ID: 1172062062

View in Genome Browser
Species Human (GRCh38)
Location 20:32193440-32193462
Sequence CTGCATCATCTTGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 2, 1: 1, 2: 4, 3: 24, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172062062_1172062067 1 Left 1172062062 20:32193440-32193462 CCTCCCACCTCAAGATGATGCAG 0: 2
1: 1
2: 4
3: 24
4: 204
Right 1172062067 20:32193464-32193486 GATCCTTTGAGCTGACACCTGGG 0: 3
1: 0
2: 0
3: 8
4: 93
1172062062_1172062070 24 Left 1172062062 20:32193440-32193462 CCTCCCACCTCAAGATGATGCAG 0: 2
1: 1
2: 4
3: 24
4: 204
Right 1172062070 20:32193487-32193509 CATGTCATCCCCTTACCCCCAGG 0: 2
1: 1
2: 0
3: 13
4: 263
1172062062_1172062066 0 Left 1172062062 20:32193440-32193462 CCTCCCACCTCAAGATGATGCAG 0: 2
1: 1
2: 4
3: 24
4: 204
Right 1172062066 20:32193463-32193485 AGATCCTTTGAGCTGACACCTGG 0: 3
1: 0
2: 1
3: 3
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172062062 Original CRISPR CTGCATCATCTTGAGGTGGG AGG (reversed) Exonic
900532059 1:3159347-3159369 CTCCACCATCTGGAGGTGGGAGG + Intronic
900737129 1:4306068-4306090 CTGGGTGGTCTTGAGGTGGGAGG - Intergenic
900909211 1:5582868-5582890 CTGCATCATCCTATGGTGGAAGG - Intergenic
903015328 1:20357964-20357986 CTGCATCTGCATGTGGTGGGAGG - Intergenic
904475216 1:30760435-30760457 ATTCAGGATCTTGAGGTGGGTGG + Intergenic
905018841 1:34794837-34794859 CTTCATCATCTTCATGTTGGTGG + Exonic
908034498 1:60037471-60037493 CTGCATCATTCTGTGGTGGAAGG + Intronic
909101549 1:71355580-71355602 TTGCATCATGTTGAGGTTTGGGG + Intergenic
912070264 1:105800773-105800795 CTGCATCTTCTTCAGGTGCGTGG + Intergenic
915114107 1:153584332-153584354 CTGTATTATCTGGAGGTTGGTGG - Intergenic
916351715 1:163857354-163857376 CTTCATCAAATTGGGGTGGGCGG - Intergenic
922175527 1:223194224-223194246 CTGCAGCATCTCGTGGTGGAAGG + Intergenic
924726162 1:246673106-246673128 CTGCATCATCCCGTGGTGGAAGG - Intergenic
1064319718 10:14293297-14293319 TTGCATCATCCTGTGGTGGAAGG - Intronic
1064323370 10:14327042-14327064 CTGGACCATCTTGAGGTGGGAGG - Intronic
1065660429 10:27999694-27999716 ATGCACTATCTTGGGGTGGGGGG + Intergenic
1066122898 10:32308460-32308482 TTTCATAATCTTGAGGTGGGAGG - Intronic
1067415264 10:46097638-46097660 CTGCCGCATCTTGAGCTAGGGGG - Intergenic
1067435305 10:46272709-46272731 CTGCCACATCTTGAGCTAGGGGG - Intergenic
1070718336 10:78738917-78738939 CTGCATCAGCTTTAGGTATGAGG - Intergenic
1070753692 10:78978496-78978518 CAGCATCAGCCTCAGGTGGGAGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075754447 10:124800047-124800069 CTGTAGCGTCTTGGGGTGGGAGG - Intergenic
1076209572 10:128629576-128629598 CTGCATCTTCTTGAAGAAGGTGG + Intergenic
1076810201 10:132882479-132882501 CTGCAACATCTCGAGGGGGAAGG + Intronic
1076890593 10:133281265-133281287 CAGCGTCATCTCCAGGTGGGTGG - Exonic
1078555108 11:12318743-12318765 CTGCATCATGTTGATGTGTAGGG + Intronic
1082283341 11:50295917-50295939 CTGCTTCTACTTGAGGTAGGAGG + Intergenic
