ID: 1172071274

View in Genome Browser
Species Human (GRCh38)
Location 20:32259149-32259171
Sequence ATTGCCTTTATGGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172071274_1172071279 29 Left 1172071274 20:32259149-32259171 CCTGCTTTACCCATAAAGGCAAT No data
Right 1172071279 20:32259201-32259223 TTGCCCAGGCTGAAGTGCAGTGG 0: 2064
1: 73654
2: 183538
3: 230183
4: 188187
1172071274_1172071277 15 Left 1172071274 20:32259149-32259171 CCTGCTTTACCCATAAAGGCAAT No data
Right 1172071277 20:32259187-32259209 ACAGAGTCTCGCCGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172071274 Original CRISPR ATTGCCTTTATGGGTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr