ID: 1172066727

View in Genome Browser
Species Human (GRCh38)
Location 20:32226589-32226611
Sequence GTGTATATGTTTAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172066727 Original CRISPR GTGTATATGTTTAGGGAGGT GGG (reversed) Intronic
900753144 1:4412615-4412637 GTCTATATTCTTTGGGAGGTAGG + Intergenic
901474178 1:9478113-9478135 GTGTATATGTGTATGTATGTTGG - Intergenic
901504729 1:9677242-9677264 GTGTGTGTGTTTTGGGAGGGAGG + Intronic
908222757 1:62024647-62024669 GTGTGTGTGTGTTGGGAGGTGGG - Intronic
908404943 1:63805403-63805425 GTCTACATGTTTCTGGAGGTAGG - Intronic
908708654 1:66990692-66990714 GTGTATATGTATAGTTAGTTAGG + Intergenic
908822989 1:68106746-68106768 GTGTGTATGTGTGGGTAGGTGGG + Intronic
908995418 1:70146736-70146758 GTGTTAATGTTTTGGGAGGCAGG - Intronic
909611610 1:77557058-77557080 GTGTATATGTGGGGGGAGGTAGG - Intronic
909738866 1:79002932-79002954 TTTAATATGTTTAGTGAGGTTGG + Intronic
911190210 1:94941064-94941086 ATGTATATGTTGATGAAGGTAGG - Intergenic
912055561 1:105594293-105594315 GAAAATATGTTTAGAGAGGTAGG - Intergenic
912727629 1:112072778-112072800 GTATTTATCTTTAGGGAGATGGG + Intergenic
912968291 1:114256641-114256663 GTGTTCATGTGCAGGGAGGTTGG + Intergenic
916426259 1:164683608-164683630 GTGTATGTGTTTTGGAAGGTGGG - Intronic
916510252 1:165466915-165466937 GTGTGTATGTATATGGGGGTGGG - Intergenic
916549162 1:165832949-165832971 GTAAATATTTTTAGGGAGGTTGG + Intronic
916849378 1:168687508-168687530 GTGTAAATGTTTGGGGATATGGG + Intergenic
917558409 1:176116879-176116901 GTTTATATGTTTGAGGTGGTGGG - Intronic
918137595 1:181688297-181688319 GTGTATGTTTTTATAGAGGTTGG + Intronic
918457355 1:184735815-184735837 ATGTATATGTGTATGGAGGGTGG - Intronic
918904096 1:190468714-190468736 TTGTATATCTTTTGGGGGGTGGG + Intronic
920411249 1:205762728-205762750 GGGTTTATGTTTAGAGCGGTGGG - Intergenic
920498616 1:206472552-206472574 GTGTATGTGTGTAGGGCGTTGGG - Intronic
921847246 1:219897243-219897265 GTGTATATGTGTATGTATGTTGG - Intronic
922222080 1:223616318-223616340 GTGTGGATGTGTAGGAAGGTAGG - Intronic
922471280 1:225878875-225878897 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
924403326 1:243713652-243713674 TTGTGTCTGTTTAGGGGGGTAGG - Intronic
924581159 1:245325148-245325170 GGGTATGTGTGTAAGGAGGTGGG - Intronic
924940593 1:248810598-248810620 GTCTACAGGTTGAGGGAGGTTGG - Exonic
1063101525 10:2954110-2954132 GTGAAGATGTTTGGGGATGTTGG - Intergenic
1063582051 10:7316865-7316887 GTGTTTATGTGTGGGGAGGGAGG - Intronic
1064042289 10:11977869-11977891 GTTTCTATGTTTAGAGAGGTTGG - Intronic
1064082247 10:12318171-12318193 ATGTAGCTGTTTTGGGAGGTAGG + Intergenic
1064492195 10:15870967-15870989 GTGTATATGTTTCGTGGGGTGGG + Intergenic
1067755450 10:49001230-49001252 GTGTATGTGTTAAGGGAGGGAGG - Intergenic
1067943670 10:50677291-50677313 GAGTCTGTGTTTAGGGAGGACGG + Intergenic
1068732592 10:60375746-60375768 GTGTTTATGTTGGGGGAAGTAGG - Intronic
1069165086 10:65145789-65145811 GTGTATATGTTTATGTGTGTAGG - Intergenic
1070865156 10:79704158-79704180 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1070878947 10:79842289-79842311 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1071632052 10:87226379-87226401 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1071645505 10:87358598-87358620 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1072862441 10:99020641-99020663 GTGTATGTGTTGAGGGAGGGTGG + Intronic
1074863672 10:117532501-117532523 GTGATTTAGTTTAGGGAGGTGGG - Intergenic
1074921728 10:118021067-118021089 GTGTGTATGTGTAGGCAGGGTGG - Intronic
1074953079 10:118359572-118359594 GTGTTTATGTATTGGGAGGCAGG + Intergenic
1076173635 10:128345792-128345814 TTGTATATGTTTAAGGAGTGAGG + Intergenic
1076933837 10:133554718-133554740 GTGTATGTGTGTATGCAGGTGGG + Intronic
1077340394 11:2023848-2023870 GTGTACAGGTGTGGGGAGGTGGG + Intergenic
1077966823 11:7143125-7143147 GCTTATATGTTTATGGAGGCTGG - Intergenic
1079829261 11:25241791-25241813 GTGTATGTGTTGTGGGGGGTGGG - Intergenic
1080729250 11:34931842-34931864 GTGTGTGTGTTCTGGGAGGTAGG + Intronic
1081303990 11:41489064-41489086 GTTTATATGGTTAGGCAAGTGGG - Intergenic
1081356412 11:42119893-42119915 GTGTGTATGTTTTGGGGGGTGGG + Intergenic
1081738344 11:45420823-45420845 GTGTAGATGGTTAGGTAGATGGG - Intergenic
1082094067 11:48112665-48112687 GTGTAAATATTTTGTGAGGTGGG + Intronic
1082987293 11:59179893-59179915 GTGTATGTGTGTAGGGTGGTAGG - Intronic
1083188107 11:61029653-61029675 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1084244805 11:67849770-67849792 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1084493982 11:69493420-69493442 GTGTGTGTGTTTGGGAAGGTGGG - Intergenic
1084811448 11:71614144-71614166 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1084827881 11:71744787-71744809 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1085440252 11:76555358-76555380 GTGTATGTGGTGGGGGAGGTAGG - Intergenic
1085763125 11:79259532-79259554 GAGTATATGGGTAGGTAGGTGGG - Intronic
1085773616 11:79346510-79346532 GTGTGTATGTGGTGGGAGGTGGG - Intronic
1086861561 11:91930799-91930821 GTGTCTATGTGGAGAGAGGTCGG + Intergenic
1087457502 11:98405193-98405215 GTGTCTATGTGTGGGGGGGTGGG - Intergenic
1088536181 11:110864250-110864272 CTGTATATGTTTAGGGAGGGAGG + Intergenic
1088914749 11:114219080-114219102 GTGTATATGTATAGCGGGGCTGG + Intronic
1090497994 11:127233365-127233387 GTGTATGTGTGTAGGTAGGTAGG - Intergenic
1091150751 11:133326362-133326384 GTGTATGTGTTTGGGGGTGTGGG + Intronic
1202823379 11_KI270721v1_random:79037-79059 GTGTACAGGTGTGGGGAGGTGGG + Intergenic
1091423097 12:360518-360540 ATGTATATGTTTAATGTGGTTGG - Intronic
1091814383 12:3425377-3425399 GTCTAGTTGTTTAGAGAGGTAGG + Intronic
1092415374 12:8286917-8286939 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1092820735 12:12351033-12351055 GTGTGTGTGTTTATGGAGGTGGG - Intergenic
1093252991 12:16831460-16831482 GTGTATTTATTTAGAGAGGCAGG - Intergenic
1094344250 12:29449266-29449288 GTGTGTGTGTGTAGGGAGGGGGG - Intronic
1095127244 12:38494618-38494640 GTGTATATTATTAATGAGGTGGG - Intergenic
1095507768 12:42915750-42915772 GTGTATATGTTTGTGTATGTTGG + Intergenic
1095882586 12:47153971-47153993 ATGTATTTGTTTAGTGAGGTGGG + Intronic
1095974156 12:47927863-47927885 ATGTATATGTTCAGAGTGGTGGG + Intronic
1096071575 12:48778299-48778321 GTGTGTGTGTTTAGGGGGGCAGG - Intronic
1096460259 12:51818379-51818401 GTGTGTATGTATTGGGGGGTGGG - Intergenic
1096832708 12:54326669-54326691 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1097292769 12:57932954-57932976 GTTGATTTGTTTAGGGAGGTGGG - Intergenic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1100543598 12:95580636-95580658 GTGTCTATGTATATGTAGGTGGG + Intergenic
1100611832 12:96196342-96196364 GTGTATGTGTGTTGAGAGGTGGG + Intronic
1101085826 12:101234820-101234842 GTGTATATGTGTGTGAAGGTAGG - Intergenic
1101451100 12:104780042-104780064 GTGTTTGTGTTTAGGGGTGTAGG - Intergenic
1102045509 12:109827540-109827562 GTGTGTGTGTTTATGGAGGGTGG - Intronic
1102638503 12:114345575-114345597 GTATATAAGTTTTGGGCGGTTGG - Intergenic
