ID: 1172068489

View in Genome Browser
Species Human (GRCh38)
Location 20:32238879-32238901
Sequence GTGAGGAATGCGGAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172068489_1172068498 22 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068498 20:32238924-32238946 GTCTAGGCAGTGCTTCCCAAAGG No data
1172068489_1172068497 6 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068497 20:32238908-32238930 ATTACAGGTGCTAATGGTCTAGG No data
1172068489_1172068493 -9 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068493 20:32238893-32238915 ATTCCTCACCTCAGCATTACAGG No data
1172068489_1172068499 23 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068499 20:32238925-32238947 TCTAGGCAGTGCTTCCCAAAGGG No data
1172068489_1172068496 0 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068496 20:32238902-32238924 CTCAGCATTACAGGTGCTAATGG No data
1172068489_1172068500 26 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068500 20:32238928-32238950 AGGCAGTGCTTCCCAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172068489 Original CRISPR GTGAGGAATGCGGAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr