ID: 1172071279

View in Genome Browser
Species Human (GRCh38)
Location 20:32259201-32259223
Sequence TTGCCCAGGCTGAAGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 677626
Summary {0: 2064, 1: 73654, 2: 183538, 3: 230183, 4: 188187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172071274_1172071279 29 Left 1172071274 20:32259149-32259171 CCTGCTTTACCCATAAAGGCAAT No data
Right 1172071279 20:32259201-32259223 TTGCCCAGGCTGAAGTGCAGTGG 0: 2064
1: 73654
2: 183538
3: 230183
4: 188187
1172071275_1172071279 20 Left 1172071275 20:32259158-32259180 CCCATAAAGGCAATTTTTTTTTT No data
Right 1172071279 20:32259201-32259223 TTGCCCAGGCTGAAGTGCAGTGG 0: 2064
1: 73654
2: 183538
3: 230183
4: 188187
1172071276_1172071279 19 Left 1172071276 20:32259159-32259181 CCATAAAGGCAATTTTTTTTTTT No data
Right 1172071279 20:32259201-32259223 TTGCCCAGGCTGAAGTGCAGTGG 0: 2064
1: 73654
2: 183538
3: 230183
4: 188187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172071279 Original CRISPR TTGCCCAGGCTGAAGTGCAG TGG Intergenic
Too many off-targets to display for this crispr