ID: 1172068498

View in Genome Browser
Species Human (GRCh38)
Location 20:32238924-32238946
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172068492_1172068498 12 Left 1172068492 20:32238889-32238911 CCGCATTCCTCACCTCAGCATTA No data
Right 1172068498 20:32238924-32238946 GTCTAGGCAGTGCTTCCCAAAGG No data
1172068490_1172068498 21 Left 1172068490 20:32238880-32238902 CCTTCACCTCCGCATTCCTCACC No data
Right 1172068498 20:32238924-32238946 GTCTAGGCAGTGCTTCCCAAAGG No data
1172068495_1172068498 0 Left 1172068495 20:32238901-32238923 CCTCAGCATTACAGGTGCTAATG No data
Right 1172068498 20:32238924-32238946 GTCTAGGCAGTGCTTCCCAAAGG No data
1172068489_1172068498 22 Left 1172068489 20:32238879-32238901 CCCTTCACCTCCGCATTCCTCAC No data
Right 1172068498 20:32238924-32238946 GTCTAGGCAGTGCTTCCCAAAGG No data
1172068491_1172068498 15 Left 1172068491 20:32238886-32238908 CCTCCGCATTCCTCACCTCAGCA No data
Right 1172068498 20:32238924-32238946 GTCTAGGCAGTGCTTCCCAAAGG No data
1172068494_1172068498 5 Left 1172068494 20:32238896-32238918 CCTCACCTCAGCATTACAGGTGC No data
Right 1172068498 20:32238924-32238946 GTCTAGGCAGTGCTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172068498 Original CRISPR GTCTAGGCAGTGCTTCCCAA AGG Intergenic
No off target data available for this crispr