1102802322 12:115747030-115747052 GTGTATATTTGGAGGGAGATAGG + Intergenic
1104189090 12:126460534-126460556 GTGTATAGGTATAGGTAGGGAGG + Intergenic
1104193937 12:126512626-126512648 GTGTAGATGTTTAGGTACTTTGG - Intergenic
1104395295 12:128427428-128427450 GTATATATATTTAAGGAGGGTGG + Intronic
1105610070 13:21960899-21960921 GTGTATGTGGTGAGGGATGTAGG - Intergenic
1106933539 13:34693270-34693292 GTAAATATGTTTGGGGAGATGGG + Intergenic
1107765140 13:43726593-43726615 GTGTATTTGTTGAGTGAGTTAGG - Intronic
1108014164 13:46056229-46056251 TTGTATGTGTTTAGAAAGGTTGG - Intronic
1108486318 13:50930028-50930050 GTGTATGTGTGTATGGGGGTGGG - Intronic
1108798017 13:54056808-54056830 GTTTATTTATTTGGGGAGGTGGG - Intergenic
1109233405 13:59786751-59786773 GTGTATGTGTTTAGGGAGAGGGG + Intronic
1109537819 13:63740439-63740461 GTGTAGGTGTTTAGAGACGTAGG + Intergenic
1109629488 13:65027056-65027078 TTGTATATGGTTAGGGAGAGGGG + Intergenic
1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG + Intergenic
1109995076 13:70112485-70112507 GTGTATTTGTTTTAAGAGGTAGG - Intergenic
1110723679 13:78794939-78794961 GTGCAAATGTTCAGGGAAGTGGG + Intergenic
1110723726 13:78795357-78795379 GTGCAAATGTTCAGGGAAGTGGG - Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1111131009 13:83975674-83975696 GTGTGTATGTGTGGGTAGGTGGG + Intergenic
1112894771 13:104285691-104285713 GTGTACATGTTTATGGAAGCAGG + Intergenic
1113093517 13:106639100-106639122 GTGGATGTGCTCAGGGAGGTGGG + Intergenic
1113341555 13:109431020-109431042 ATATGTATGTTTATGGAGGTAGG - Intergenic
1117038716 14:51751167-51751189 GTCTAATTGTTTAGAGAGGTAGG - Intergenic
1117524509 14:56584024-56584046 GTGTATGTGTTTAGGGGCATGGG + Intronic
1118177864 14:63460595-63460617 GTGAACAAGTTTAGGCAGGTAGG + Intronic
1118675236 14:68177331-68177353 GTGTGTATGTTTACACAGGTAGG + Intronic
1118799682 14:69178122-69178144 TTGTAGATGTTTAGAGAGTTTGG + Intergenic
1119188786 14:72664325-72664347 GTGTGTGTGTGTTGGGAGGTCGG - Intronic
1120525458 14:85571868-85571890 GTGTATGTGTTTTGGAAGGATGG + Intronic
1121883206 14:97518679-97518701 GTATATATGTGTGGGGGGGTGGG - Intergenic
1122052024 14:99067053-99067075 GGGTGGTTGTTTAGGGAGGTGGG - Intergenic
1122506957 14:102237758-102237780 GTCTAACTGTTTAGAGAGGTAGG - Intronic
1123472174 15:20563264-20563286 GTGTTTATGTTAAGGGAGTGAGG - Intergenic
1124127191 15:26946714-26946736 GTGGATATGTTTGGAGAGGTGGG - Intronic
1124563014 15:30792344-30792366 GTGTCTATGTTAAGGGAGTAAGG - Intergenic
1127667839 15:61166368-61166390 GTGAATCTGTTTAGAGAGGAGGG + Intronic
1128030777 15:64478192-64478214 GTGTGTCTGTTTAAAGAGGTGGG + Intronic
1130407398 15:83614120-83614142 GTGTATATGGGTGGGCAGGTGGG - Intronic
1131107805 15:89746650-89746672 GTGTGTTTGTGTGGGGAGGTAGG - Intergenic
1131107819 15:89746724-89746746 GTGTATATGTGTGGGGAGGTAGG - Intergenic
1131107825 15:89746752-89746774 GTGTATATGTGTGGGGAGGTAGG - Intergenic
1131107831 15:89746780-89746802 GTGTGTGTGTGTGGGGAGGTAGG - Intergenic
1131338263 15:91571273-91571295 GGGACTATGTTTAGGCAGGTGGG + Intergenic
1131828608 15:96340404-96340426 TTGTATATGTTTAGAGTGGCCGG + Intergenic
1133558828 16:6930954-6930976 ATGTATGTGTGTAGGGGGGTGGG - Intronic
1133846921 16:9463594-9463616 GTGTTTATATTTAGAGAGTTTGG + Intergenic
1134156146 16:11844846-11844868 GTGTATCAGCTTGGGGAGGTAGG - Intronic
1134742582 16:16561066-16561088 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1134768737 16:16785421-16785443 GTGTAGAGGTATTGGGAGGTGGG + Intergenic