1084044338 11:66560157-66560179 CTCCATCCGCTAGAGGTGGGAGG - Exonic
1085297867 11:75441150-75441172 CTGGATCATGGTGAGTTGGGGGG - Exonic
1087912631 11:103771243-103771265 CTGCAGCATCTTGAGAAGGTGGG + Intergenic
1089950734 11:122523787-122523809 CTGCCTCATATCAAGGTGGGAGG + Intergenic
1091891841 12:4062184-4062206 TGGCATAATTTTGAGGTGGGTGG + Intergenic
1094430057 12:30358484-30358506 CTGAATCGTGTTGAAGTGGGTGG + Intergenic
1096673424 12:53213692-53213714 ACGCAGCATCTGGAGGTGGGGGG + Exonic
1098012632 12:66071140-66071162 CAGCAGCATCCTGAGGTGGAGGG - Intergenic
1098179754 12:67833226-67833248 CTGCATTGTCTGGTGGTGGGAGG - Intergenic
1101855791 12:108441680-108441702 CAACATTACCTTGAGGTGGGAGG + Intergenic
1102845981 12:116182822-116182844 CTGCAGGAACTTCAGGTGGGAGG - Intronic
1104464335 12:128978435-128978457 CGGCATCGTCCTGAGGTCGGTGG + Intronic
1104522106 12:129485561-129485583 CTGCCTCATCCTCAGGTGGGTGG - Intronic
1104653605 12:130556703-130556725 TGGCACCATCTTGAGTTGGGAGG - Intronic
1106110926 13:26776219-26776241 CTGCATCATCCTGTGGTGGGAGG - Intergenic
1106198625 13:27516366-27516388 CTTGATCATCTTGAAGTGGATGG - Intergenic
1107443486 13:40449172-40449194 TTGTCTCATCTGGAGGTGGGAGG - Intergenic
1107581687 13:41795781-41795803 CTGGAGCCTCTTGAGGTGGGCGG + Intronic
1108591661 13:51917900-51917922 CTGAAACATCTAGAGGTGGGAGG - Intergenic
1109602383 13:64649226-64649248 CTGCATCATCTAATGGTGGAAGG - Intergenic
1112438412 13:99408066-99408088 CTGCTTGATGTTGAGGTGGTAGG + Intergenic
1112505599 13:99972990-99973012 CTGCATCACTTTTTGGTGGGCGG + Intergenic
1112784537 13:102937715-102937737 CTGCTTCATCCTGAGTTAGGAGG + Intergenic
1113925691 13:113940294-113940316 CTGGCTCATCTGGGGGTGGGGGG - Intergenic
1114258011 14:21018765-21018787 CTGCATCTTCATGAGGTGCTTGG + Exonic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1116587108 14:46720427-46720449 CTTAAGCATCTTGAGATGGGGGG - Intergenic
1121020626 14:90578112-90578134 CTGCATGCTCTTCACGTGGGTGG + Exonic
1121640752 14:95483313-95483335 CTGGGTCAGCTTGTGGTGGGCGG - Intergenic
1121838020 14:97109330-97109352 ATGCACCATCTTGAGGTAAGGGG + Intergenic
1124499256 15:30212315-30212337 CTGGCTCATCTTGGGGCGGGTGG - Intergenic
1124744323 15:32326355-32326377 CTGGCTCATCTTGGGGCGGGTGG + Intergenic
1126336516 15:47591152-47591174 CTGCATCCTCATGAGGTGGGAGG + Intronic
1126839461 15:52702691-52702713 CTGCATGATACTGAGGTGTGGGG - Intronic
1127365746 15:58288029-58288051 ATCCATAATGTTGAGGTGGGGGG + Intronic
1127368162 15:58310520-58310542 CAGCAGCATCTTGAGGGGTGAGG + Intronic
1128239961 15:66095147-66095169 CTGCAGCCTCCTGAGGTGGGAGG + Intronic
1128752487 15:70159324-70159346 CTGCAGCATCTGCAGGTGGGGGG - Intergenic
1130065849 15:80604443-80604465 CTGCCTCATCCTGAGGGGAGAGG + Intergenic
1131360127 15:91783520-91783542 CAGCATGCTCTTGAGGTTGGGGG - Intergenic
1132662585 16:1068245-1068267 CTGGATCCTCCTGGGGTGGGTGG - Intergenic
1132673870 16:1113807-1113829 CTGGATCTTCTCGGGGTGGGGGG - Intergenic
1133813331 16:9177915-9177937 CTGTGTCCTCTTGAGGTGGAAGG + Intergenic
1133906420 16:10026786-10026808 CTGCATTGTTTTGGGGTGGGAGG - Intronic
1134008952 16:10836982-10837004 CTGCTTCCACTTGTGGTGGGAGG - Intergenic
1134256621 16:12617671-12617693 CGGCCCCATCTGGAGGTGGGAGG - Intergenic
1134443086 16:14310890-14310912 CTGCTGCATCATGGGGTGGGGGG + Intergenic
1136531114 16:30870077-30870099 CTGCATCTTCCTAAGGTGGCAGG - Intronic
1137513224 16:49119531-49119553 ATGCAACATTTTGAAGTGGGAGG - Intergenic
1138208585 16:55143812-55143834 CTGCATCATCCTATGGTGGAAGG - Intergenic
1139205686 16:65026263-65026285 CTGCAGCATCTTGATGAGGTGGG + Intronic
1139476057 16:67203143-67203165 CTGCAGCAGCTTGTGGTTGGGGG - Exonic
1139884266 16:70197524-70197546 GTGCAACATCCTGAGGTGCGTGG + Intergenic
1144565505 17:16355716-16355738 CTACATTATCTTGATCTGGGTGG + Intergenic
1145393120 17:22471322-22471344 CTGCATCATCCCGTGGTGGAAGG - Intergenic
1147112474 17:38273549-38273571 CTGCATCATTTTCAGGTGAGTGG - Intergenic
1147393580 17:40123815-40123837 CTGCAGCATCTTTAGATAGGAGG + Intronic
1147953844 17:44121720-44121742 CTGCAGCTACTTGGGGTGGGTGG + Intronic
1148417155 17:47515700-47515722 CTGCATCATTTTCAGGTGAGTGG + Intergenic
1149204126 17:54223851-54223873 CTGCAGTATCTTAAGGTGGCAGG + Intergenic
1149774399 17:59345955-59345977 GTGCAGGATCTAGAGGTGGGTGG - Intronic
1150033332 17:61765049-61765071 CTCCATCATCTCGAGGTGAAAGG - Intronic
1150989466 17:70239323-70239345 CTGCTTCATTCTAAGGTGGGTGG - Intergenic
1151750930 17:76037156-76037178 CTGCAGCATCGTGAGGGGGACGG - Intergenic
1152326649 17:79645459-79645481 CAGCATCATCTTGAAGGGTGGGG - Intergenic
1152722395 17:81929333-81929355 CAGAATCTTCTTGGGGTGGGTGG + Intergenic
1156030427 18:32706793-32706815 CTGCCTCATCTTTAGGGTGGAGG - Intronic
1156875280 18:42003042-42003064 ATGCACCATCTTGAGGTGATGGG + Intronic
1156900798 18:42298381-42298403 CTGCTTGATGCTGAGGTGGGAGG + Intergenic
1157371553 18:47117469-47117491 CTGCATCATCCTGTGGTAGAAGG - Intronic
1158634146 18:59141073-59141095 CTCCATCATGTTGAGATGTGGGG + Intronic
1159783020 18:72681127-72681149 CTACATCTGCTTGAGGTAGGAGG + Intergenic
1160501311 18:79402275-79402297 ATACACCATTTTGAGGTGGGCGG + Intronic
1163321914 19:16579701-16579723 CTTTATCATGTTGGGGTGGGGGG - Intronic
1163795703 19:19336781-19336803 CGTCATCATTCTGAGGTGGGAGG - Intronic
1165302503 19:34979635-34979657 CTGCCTCAACTTTAGGTGTGTGG + Intergenic
1166566624 19:43769552-43769574 CTCCTTCATCTGGGGGTGGGTGG + Exonic
1167690501 19:50981763-50981785 CTACTTCATCTTGCAGTGGGCGG + Exonic
926372503 2:12194128-12194150 CTGCATCATCTTATGGTGGAAGG - Intergenic
927173115 2:20387015-20387037 CTGCAGCATCATGTGGTGGAAGG - Intergenic
927206141 2:20611771-20611793 CTGCCTCACCGTGGGGTGGGGGG - Intronic
927460980 2:23297956-23297978 CGGCCTCATCATCAGGTGGGCGG - Intergenic
930875108 2:56206491-56206513 CTGCATCATCCCATGGTGGGAGG + Intronic
933626075 2:84601128-84601150 CTGGAGCATCTTGAGGTGCTGGG + Intronic
934580083 2:95430783-95430805 CTGGAAGATTTTGAGGTGGGAGG + Intergenic
934599364 2:95645942-95645964 CTGGAAGATTTTGAGGTGGGAGG - Intergenic
934715311 2:96539599-96539621 CTCCATAATCTTGAGGAAGGAGG - Intronic
934928253 2:98397128-98397150 CTGCTTCATCTTCATCTGGGTGG - Exonic
934945820 2:98540644-98540666 CTGCACCATCCTGTGGTGGAAGG + Intronic
936532707 2:113287950-113287972 CTGGAAGATTTTGAGGTGGGAGG - Intergenic
939368388 2:141265140-141265162 CTGCGTCTTCTTGAGGTGACTGG - Intronic
939977867 2:148739993-148740015 CTTCTTTATGTTGAGGTGGGAGG + Intronic
941664608 2:168231878-168231900 CTGCAGCAGCTTGATGTGGGGGG + Intronic
942653558 2:178193593-178193615 CATCATCATCTGGGGGTGGGAGG - Intergenic
943603435 2:189948866-189948888 CTACATAATCTTGAGGTGAAAGG - Intronic
943824440 2:192371146-192371168 CTGTCTCATTTTGTGGTGGGTGG + Intergenic
944363604 2:198890271-198890293 ATTCAGGATCTTGAGGTGGGAGG - Intergenic
946351915 2:219160815-219160837 CTGCCTCCTCTTGCGGTGGGGGG - Exonic
947217126 2:227759703-227759725 GTGCATAGTCATGAGGTGGGGGG - Intergenic
947738089 2:232468900-232468922 CAGCATGAGGTTGAGGTGGGCGG - Intergenic
1169167416 20:3436083-3436105 ATGCATCTTCTGGAGGTGGAAGG + Intergenic
1169188386 20:3639638-3639660 CTTCATCATTTTGGGGAGGGGGG - Intronic
1170420647 20:16189655-16189677 CTGCATCACCTTGAGGACTGAGG - Intergenic
1172062062 20:32193440-32193462 CTGCATCATCTTGAGGTGGGAGG - Exonic
1175086613 20:56464787-56464809 CTGCATCATCCCAAGGTGGAAGG + Intergenic
1180250534 21:46583761-46583783 CTGCATCATCCCATGGTGGGAGG - Intergenic
1181475316 22:23164474-23164496 CTGCATCAACTTGGGGTGGGGGG - Intergenic
1182689716 22:32150559-32150581 CTGGATCATGTGCAGGTGGGCGG + Intronic
950200357 3:11037945-11037967 CGGCAGCAGCTTGGGGTGGGTGG - Exonic
950686445 3:14621872-14621894 CTGCACCTTCTTGAGGTGTAGGG + Intergenic
950971749 3:17196203-17196225 CAGCAGCATCTTGAGATGGAGGG - Intronic
952313438 3:32211307-32211329 CTGCATCATCTCATGGTGGAAGG - Intergenic
952740787 3:36732285-36732307 CTGGATCATCTTGAGGACTGAGG - Intronic
953138523 3:40205147-40205169 CCATATCATCATGAGGTGGGGGG + Intronic
953422373 3:42764511-42764533 CTGCAGCATCTGGAGGTGGCAGG - Intronic
953746723 3:45580033-45580055 CTGCATCATCCTCTGGTGGAAGG - Intronic
954244113 3:49317181-49317203 CTCCAGCATCTTGAGGTAGGTGG + Intronic
957643505 3:82888329-82888351 CTGTGTCATCTTGTGGTGGAAGG + Intergenic
957961031 3:87252784-87252806 ATGCATCATGTTGAGTTGTGGGG - Intronic
958945241 3:100354757-100354779 CTGCATCTTTTTCAGGGGGGAGG + Exonic
960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG + Intronic
960570617 3:119181972-119181994 CTGCATCAACTTGCAGTGTGGGG + Intronic
965658313 3:171014489-171014511 CTGCATCATTCTTTGGTGGGTGG - Exonic
968129617 3:196185159-196185181 CTGCAGCCTCTAGAGCTGGGTGG + Intergenic
