ID: 1172068493

View in Genome Browser
Species Human (GRCh38)
Location 20:32238893-32238915
Sequence ATTCCTCACCTCAGCATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172068488_1172068493 4 Left 1172068488 20:32238866-32238888 CCTTGAAGCAAATCCCTTCACCT 0: 1
1: 1
2: 3
3: 34
4: 400
Right 1172068493 20:32238893-32238915 ATTCCTCACCTCAGCATTACAGG No data
1172068487_1172068493 21 Left 1172068487 20:32238849-32238871 CCTGACTTGCAGAGTGACCTTGA 0: 1
1: 0
2: 2
3: 35
4: 284
Right 1172068493 20:32238893-32238915 ATTCCTCACCTCAGCATTACAGG No data
1172068486_1172068493 22 Left 1172068486 20:32238848-32238870 CCCTGACTTGCAGAGTGACCTTG 0: 1
1: 0
2: 6
3: 54
4: 411
Right 1172068493 20:32238893-32238915 ATTCCTCACCTCAGCATTACAGG No data
1172068490_1172068493 -10 Left 1172068490 20:32238880-32238902 CCTTCACCTCCGCATTCCTCACC No data
Right 1172068493 20:32238893-32238915 ATTCCTCACCTCAGCATTACAGG No data
1172068489_1172068493 -9 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068493 20:32238893-32238915 ATTCCTCACCTCAGCATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172068493 Original CRISPR ATTCCTCACCTCAGCATTAC AGG Intergenic
No off target data available for this crispr