1134924979 16:18151386-18151408 GTGTGTGTGTGTAGGTAGGTTGG - Intergenic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1138056064 16:53834881-53834903 GTGTACATGTGTAGGCAGGCAGG - Intronic
1138958670 16:62003148-62003170 GTGTGTATCTTGGGGGAGGTGGG + Intronic
1143670173 17:8391519-8391541 GGGTATAGGTTGAGGGAGGTTGG + Exonic
1144029682 17:11308328-11308350 GTTTGTGTGTTTAGGGAGCTGGG - Intronic
1144055800 17:11539523-11539545 GTTTATCTGCTAAGGGAGGTGGG - Intronic
1144139877 17:12337833-12337855 GTGTATATATGTTGGGAGGCTGG + Intergenic
1144791576 17:17862523-17862545 GTGTGTGTGTTTGGGGGGGTGGG + Intronic
1146462459 17:33057021-33057043 GTGTGTGTGTTTAAGGAGGTGGG + Intronic
1146553545 17:33803337-33803359 GTGTATATGTGTGGGTGGGTGGG + Intronic
1146657902 17:34645753-34645775 GTGTCTATGTGTAGAGAGGGTGG - Intergenic
1147553603 17:41462500-41462522 TTCCATATGTTTAGGGAGATAGG - Intronic
1148258928 17:46162279-46162301 TGGTCCATGTTTAGGGAGGTGGG + Intronic
1149076042 17:52596892-52596914 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1149518001 17:57294939-57294961 GTGTGTCTGTTTGGGGAGGCAGG + Intronic
1151114278 17:71716356-71716378 GTGTATATTTCTCTGGAGGTTGG + Intergenic
1151199867 17:72459952-72459974 GTGTATCTGTTTTTGGAGGGGGG - Intergenic
1154389197 18:13922130-13922152 GTTTATTAATTTAGGGAGGTAGG + Intergenic
1156218653 18:35028512-35028534 GTGTATGTGTTTGGGGGGTTGGG - Intronic
1156565661 18:38186971-38186993 GTGTATGTGTGTATGGAGGCGGG - Intergenic
1157785888 18:50482258-50482280 GTATGTGTGTTTGGGGAGGTAGG + Intergenic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1159361318 18:67407364-67407386 GAGAAAATGTTTGGGGAGGTGGG + Intergenic
1163966448 19:20751414-20751436 GTCTAGTTGTTTAGAGAGGTAGG + Intronic
1164897428 19:31889267-31889289 TTGTATTTGTTTAATGAGGTTGG + Intergenic
1165586321 19:36919272-36919294 GAGTTTATGTTGAGGGGGGTGGG + Intronic
1166619090 19:44279642-44279664 GAGAATATGTTTAGGAAAGTGGG - Intronic
1167382267 19:49145594-49145616 GTGCAAATGTTTAGGGAGTATGG - Intronic
1167560779 19:50225762-50225784 GTGGATCTGTTGAGGGAGGAGGG + Intronic
1168450747 19:56464718-56464740 TTGTGTGTGTTTAGGGAGGGGGG - Intronic
1168509573 19:56963610-56963632 GTGTATGTCTGTGGGGAGGTGGG - Intergenic
925291391 2:2750763-2750785 GTGTATATGTGTGGGGGGGGTGG + Intergenic
925317235 2:2935854-2935876 GTGCAGATGTTTAGTGAGGTCGG - Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363704 2:3296614-3296636 GTGTATGTGTGTAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925858896 2:8156282-8156304 GTGAGGATGTGTAGGGAGGTTGG - Intergenic
926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG + Intergenic
927036947 2:19187839-19187861 GTGTGTATGTTGGGGGAGTTGGG + Intergenic
928141815 2:28735938-28735960 ATGTTTATGTTTGGGGAGGCTGG - Intergenic
929041626 2:37750178-37750200 GTGTATATGTGTGGGGTGGGTGG - Intergenic
930518459 2:52434898-52434920 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
931256152 2:60574888-60574910 GTGTGTGTGTTTAGAGGGGTGGG + Intergenic
931874227 2:66494890-66494912 ATGCATATGTTTGGGGAAGTAGG + Intronic
932349854 2:71022981-71023003 GTCTACTTGTTTAGAGAGGTAGG - Intergenic
932648916 2:73533629-73533651 ATGTATAGGTGTAAGGAGGTAGG + Intronic
932752053 2:74377493-74377515 GTGTACTTGTATAGAGAGGTAGG + Intronic
933103683 2:78293504-78293526 GTGGAGATGTATAGGTAGGTAGG - Intergenic
933158622 2:79000547-79000569 GTGTATATGTGGTGGGAAGTGGG - Intergenic
934061196 2:88295822-88295844 GTGAATAGGATTATGGAGGTAGG + Intergenic
934949836 2:98568789-98568811 GTGTGTGTGTTTAGGGAGAAAGG - Intronic
935897754 2:107755909-107755931 GTGAATATCTTTTGGGAGGGGGG + Intergenic
936225722 2:110648634-110648656 GTGTGTATATATGGGGAGGTAGG + Intronic
936875852 2:117188270-117188292 GTGTATGTGTTTGGGAGGGTGGG + Intergenic
937116391 2:119407807-119407829 GTGTATATGTTTGTGGCAGTGGG + Intergenic
937855131 2:126666698-126666720 GTGTGTGTGTGTAGGGAGGGAGG - Intronic
939590475 2:144058121-144058143 GTGTGTGTGTTTAGCGGGGTGGG - Intronic
940708133 2:157129096-157129118 ATGTATATATTTAGGATGGTAGG - Intergenic
940869430 2:158847759-158847781 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
941656154 2:168146820-168146842 CTGTATATGAATAGAGAGGTTGG + Intronic
942121433 2:172781731-172781753 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
942215471 2:173715074-173715096 GTGTATATGTTTAGGAGTGGAGG + Intergenic
943164999 2:184311109-184311131 GTGTATGTGTTTAGGAATTTGGG - Intergenic
943330127 2:186549222-186549244 GTATATATGTTAGGGGAGGGAGG - Intergenic
943372453 2:187031711-187031733 GTGTATGTGTGTGGGGAGTTGGG + Intergenic
944916930 2:204370332-204370354 GTGTCTATATTAAGGGAGGGAGG + Intergenic
945413745 2:209544806-209544828 GTCAATATTTTTATGGAGGTTGG + Intronic
945743889 2:213697120-213697142 GGGTAGAAGTTTAGGTAGGTAGG + Intronic
946621902 2:221571331-221571353 GTGTGTCTGTGTCGGGAGGTGGG - Intronic
947093650 2:226542129-226542151 GTGTTGATGTTTAGGGATGTAGG - Intergenic
947328741 2:229005803-229005825 GTTTTTATGGTTAGGGAGATGGG - Intronic
947455150 2:230247392-230247414 GTGTTTAAGTTGAGGGAGGTGGG - Intronic
948300517 2:236903333-236903355 GTGTGTGTGTGTAGGGAGATGGG + Intergenic
948558419 2:238834260-238834282 GTGTGTGTGTGTAGGTAGGTAGG - Intergenic
1168806378 20:674727-674749 GTGTGTATGTGTAGTGAGGAGGG + Intronic
1169323681 20:4657027-4657049 GTGGATTTGTTTAGGGGAGTAGG + Intergenic
1170153321 20:13247548-13247570 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1170241065 20:14166852-14166874 TTATATTTGTTCAGGGAGGTGGG - Intronic
1171408465 20:24929620-24929642 ATGTAGTTGTTTAGAGAGGTAGG - Intergenic
1172066727 20:32226589-32226611 GTGTATATGTTTAGGGAGGTGGG - Intronic
1172798154 20:37557621-37557643 GTGTGTGTGTGTAGGGTGGTAGG + Intergenic
1174146728 20:48457228-48457250 GTGTATGTGTATAGTGAGCTTGG - Intergenic
1175029510 20:55938356-55938378 GTGTTGATGATGAGGGAGGTAGG - Intergenic
1175254945 20:57636579-57636601 GTGCATGTGTGTGGGGAGGTAGG - Intergenic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1178153970 21:29830298-29830320 GTGTGTGTGTGTGGGGAGGTGGG - Intronic
1180355555 22:11836652-11836674 TTGTATATTTTTGGAGAGGTGGG + Intergenic
1181728484 22:24827740-24827762 GGGTATCTGTTAAGTGAGGTGGG - Intronic
1183413140 22:37666944-37666966 GAGTCTATGTTTGGGGAGGGAGG + Intergenic
1184466928 22:44674031-44674053 ATGAATATGTTTAGGGAGAAAGG - Intronic
949882960 3:8675936-8675958 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
952072289 3:29652297-29652319 TTGTATACTTGTAGGGAGGTGGG + Intronic
952792462 3:37211098-37211120 GTGTATATGGTCAGGGATGGTGG + Intergenic
953327416 3:42024072-42024094 GTGGAGATGTTTAGGGCAGTGGG + Intronic
957044484 3:75363336-75363358 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
957076276 3:75605520-75605542 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
958110479 3:89136561-89136583 GTGTTTATGTTTTAGGAGATTGG + Intronic
960517975 3:118623357-118623379 GTGTATATGTTGAGGGTGGCAGG + Intergenic
960552432 3:118990868-118990890 GTATATATGTGTAGGTAGGAAGG + Intronic
960831637 3:121855735-121855757 GTGTATACGTTTTGGAAAGTAGG + Intronic
961277941 3:125742290-125742312 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
962308004 3:134305871-134305893 GTTTAAAAGTTTAGGGAGGCTGG - Intergenic
963851903 3:150217649-150217671 GTGCAGGTGTTTGGGGAGGTGGG + Intergenic
963948531 3:151172187-151172209 GTGTATTTCTTTAGGGACATTGG + Intronic
966512539 3:180780269-180780291 GTGAATATGTCTAGCAAGGTTGG + Intronic
966526799 3:180928434-180928456 GTGTATGTGTTTGGGGTGGGGGG - Intronic
966712547 3:182984597-182984619 GTGTATGTGTTGGGGGTGGTGGG - Intronic
967424919 3:189316125-189316147 GTGCATATGTTCAGAGAGGAGGG + Intronic
969734130 4:8975593-8975615 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
969749839 4:9101612-9101634 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
969785557 4:9454478-9454500 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
969788973 4:9478884-9478906 GTCCAGTTGTTTAGGGAGGTAGG - Intergenic
969893625 4:10282435-10282457 CATTATGTGTTTAGGGAGGTAGG + Intergenic
969967651 4:11013740-11013762 GTGTGTGTGTTTTGGGGGGTGGG + Intergenic
970172770 4:13305869-13305891 GTGTATGTGTTTAGGGGGGTGGG - Intergenic
971167727 4:24201732-24201754 TTATATATGTTTATGAAGGTAGG - Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
973116054 4:46460858-46460880 TTGTATATGGTGAGGGATGTAGG - Intronic
973270611 4:48258902-48258924 GAGTGTATGTGTAGGGAAGTAGG - Intronic
975479190 4:74858771-74858793 GTGTGAAGGTGTAGGGAGGTTGG - Intergenic
975995893 4:80314160-80314182 GTGTATATTTTTAGGTAAGTAGG + Intronic
977342650 4:95778628-95778650 GTGTATATCTTGATGCAGGTGGG - Intergenic
978378756 4:108104626-108104648 TTGTATATGTTTAGGCAGACAGG + Intronic
978962388 4:114698339-114698361 ATTTATTTGTTTGGGGAGGTAGG + Intergenic
979403766 4:120283385-120283407 GTGTATATGTGTTGTGGGGTGGG - Intergenic
980302123 4:131009027-131009049 GTTGATATGTTTAGGTAGATGGG - Intergenic
980312970 4:131158677-131158699 GTGTATATATATAGGTAGATGGG - Intergenic
980869066 4:138589827-138589849 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
981025459 4:140073019-140073041 GTGTGTTTGTCTAGGGAGGGAGG + Intronic
981604912 4:146530045-146530067 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
981698296 4:147580980-147581002 GTGTGTGTGTTTTGGGAGGTGGG - Intergenic
981875773 4:149543571-149543593 GTGTATATGTGTGGGGTGGGGGG + Intergenic
983266904 4:165516872-165516894 GTGTATATGGTTAGGGGGCTTGG + Intergenic
983952498 4:173659170-173659192 GTCTATATGATTTGGCAGGTAGG - Intergenic
984673570 4:182520415-182520437 GTGTATGTATTTAGGGTGTTTGG + Intronic
986883639 5:12206840-12206862 GTGTATATATTTAGGAAGTTAGG + Intergenic
987761285 5:22165465-22165487 GTGTATGTGTGTTGGGAGGCTGG - Intronic
987806575 5:22776941-22776963 GTATACATGTTTAGGGTTGTGGG - Intronic
988097158 5:26630687-26630709 GTGTGTATGTGTATGGAGGAAGG + Intergenic
989131351 5:38110252-38110274 GTGTGTGTGTTGAGGAAGGTCGG - Intergenic
989349020 5:40463388-40463410 GTGTGGCAGTTTAGGGAGGTGGG + Intergenic
990773391 5:59276935-59276957 GTGTAGATGTTCAGAGAGATAGG - Intronic
991051966 5:62282453-62282475 GTGTGTATGTGTATGGAGGCTGG - Intergenic
991720525 5:69491669-69491691 GTGTATATTTTTATGTATGTTGG - Intergenic
991896076 5:71398919-71398941 GTGTATGTGTGTTGGGAGGCTGG - Intergenic
991982298 5:72245163-72245185 GTGTATAGCTTTAGAGAGGCTGG - Intronic
992837085 5:80652188-80652210 GTGTATATGTTGAGTAAGGTGGG + Intronic
993221747 5:85107517-85107539 GTGTATATGTATAGTGCAGTTGG + Intergenic
993328224 5:86567623-86567645 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
993532660 5:89043267-89043289 TTGCATATGTTTGGGGAGGAGGG + Intergenic