968970385 4:3790608-3790630 TAGCATCATGATGAGGTGGGAGG - Intergenic
970121303 4:12755737-12755759 CTGTATCATCTTGTAGTGGAAGG - Intergenic
972232796 4:37094944-37094966 CTGAATCATGATGAGGTGGCAGG + Intergenic
973746482 4:53968222-53968244 CTGAAGCATTCTGAGGTGGGAGG + Intronic
976224536 4:82785128-82785150 CAGCATCATCTGGAGCTGGGGGG - Intronic
976367569 4:84247222-84247244 CTGCATCATCTTGAGGTGGGAGG + Intergenic
979422360 4:120521062-120521084 GTGCATAGTCATGAGGTGGGGGG - Intergenic
984196423 4:176663115-176663137 CTTCATCATCTTGATTTTGGAGG + Intergenic
984414168 4:179435697-179435719 CTGCATCATCGTGACGTGGAAGG - Intergenic
987235326 5:15936466-15936488 CTGCATCAGCTTGACCCGGGAGG + Exonic
987416862 5:17671081-17671103 CTGCATCATCCTGAGGTGGGAGG + Intergenic
988503361 5:31801378-31801400 CTGCAGCATCTTGAGCCTGGTGG - Intronic
989565119 5:42894212-42894234 CTGCGTCTTCTTGAGGTGACTGG - Intergenic
990631798 5:57678672-57678694 CTGACCCATTTTGAGGTGGGAGG + Intergenic
990820972 5:59839987-59840009 CTACATGAGCTTGTGGTGGGGGG + Intronic
990949647 5:61286099-61286121 CTGCATCCTCATGTGGTGGAAGG + Intergenic
993439011 5:87932242-87932264 TTGCAACTTCTTGAGGTGGGAGG + Intergenic
996529844 5:124517030-124517052 CTGCACCATCCTGAGGCTGGGGG + Intergenic
999417263 5:151409291-151409313 CTGCATCTGGTTGGGGTGGGGGG + Intergenic
1001177557 5:169486276-169486298 CTGCATCATGTTGCTGGGGGTGG - Intergenic
1001605105 5:172954227-172954249 CAGCAGCATTTTGAGTTGGGAGG - Intergenic
1002525344 5:179812534-179812556 CTGCGTCTTCTTGAGGTGACTGG + Intronic
1002533815 5:179865152-179865174 CTGCAGCATCTCCTGGTGGGTGG - Intronic
1004039881 6:11965100-11965122 CTGCATCATCCTATGGTGGAAGG + Intergenic
1004981286 6:21027654-21027676 CTGTATCATCCTGTGGTGGAGGG - Intronic
1006313078 6:33275145-33275167 CTGCATCAGCTTGGAGTGGCAGG + Intronic
1008367594 6:50700553-50700575 CTGCATCATCATAAGGTGGAGGG - Intergenic
1008770255 6:54970241-54970263 CTGCATCATGTTGAGTTGCAGGG - Intergenic
1010602895 6:77852678-77852700 CTGCATCCTCATGTGGTGGAAGG + Intronic
1013991265 6:116256762-116256784 GTGTTTCATTTTGAGGTGGGTGG + Intronic
1014802847 6:125796338-125796360 CTGATTTATATTGAGGTGGGTGG - Intronic
1016006444 6:139093552-139093574 ATGTATCATCTTGGTGTGGGGGG + Intergenic
1016779309 6:147940631-147940653 CTGCATCATCTTGTGGTCAAAGG + Intergenic
1017979541 6:159387940-159387962 TTCCAGCATCTTAAGGTGGGAGG + Intergenic
1017996590 6:159536876-159536898 CTGCATCATTATGTGGTGGAAGG + Intergenic
1018966208 6:168491017-168491039 CTGCATCATCTTGTGCAAGGGGG + Intronic
1019791289 7:3015581-3015603 CTGCAACATATGGATGTGGGGGG + Intronic
1020080931 7:5285278-5285300 CTGCCACATCTGGAGCTGGGGGG - Intronic
1020573122 7:9890891-9890913 CTGGGTCACCTGGAGGTGGGTGG - Intergenic
1021112529 7:16711915-16711937 CTGAATCAGCATGAGCTGGGAGG - Intergenic
1022275161 7:28847756-28847778 CTGCATCAGCTGGAGCTGGGAGG + Intergenic
1022752974 7:33251578-33251600 ATGCATCATCATGATGTGTGTGG + Intronic
