenic
947437612 2:230085941-230085963 TAGTTGCAATAGAGACCACATGG + Intergenic
1170909377 20:20549502-20549524 AAGTCGCCAAAGACAGCACTGGG + Intronic
1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG + Intergenic
949777339 3:7647636-7647658 GAGTAATAATAGAGACCACTAGG + Intronic
949894412 3:8758588-8758610 GAGTCTCAATATACACTACAGGG + Intronic
984835663 4:184017919-184017941 GGGTCGCAATGGAGATCACTGGG + Exonic
987986568 5:25154664-25154686 GAGTTGCAGCAGAAACCACTGGG + Intergenic
1000391040 5:160723849-160723871 GAGTCGCAATAGAAAAGACATGG + Intronic
1001910249 5:175510899-175510921 TAATTGCAATAAACACCACTTGG - Intronic
1008090097 6:47285052-47285074 GAGTCCCAAGAGACAGGACTTGG + Intronic
1011043748 6:83059565-83059587 GTGCCGCAAGAGATACCACTGGG + Intronic
1013990890 6:116253024-116253046 GAGTGGAAAGAGACACCACCCGG + Exonic
1013993243 6:116278771-116278793 GAGTAGAAAGAGACACCACTCGG + Exonic
1024963053 7:54997354-54997376 GAGTCGCAACAGAGACCGCATGG - Intergenic
1037237989 8:16743401-16743423 GATTCTCAACAGACAGCACTGGG + Intergenic
1045316882 8:101051260-101051282 GAGGCGCAATAGACAAAACTTGG + Intergenic
1186740018 X:12507324-12507346 GAGTCACAACAGAGACCACATGG - Intronic
1189606577 X:42684304-42684326 ATGTAGCAATAGACACCACAGGG - Intergenic
1192247137 X:69382916-69382938 GAGTCACAAGAGAAACCATTTGG - Intergenic
1192509938 X:71715705-71715727 GCCTCACATTAGACACCACTAGG - Intronic
1192516759 X:71765848-71765870 GCCTCACATTAGACACCACTAGG + Intronic
1193600164 X:83501458-83501480 GTGTCGCAATAGAATCCATTTGG + Intergenic