ID: 1172071277

View in Genome Browser
Species Human (GRCh38)
Location 20:32259187-32259209
Sequence ACAGAGTCTCGCCGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172071276_1172071277 5 Left 1172071276 20:32259159-32259181 CCATAAAGGCAATTTTTTTTTTT No data
Right 1172071277 20:32259187-32259209 ACAGAGTCTCGCCGTTGCCCAGG No data
1172071275_1172071277 6 Left 1172071275 20:32259158-32259180 CCCATAAAGGCAATTTTTTTTTT No data
Right 1172071277 20:32259187-32259209 ACAGAGTCTCGCCGTTGCCCAGG No data
1172071272_1172071277 24 Left 1172071272 20:32259140-32259162 CCAGTAATTCCTGCTTTACCCAT No data
Right 1172071277 20:32259187-32259209 ACAGAGTCTCGCCGTTGCCCAGG No data
1172071274_1172071277 15 Left 1172071274 20:32259149-32259171 CCTGCTTTACCCATAAAGGCAAT No data
Right 1172071277 20:32259187-32259209 ACAGAGTCTCGCCGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172071277 Original CRISPR ACAGAGTCTCGCCGTTGCCC AGG Intergenic
No off target data available for this crispr