1023916851 7:44596436-44596458 TTGCAACATCCTGAGATGGGGGG - Intergenic
1026053719 7:66967400-66967422 CATCATCATCTTGAGGTGCAGGG - Intergenic
1026884971 7:73935439-73935461 CTGCATTATCTGGGGGTGGTGGG + Intergenic
1027573059 7:79896048-79896070 CTTCATGATCTTTAGGTAGGAGG + Intergenic
1027609433 7:80341205-80341227 ATACATCATCTTGAGATGAGTGG + Intergenic
1028107879 7:86902117-86902139 CTGCATCCTCATGTGGTGGAAGG + Intronic
1028893087 7:96010385-96010407 TTGCAGGATCTTGAGGTAGGAGG - Intronic
1030941031 7:115650257-115650279 TTGCATCATCTGGCAGTGGGTGG + Intergenic
1033284023 7:140025575-140025597 CTGCACCATTTTCAGGTAGGTGG - Intronic
1036177103 8:6549589-6549611 CTTCTGCATCTTGAGTTGGGCGG + Intronic
1036586783 8:10131763-10131785 CTGCCTCTTCCTGAGCTGGGAGG + Intronic
1044654253 8:94530984-94531006 CTTCATCATCATCAGGTGGAGGG + Exonic
1044657795 8:94566298-94566320 CCGCATCATCATGTGGTGGAAGG - Intergenic
1045557832 8:103231885-103231907 CTGCATTAGCTGGAGCTGGGAGG + Intergenic
1047020035 8:120765560-120765582 CTGCATCATCCTATGGTGGGAGG + Intronic
1047758965 8:127939975-127939997 CTGCATTTTGTGGAGGTGGGTGG + Intergenic
1048927019 8:139280553-139280575 CTGCATCCTCATGTGGTGGAAGG + Intergenic
1049233336 8:141495461-141495483 CTGCAGCATCTTGAAGCCGGTGG + Intergenic
1049274043 8:141710918-141710940 GTGCATCATCTTGTGCTGTGTGG - Intergenic
1049677763 8:143900072-143900094 CTGCTTCATCTTCGGGTGGGTGG - Intergenic
1050055395 9:1647701-1647723 ATGCAGCATCTTTAGGTGTGAGG + Intergenic
1050269587 9:3928025-3928047 CACCATCATTTTGAGGTGTGAGG + Intronic
1050607994 9:7321158-7321180 CTGCATCATCTTCAGCTGTTTGG + Intergenic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1055094733 9:72400359-72400381 CTGCGGCCTGTTGAGGTGGGTGG + Intergenic
1055120307 9:72652443-72652465 CTTCAGCATTTAGAGGTGGGTGG + Intronic
1056386542 9:86101563-86101585 CTGCATCAGCCTGTGGTGGAAGG + Intergenic
1058485071 9:105435478-105435500 GTGCATAGTCATGAGGTGGGGGG + Intronic
1058896110 9:109401891-109401913 CTGCAGCAACTGGAGGTGAGGGG - Intronic
1060044764 9:120331159-120331181 CTGCATTATGTTGTGTTGGGAGG - Intergenic
1061346575 9:130031037-130031059 CTTGAACATCTTGAAGTGGGAGG + Intronic
1062131443 9:134896196-134896218 CTGCCACATCTTGGGGTGGGCGG - Intergenic
1062185198 9:135214527-135214549 GGGCAGCATCTTGGGGTGGGAGG + Intergenic
1185790689 X:2926874-2926896 CTGCCTGATTCTGAGGTGGGAGG + Intronic
1190247210 X:48698514-48698536 CTGCATCCTACTGAGATGGGGGG + Intronic
1196541023 X:116908383-116908405 CTGCTTCTTCTTGGGGGGGGCGG + Intergenic
1196978043 X:121181304-121181326 CTGCTGCCTTTTGAGGTGGGGGG + Intergenic
1197328634 X:125125733-125125755 CTGCACTATCTTGAGGAGGCAGG + Intergenic
1197401314 X:125994842-125994864 CTGCATCATCCTGTGGTGGAAGG + Intergenic
1198376177 X:136042111-136042133 CTTCAACATCTTTTGGTGGGGGG + Intronic
1201481240 Y:14441522-14441544 ATGCATCATCTTGTGATGGAAGG - Intergenic