ID: 1172069262

View in Genome Browser
Species Human (GRCh38)
Location 20:32244539-32244561
Sequence CCTCCCACCTCCAAGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172069253_1172069262 10 Left 1172069253 20:32244506-32244528 CCTGCTGGGGAGATGGGCTGGCA No data
Right 1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172069262 Original CRISPR CCTCCCACCTCCAAGGGGTT AGG Intergenic
No off target data available for this crispr