994884697 5:105544966-105544988 TTCTCTATGTTTAGAGAGGTTGG + Intergenic
995747875 5:115422975-115422997 GTGTATATGTTTTGGCAGAATGG - Intergenic
995823467 5:116266029-116266051 ATGTATTTCTTTTGGGAGGTGGG + Intronic
996875691 5:128238254-128238276 TTGTATATGTTAAAGGATGTGGG + Intergenic
997202157 5:132017295-132017317 GTGTATGTGGTGAGGGGGGTGGG + Intergenic
999408666 5:151330007-151330029 GTGTGTGTGTTTAGGGGGGTGGG + Intronic
1001745696 5:174090688-174090710 GTGTATTTGTTCAGGGCAGTGGG + Intronic
1001784192 5:174397522-174397544 GTTTATCTGTTGAGGGAGCTCGG + Intergenic
1001827065 5:174753525-174753547 GTGTGTGTGTGTAGGGAGGGAGG + Intergenic
1004150626 6:13116521-13116543 GTGTTTACTTTTAGGGAGGATGG + Intronic
1005316769 6:24610618-24610640 GTGTACATGATAAGGGAGTTAGG + Intronic
1006961819 6:37939519-37939541 GTGGACATATTTTGGGAGGTGGG + Intronic
1007079908 6:39092600-39092622 GTGTGTATGTGTTGGGAGGGTGG - Intergenic
1011241606 6:85277409-85277431 GTGTGTATGTATAGGGATGGAGG + Intergenic
1011382116 6:86753221-86753243 GCTTATATGATTATGGAGGTTGG - Intergenic
1011565269 6:88666321-88666343 GTCTAGCTGTTTAGAGAGGTAGG - Intronic
1011748299 6:90429663-90429685 GTTTATTTGTTTATGGTGGTAGG - Intergenic
1012617779 6:101298669-101298691 GTGTGTGTGTATAGGGAGGTGGG + Intergenic
1012790104 6:103682414-103682436 GTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1014293929 6:119594700-119594722 GTGTATGTATTTAGGGAGGAGGG - Intergenic
1015002238 6:128232148-128232170 GTGTGTATGTGTGGGGACGTGGG - Intronic
1015575582 6:134667464-134667486 GTGTATGTGTTTTGGGGTGTGGG - Intergenic
1017362662 6:153594453-153594475 GTGTGTGTGTTTAGGGCAGTAGG - Intergenic
1017976807 6:159365445-159365467 ATTTATATGTTGATGGAGGTGGG + Intergenic
1018186814 6:161272693-161272715 GTGTGTGTGTTTAGGGAAATGGG - Intronic
1018407268 6:163500284-163500306 ATGTATGTGTGTAGGGAGTTGGG + Intronic
1019721200 7:2572568-2572590 GCCTCTATGTTTAGGGAGGGAGG - Intronic
1019934982 7:4248790-4248812 GTGCATGTGTTTAGGTATGTAGG - Intronic
1020323147 7:6955030-6955052 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1022622707 7:32001012-32001034 GTGTGTATGTATGGGGAGGGTGG + Intronic
1022886759 7:34654697-34654719 GTGTGTGTGTGTAGGGAGGGGGG + Intergenic
1022978938 7:35584909-35584931 GTGTGTATAGTTAGGTAGGTAGG + Intergenic
1023635931 7:42210198-42210220 TGGTATTTGTTTACGGAGGTAGG + Intronic
1023761413 7:43468166-43468188 GTGTGTATGTGTAGGGGGGTTGG - Intronic
1024150641 7:46568425-46568447 GTGTGTTTGTATGGGGAGGTAGG + Intergenic
1026356380 7:69561190-69561212 TTGTATATATTTAGGGAACTTGG - Intergenic
1027700435 7:81463998-81464020 GTGTAACAGTTTTGGGAGGTGGG + Intergenic
1028274727 7:88840744-88840766 GTATTTGTGTTTTGGGAGGTAGG + Intronic
1028774498 7:94662145-94662167 GTGGATGTGTGTGGGGAGGTGGG - Intronic
1029090515 7:98044446-98044468 GTGTGTGTGTTTTGGGGGGTGGG - Intergenic
1029663816 7:101981193-101981215 GTGTATAGGTTGGGGGAGGAGGG - Intronic
1029874243 7:103732187-103732209 GTGTATATCTTTAGGGTCCTCGG + Intronic
1032511619 7:132477236-132477258 GTGTATGTATGCAGGGAGGTGGG - Intronic
1033304168 7:140212305-140212327 GTGTCTATGTTTAGGGAGCAGGG - Intergenic
1034570017 7:151948098-151948120 GTGTATATGTGTATGAGGGTGGG + Intergenic
1036212328 8:6852455-6852477 GTATATTTGTTTAGGGTGGGAGG + Intergenic
1036239735 8:7071710-7071732 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1036372921 8:8175954-8175976 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1036573110 8:9999179-9999201 GTGTATAGGTTTGGGTGGGTAGG + Intergenic
1036816707 8:11907906-11907928 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1036877984 8:12489687-12489709 GTCTAGTTGTTTAGAGAGGTAGG + Intergenic
1037544006 8:19899996-19900018 GTGTTTCTGTTTAGTGATGTTGG - Intergenic
1038426646 8:27468276-27468298 GTGTATGTGTGCAGGGAGGCAGG - Intronic
1038799041 8:30732760-30732782 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
1040040057 8:42906749-42906771 GTATATGTGTTTGGGGATGTTGG - Intronic
1041030849 8:53733954-53733976 GTCTAGTTGTTTAGAGAGGTAGG - Intronic
1041868063 8:62599307-62599329 GTGTATATGTATGGTGGGGTGGG + Intronic
1042461931 8:69079985-69080007 GTAACTATGTTTAGGGGGGTGGG - Intergenic
1043401597 8:79890656-79890678 GCGTGTGTGTTTGGGGAGGTGGG - Intergenic
1043461121 8:80461292-80461314 GTGTATGTGTGTAGGTAGGTAGG + Intergenic
1043557397 8:81447747-81447769 GTGTGTGTGTTTAGGCATGTCGG + Intergenic
1044865938 8:96571341-96571363 GTGTGTATGCTTAGGGAGGTGGG + Intronic
1045833299 8:106490534-106490556 GTGCATATTTTTAGGGAAGATGG + Intronic
1046089106 8:109477654-109477676 GTCTATATGATAAGGGAGTTGGG - Intronic
1047143788 8:122173612-122173634 GTGTACGTGTGTTGGGAGGTGGG - Intergenic
1047300748 8:123611886-123611908 GTGTGCATGTGTAGGGAAGTAGG + Intergenic
1048693563 8:136996327-136996349 GTGTATGTGTGTGCGGAGGTGGG - Intergenic
1048957452 8:139548758-139548780 GTTTAGTTGTTTAGAGAGGTAGG + Intergenic
1050515048 9:6434828-6434850 ATGTGTATGTTTTGGGGGGTGGG + Intronic
1052551426 9:29955042-29955064 GTGTGTATGTGCGGGGAGGTGGG + Intergenic
1052991172 9:34520227-34520249 GGGTATGTGTTTGGGGAGGGAGG - Intronic
1054703574 9:68438828-68438850 GTGTGTATGTTGGGGGAGGAGGG + Intronic
1056040565 9:82661160-82661182 ATGTATATATTTAGGGAGCCAGG - Intergenic
1056680537 9:88713866-88713888 TTGTATGTGTTTGGGGAGCTTGG + Intergenic
1056865755 9:90226215-90226237 GTCTAGTTGTTTAGAGAGGTAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057342520 9:94215511-94215533 GTGTACATCTTTGGGGATGTGGG - Intergenic
1059321759 9:113475759-113475781 ATGTATCTGTGGAGGGAGGTTGG + Intronic
1185989713 X:4879899-4879921 GTTTATATGCTTAGGAAGGGTGG + Intergenic
1187128479 X:16477103-16477125 GTGTATATGTTTATGGTGTATGG - Intergenic
1187203309 X:17157025-17157047 GTGTGTATGTGTATGGAGGATGG + Intergenic
1187289359 X:17938120-17938142 GTGTGTAGGGTTAGGGAAGTGGG + Intergenic
1189202641 X:39210633-39210655 GGGAATAAGTTTATGGAGGTGGG + Intergenic
1189891157 X:45603873-45603895 ATGTGTATGTTGAGGGAGGTTGG + Intergenic
1191722556 X:64246453-64246475 GTGTATATATTTATGAAGGGTGG + Intergenic
1192543477 X:71994326-71994348 GTGTAAAAGTTGAGGAAGGTAGG + Intergenic
1192698308 X:73442411-73442433 GTGTATATGAGGAGGCAGGTAGG - Intergenic
1193699107 X:84741639-84741661 GTCTAATTGTTTAGAGAGGTAGG - Intergenic
1194449382 X:94025760-94025782 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1194918957 X:99740479-99740501 GTGTATATGTTTGGGTGGGCAGG + Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1196519544 X:116656883-116656905 GGGTAGATATTAAGGGAGGTGGG + Intergenic
1196659065 X:118251032-118251054 CTGGATATGTTGAGGGATGTAGG - Intergenic
1197884908 X:131208497-131208519 GTGTATAGGTTCATGCAGGTAGG + Intergenic
1198911520 X:141620202-141620224 GTGTGTATGTTTAGGAGTGTGGG - Intronic
1200925230 Y:8648364-8648386 GTCTATTTGTTTAGAGAAGTAGG - Intergenic
1201684934 Y:16690498-16690520 ATGAATATTTTTAGGGAGCTGGG - Intergenic
1202345926 Y:23926878-23926900 GTGTGTATGTGTGGGGGGGTGGG + Intergenic
1202524845 Y:25743212-25743234 GTGTGTATGTGTGGGGGGGTGGG - Intergenic